ID: 1113754324

View in Genome Browser
Species Human (GRCh38)
Location 13:112799418-112799440
Sequence TGGAGGTGGGGCAGTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 862
Summary {0: 1, 1: 0, 2: 6, 3: 111, 4: 744}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113754317_1113754324 3 Left 1113754317 13:112799392-112799414 CCGAGAAAGGAGTCAGCAAAGGG 0: 8
1: 139
2: 94
3: 523
4: 1044
Right 1113754324 13:112799418-112799440 TGGAGGTGGGGCAGTTCTATAGG 0: 1
1: 0
2: 6
3: 111
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113754324 Original CRISPR TGGAGGTGGGGCAGTTCTAT AGG Intronic
900737272 1:4306869-4306891 TGGTGGTGGGGCATTTGTCTGGG + Intergenic
902969998 1:20041392-20041414 TAGGGGTGGGGCAGTTTTATAGG + Intronic
903052574 1:20612568-20612590 TCAGGGTGGGGCAGTTTTATAGG - Intronic
903268386 1:22172485-22172507 TGGTGGTGGGGCTGTTGCATGGG + Intergenic
903395319 1:22997619-22997641 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
903396296 1:23004110-23004132 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
903439172 1:23374584-23374606 TAGGGGTGGGGCCGTTGTATAGG - Intergenic
903631990 1:24781582-24781604 TGGGGGTGGAGCAGTGCTGTGGG + Intronic
903972941 1:27130966-27130988 TGGGCATGGGGCACTTCTATGGG - Intronic
904401267 1:30258158-30258180 AGGAGGAGGGGCAGGTCTACTGG - Intergenic
904533176 1:31182212-31182234 GGGAGGCCGGGCAGTCCTATGGG + Intronic
904989291 1:34578624-34578646 GGAAGGTGGGGCAGGTCTAGGGG - Intergenic
905332271 1:37213502-37213524 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
905499454 1:38425388-38425410 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
905500248 1:38430643-38430665 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
906049243 1:42857011-42857033 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
906049670 1:42859748-42859770 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
906378460 1:45316211-45316233 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
907777395 1:57531347-57531369 TAGGGGTGGGGCAGTTTTATAGG - Intronic
908824895 1:68123856-68123878 GGGAAGTGGGGCAGCTCTAAGGG - Intronic
909014460 1:70367924-70367946 TAGGGGTGGGGCCGTTTTATAGG - Exonic
909015330 1:70373887-70373909 TAGGGGTGGGGCCGTTTTATAGG - Intronic
909222268 1:72980560-72980582 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
909300123 1:74002491-74002513 TAGCGGTGGGGCCGTTTTATAGG + Intergenic
909519600 1:76552000-76552022 TGCAGGTGGGGGAGGTCAATGGG + Intronic
909776210 1:79488722-79488744 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
909776990 1:79493823-79493845 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
910003061 1:82360274-82360296 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
910868195 1:91806949-91806971 TTGAAGTGAGGCAGTGCTATTGG - Intronic
911071725 1:93836952-93836974 ATGGGGTGGGGCAGTTTTATAGG - Intronic
911147438 1:94566582-94566604 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
911158316 1:94657607-94657629 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
911895844 1:103433876-103433898 TGGCGGTGGGGGTGTTGTATGGG - Intergenic
912296919 1:108478507-108478529 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
912813289 1:112809943-112809965 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
912814768 1:112820247-112820269 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
912815608 1:112825775-112825797 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
912939479 1:114032346-114032368 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
913039821 1:115011442-115011464 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
913095934 1:115515143-115515165 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
913575622 1:120171162-120171184 CGGAGGTGGGGCTGTGATATCGG + Intronic
914557936 1:148786732-148786754 TGGAGGTGGGGCTGTGACATCGG + Intergenic
914614898 1:149343498-149343520 TGGAGGTGGGGCTGTGACATCGG - Intergenic
916328597 1:163591571-163591593 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
916866542 1:168865779-168865801 TAGGGGTAGGGCAGTTTTATAGG + Intergenic
917109843 1:171536105-171536127 TGGAGGAGGGACAGTACTACTGG - Exonic
917742021 1:177970029-177970051 TGGAGGTTGGGCAGTTGCAAAGG - Intronic
