ID: 1113752601

View in Genome Browser
Species Human (GRCh38)
Location 13:112786724-112786746
Sequence GCCCGTCCACGCGTGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 5, 1: 2, 2: 0, 3: 6, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113752601_1113752606 -2 Left 1113752601 13:112786724-112786746 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752606 13:112786745-112786767 GCTGCACATGGGGATGCCTGTGG 0: 1
1: 0
2: 3
3: 25
4: 293
1113752601_1113752607 1 Left 1113752601 13:112786724-112786746 CCCACGCACACGCGTGGACGGGC 0: 5
1: 2
2: 0
3: 6
4: 30
Right 1113752607 13:112786748-112786770 GCACATGGGGATGCCTGTGGCGG 0: 1
1: 0
2: 0
3: 25
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113752601 Original CRISPR GCCCGTCCACGCGTGTGCGT GGG (reversed) Intronic