ID: 1113752585

View in Genome Browser
Species Human (GRCh38)
Location 13:112786601-112786623
Sequence GCCCGTCCACGCGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 5, 2: 0, 3: 1, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752585_1113752590 6 Left 1113752585 13:112786601-112786623 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752590 13:112786630-112786652 TGGGGTAAACTGTGCTTTCCAGG 0: 7
1: 0
2: 1
3: 14
4: 130
1113752585_1113752591 14 Left 1113752585 13:112786601-112786623 CCCAGGCACACGCGTGGACGGGC 0: 2
1: 5
2: 0
3: 1
4: 58
Right 1113752591 13:112786638-112786660 ACTGTGCTTTCCAGGTAATGCGG 0: 7
1: 0
2: 0
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752585 Original CRISPR GCCCGTCCACGCGTGTGCCT GGG (reversed) Intronic