918042374 1:180921137-180921159 TAGGGGTGGGGCCGTTTTATAGG + Intronic
918567180 1:185948393-185948415 TAGGGGTGGGGCCGTTTTATAGG + Intronic
918568045 1:185953878-185953900 TAGGGGTGGGGCCGTTTTATAGG + Intronic
918645769 1:186902778-186902800 TAGGGGTGGGGCAGTTTTATAGG - Intronic
919091196 1:192980289-192980311 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
919306608 1:195848250-195848272 TGGGGGTGGGGCCATTTTATAGG + Intergenic
919759909 1:201091466-201091488 TGGAGGAAGGGCAGCTCTACTGG - Intronic
920723069 1:208406734-208406756 GGGAGGAGGGGCAGTGCTATGGG - Intergenic
920831722 1:209471676-209471698 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
921508964 1:216008417-216008439 TAGGGGTGGGGCCGTTTTATAGG - Intronic
921509748 1:216013733-216013755 TAGGGGTGGGGCTGTTTTATAGG - Intronic
921516981 1:216105419-216105441 TAGAGGTAAGGCAGTTCAATGGG - Intronic
922048086 1:221966218-221966240 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
922363858 1:224845798-224845820 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
922460378 1:225810687-225810709 TAGGGGTGGGGCCGTTTTATAGG + Intronic
922598704 1:226833805-226833827 TAGGGGTGGGGCAGGTTTATAGG - Intergenic
922599406 1:226838267-226838289 CAGGGGTGGGGCAGTTTTATAGG - Intergenic
922876974 1:228947719-228947741 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
922934489 1:229412683-229412705 TAAGGGTGGGGCAGTTTTATAGG - Intergenic
923408146 1:233683563-233683585 TAGAGGTGGGGCCGTTTTATAGG + Intergenic
923408974 1:233688887-233688909 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
923762660 1:236861047-236861069 TGGAGGTAAGGCAGTTTTTTAGG + Intronic
924181168 1:241439748-241439770 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
924727640 1:246684977-246684999 TCGGGGTGAGGCAGTTTTATAGG - Intergenic
1062931286 10:1354435-1354457 TGGGGGTGGGGCCGTTTTATAGG - Intronic
1063509113 10:6629693-6629715 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1063509974 10:6635207-6635229 TGGGGGTGGGGCCGTTTTATAGG + Intergenic
1063527206 10:6797197-6797219 TGGGGGTGGGGCCGTTTTATAGG + Intergenic
1063557101 10:7091332-7091354 TCGAAGTGGGGCTGTTCAATTGG - Intergenic
1064427570 10:15243695-15243717 TAGAGGGAGGACAGTTCTATTGG - Intronic
1064636843 10:17377264-17377286 GAGGGGTGGGGCAGTTTTATAGG - Intronic
1064887336 10:20124648-20124670 TGGGGGTGGGGCCGTTTTATAGG + Intronic
1065437308 10:25716696-25716718 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1065438196 10:25722790-25722812 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1065498314 10:26352725-26352747 TAGGGGTGGGGCAATTTTATAGG - Intergenic
1065610258 10:27465624-27465646 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1065611030 10:27470801-27470823 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1065706199 10:28473696-28473718 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1066240821 10:33533212-33533234 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1067353972 10:45506780-45506802 TTGGGGTGGGGCAGTTTTATAGG + Intronic
1068041191 10:51826301-51826323 GGGATCTGGGGCAGTTATATTGG - Intronic
1068057870 10:52033871-52033893 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1068179964 10:53504392-53504414 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1068349431 10:55823554-55823576 TAGGGGTGTGGCAGTTTTATAGG - Intergenic
1068361143 10:55975952-55975974 TAGTGGTGGGGCCGTTTTATAGG - Intergenic
1068782216 10:60932584-60932606 TGGGGGTGGGGCACATCTAAGGG + Intronic
1069739276 10:70677256-70677278 TGGAGGTGGGGCTGTTCAGTGGG + Intronic
1070894192 10:79967932-79967954 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1070975072 10:80599937-80599959 TGGAGGTGGGGAAGTGATGTGGG - Intronic
1071186979 10:83057745-83057767 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1071187795 10:83063228-83063250 CAGGGGTGGGGCAGTTTTATAGG - Intergenic
1071196580 10:83167415-83167437 TAAGGGTGGGGCAGTTTTATAGG - Intergenic
1071590211 10:86865465-86865487 TGAGGGTGGGGCCGTTTTATAGG - Intronic
1072223784 10:93349335-93349357 TGGAGGTGGGGCACAGTTATGGG + Intronic
1072413662 10:95229403-95229425 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1073280805 10:102352639-102352661 TGGATGGGGGGTAGTTCTCTGGG + Intronic
1073394312 10:103205737-103205759 TAGGGGTGGGACAGTTTTATAGG - Intergenic
1073683262 10:105727866-105727888 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1073933316 10:108600678-108600700 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1074990538 10:118702217-118702239 ATGAGCTGGGGCAGTTTTATAGG - Intronic
1075014485 10:118900213-118900235 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1075248402 10:120845265-120845287 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1075249177 10:120850425-120850447 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1075464214 10:122639419-122639441 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1075679622 10:124322977-124322999 TGGAGGTGGGAGAGTTCTCGTGG - Intergenic
1076616856 10:131760703-131760725 TGGAGGTCTGGCAGCTTTATTGG - Intergenic
1076832668 10:133004477-133004499 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1077002923 11:333880-333902 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1077338394 11:2015524-2015546 TGGACGAAGGGCAGTTCTAGGGG - Intergenic
1077397302 11:2331359-2331381 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1077553127 11:3211892-3211914 TAGGAGTGGGGCAGTTTTATAGG - Intergenic
1077883873 11:6371524-6371546 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1078709550 11:13777664-13777686 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1079447155 11:20568176-20568198 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1079725836 11:23879833-23879855 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1079854156 11:25579507-25579529 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1080994605 11:37583176-37583198 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1081357171 11:42125214-42125236 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1081839262 11:46184525-46184547 TGGAGATGGGGCAGGTATGTAGG + Intergenic
1082633135 11:55563759-55563781 TGGGCATGGGGCAGTTTTATAGG - Intergenic
1083353056 11:62044831-62044853 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1083653848 11:64219733-64219755 TGGTGGTGAGGCTGTCCTATGGG - Exonic
1083989495 11:66238156-66238178 TGGGGGTGGGGGGGTTCTTTAGG - Intronic
1084355034 11:68632662-68632684 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1084585262 11:70057539-70057561 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1085111657 11:73895270-73895292 TGGAGGAGGAGGAGTTGTATTGG + Intronic
1085181188 11:74538071-74538093 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1085281223 11:75332106-75332128 TAGGGGTGGGGCAGTTTTACAGG - Intronic
1085570685 11:77555566-77555588 TAGGGGTGGGGCAGTTTCATAGG - Intronic
1085612723 11:77967226-77967248 TGGAGGTGGGGCCTTTCAGTAGG + Intronic
1085901074 11:80700280-80700302 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1085946590 11:81280098-81280120 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1085988578 11:81812543-81812565 TAGGGGTGGGGCAATTTTATAGG - Intergenic
1087100134 11:94355400-94355422 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1087196559 11:95309752-95309774 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1087384061 11:97447086-97447108 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1087839873 11:102909613-102909635 TAGAGGTGGGGCCGTTTTATAGG + Intergenic
1089178687 11:116566225-116566247 TGGAGATGGGGCCTTTCTTTGGG - Intergenic
1089235376 11:117020019-117020041 TTGAGGTGGGGCTTTTCTTTGGG - Intronic
1089349473 11:117814193-117814215 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1090545990 11:127769033-127769055 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1090850113 11:130564503-130564525 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1090850923 11:130569797-130569819 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1202821378 11_KI270721v1_random:70706-70728 TGGACGAAGGGCAGTTCTAGGGG - Intergenic
1092474141 12:8805147-8805169 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1092474948 12:8810444-8810466 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1092723258 12:11462283-11462305 TAGGGGTGGGGCTGTTTTATAGG + Intronic
1093072915 12:14725004-14725026 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1093301969 12:17470176-17470198 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1093303106 12:17478345-17478367 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1093563506 12:20573344-20573366 TGGTGGTGAAGCAGTTCCATGGG + Intronic
1094029366 12:25993137-25993159 GGGAGCGGGGGCAGTTCTGTGGG - Intronic
1094589535 12:31807511-31807533 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1094723690 12:33090535-33090557 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1095386347 12:41655037-41655059 TTGAGATGGGGCAGTTATGTCGG - Intergenic
1095897675 12:47296517-47296539 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1096611639 12:52805863-52805885 TGGAGGTGGAGCAGGTCTTCTGG - Intergenic
1096890558 12:54766537-54766559 TGGTGGCGGGGCAGTGCTACTGG + Intergenic
1096906659 12:54942653-54942675 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1096907452 12:54948092-54948114 TAGGGGTGGGGCTGTTTTATAGG + Intronic
1097417372 12:59328619-59328641 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1097542513 12:60957327-60957349 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1097544291 12:60979388-60979410 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1097690521 12:62730122-62730144 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1098055263 12:66498090-66498112 TAAGGGTGGGGCAGTTTTATAGG - Intronic
1098630298 12:72714064-72714086 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1098653325 12:73001962-73001984 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1099498083 12:83377483-83377505 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1099872550 12:88368338-88368360 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1100215012 12:92438638-92438660 TGGAGGTGGGGCATTTGTGAGGG + Intergenic
1100263816 12:92957164-92957186 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1100560957 12:95749146-95749168 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1101577900 12:106014760-106014782 TGGAGGTGGATCAGTTATCTTGG - Intergenic
1102117070 12:110410817-110410839 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1102600023 12:114022576-114022598 TAGAGGTGGGGCCGTTTTATAGG - Intergenic
1103873363 12:124107204-124107226 TAGGGGTGAGGCAGTTTTATAGG + Intronic
1104534459 12:129605916-129605938 TGCAGCTGGAGCAGCTCTATGGG - Intronic
1104675459 12:130709390-130709412 TGGGGCTGGGGCAGGTCTCTGGG + Intronic
1105660383 13:22487712-22487734 TGGAGGTGGGCTTGTTCTAAAGG + Intergenic
1106232700 13:27833479-27833501 TGGAGATGGGGAAGGTCCATTGG - Intergenic
1106943804 13:34803248-34803270 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1108196661 13:48001898-48001920 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1108196997 13:48004712-48004734 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1108912939 13:55578340-55578362 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1109041913 13:57349351-57349373 TGGAGCTGGGGTGGTGCTATAGG - Intergenic
1109302719 13:60605582-60605604 TGGAAGTGGTGCAGATTTATGGG + Intergenic
1109422525 13:62132030-62132052 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1109465217 13:62722980-62723002 TGGAGGTGGGGTAGTCATAATGG - Intergenic
1109709183 13:66141446-66141468 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1109709981 13:66146719-66146741 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1110765124 13:79274355-79274377 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1110765956 13:79279687-79279709 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1110815751 13:79858373-79858395 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1110845893 13:80189845-80189867 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1111631223 13:90848687-90848709 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1111956336 13:94762841-94762863 TGGGGTGGGGGCAGTTATATTGG - Intergenic
1112918608 13:104581741-104581763 TGGAGATGGGGCGGCTCTTTGGG + Intergenic
1113324823 13:109270979-109271001 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1113461736 13:110486711-110486733 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1113754324 13:112799418-112799440 TGGAGGTGGGGCAGTTCTATAGG + Intronic
1114221413 14:20701118-20701140 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1114346067 14:21796532-21796554 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1114540991 14:23458142-23458164 TGGAGGTGGGGCAGTCTTGTGGG + Intergenic
1115335945 14:32244450-32244472 TGGAGAGGGGGCAGTTCACTGGG + Intergenic
1115650035 14:35396565-35396587 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1115949118 14:38699902-38699924 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1116865552 14:50028802-50028824 TAGGAGTGGGGCAGTTTTATAGG - Intergenic
1116867956 14:50046609-50046631 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1116952577 14:50893474-50893496 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1116953146 14:50896744-50896766 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1117957403 14:61133355-61133377 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1117958245 14:61138876-61138898 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1118323687 14:64767834-64767856 TGGAGGTGTGCCAGTTCTCGAGG - Exonic
1119247874 14:73128565-73128587 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1119248664 14:73133779-73133801 TGGGGGTGGGGCAGTTTTATAGG + Intergenic
1120305123 14:82760265-82760287 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1120537699 14:85716986-85717008 TTGAGGTGGGGCATTTTTAGAGG - Intergenic
1121192379 14:92041871-92041893 TAGGGGTGGGGCAGTTTTATAGG + Exonic
1121389864 14:93564687-93564709 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1121499352 14:94421258-94421280 TGGAGATGGGACATTTGTATTGG - Intergenic
1121702785 14:95968507-95968529 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1121704155 14:95978726-95978748 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1122381628 14:101310963-101310985 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1122529007 14:102411606-102411628 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1122754084 14:103963903-103963925 TGGAGGTCGGGGAGTTCTGGAGG + Intronic
1123200606 14:106660083-106660105 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1202876026 14_KI270722v1_random:1054-1076 TGGTGGGGGGGCAGTCCTGTGGG + Intergenic
1124140365 15:27072086-27072108 TGGAGGTGGGGTACTTCGAAAGG - Intronic
1124229729 15:27933579-27933601 TAGGGATGGGGCAGTTTTATAGG + Intronic
1125046398 15:35246121-35246143 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1125047118 15:35254783-35254805 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1126154348 15:45551351-45551373 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1126844333 15:52745068-52745090 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1127085169 15:55417832-55417854 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1127099721 15:55552563-55552585 TGGAGGTGGGGCTTTTTTTTTGG - Intronic
1128154971 15:65386317-65386339 TGGGAGTGAGGCAGTTCTGTTGG + Intronic
1128240240 15:66096574-66096596 TGGCGGTGGGGCCGTTCCAGAGG + Intronic
1128766923 15:70256906-70256928 TGGGGGTGGGGTGCTTCTATAGG - Intergenic
1129259155 15:74354404-74354426 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1129259929 15:74359649-74359671 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1129392582 15:75227882-75227904 TGGGGGTGGGGCAGCACTGTAGG + Intergenic
1129471814 15:75760314-75760336 TGGGGGTGGGGCAGCACTGTAGG - Intergenic
1130082683 15:80748040-80748062 TGGAGGTGAGGACTTTCTATGGG - Intronic
1130995002 15:88898809-88898831 AGGGGGTGGGGCGGGTCTATGGG - Exonic
1131068709 15:89450544-89450566 TGGAGATGGGGCATCTCAATCGG - Intergenic
1132262663 15:100440471-100440493 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1132263536 15:100446065-100446087 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1132340912 15:101078157-101078179 TGGGGGTGGGGCCGTTTTATAGG - Intronic
1133007102 16:2889725-2889747 TGGGGGTGGGGAAGATCTATAGG - Intronic
1133651066 16:7814960-7814982 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1133937820 16:10283432-10283454 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1133962373 16:10505722-10505744 TAGAGGTGGGGCTGTTTTATAGG - Intergenic
1134124158 16:11605057-11605079 TGGACGTGGGGCACTTGAATGGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1136988860 16:35139959-35139981 TGCAGGCGGGCCAGTTCTCTTGG - Intergenic
1137893805 16:52189605-52189627 TGGAGGTGGGGCACAGCAATAGG + Intergenic
1138246920 16:55474516-55474538 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1138766667 16:59613426-59613448 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1138804557 16:60078849-60078871 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1138805429 16:60084442-60084464 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1138815757 16:60200993-60201015 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1139013549 16:62662701-62662723 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1139230099 16:65275372-65275394 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1140076918 16:71708439-71708461 ATGGGGTGGGGCAGTTTTATAGG - Intronic
1141796419 16:86278397-86278419 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1142248822 16:88981854-88981876 TGGCCCTGGGGCAGCTCTATCGG + Intergenic
1142855852 17:2729774-2729796 GGGAGCTGGGGGAGTTCAATGGG - Intergenic
1143639649 17:8188876-8188898 TGTATGTGGGGAAGTTCTAACGG - Exonic
1143711265 17:8736784-8736806 GGGAGGTGAGGCAGTGCTACAGG + Intronic
1144104297 17:11972051-11972073 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1144105064 17:11976809-11976831 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1144301870 17:13928681-13928703 TAAGGGTGGGGCAGTTTTATAGG + Intergenic
1144303939 17:13950281-13950303 TGGATGATGGGCAGTTCTAAAGG - Intergenic
1145024596 17:19458446-19458468 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1146005214 17:29156422-29156444 TGGAGGAGAGGCAGCTCTGTGGG - Intronic
1146165966 17:30589008-30589030 TAGGGGTGGGGCAGCTTTATAGG + Intergenic
1146181896 17:30703787-30703809 TGGAGAGGGGGCAGTTTTGTAGG - Intergenic
1146597542 17:34183486-34183508 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1146598384 17:34188869-34188891 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1147808341 17:43148413-43148435 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1149266754 17:54935187-54935209 TAGGGGTGGGGCAGTTTTATAGG + Intronic
1149320495 17:55476384-55476406 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1151029855 17:70724061-70724083 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1151543935 17:74780531-74780553 TGGTCGTGGGACAGTTCTGTGGG - Intronic
1152804031 17:82346484-82346506 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1153834833 18:8954624-8954646 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1154213740 18:12400409-12400431 TGGAAGTGGTACAGTTCTTTTGG + Intergenic
1155156632 18:23163157-23163179 TGGAGATGGGGCAGTTTGAAGGG + Intronic
1155174374 18:23289910-23289932 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1155486219 18:26345521-26345543 TGGAGGTGGTGCAGTTTTGCTGG - Intronic
1155696521 18:28693142-28693164 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1155720036 18:29000462-29000484 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1155892201 18:31284313-31284335 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1155942093 18:31809922-31809944 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1155991314 18:32282078-32282100 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1156014548 18:32533313-32533335 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1156591149 18:38489986-38490008 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1156610120 18:38715547-38715569 TGGAGGTGGGTGAGTTATCTGGG + Intergenic
1156938299 18:42737302-42737324 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1156938997 18:42742211-42742233 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1157896153 18:51470300-51470322 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1159130460 18:64275442-64275464 TAAGGGTGGGGCAGTTTTATAGG + Intergenic
1159835528 18:73330226-73330248 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1159929833 18:74298908-74298930 TAGGGCTGGGGCAGTTTTATAGG - Intergenic
1160572823 18:79830575-79830597 TGGAGCTGGGGCGGTTCTGGAGG - Intergenic
1161662088 19:5553074-5553096 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1161824333 19:6552090-6552112 TGGAGCTGGGGCCGTGCTTTGGG - Intergenic
1161827354 19:6577162-6577184 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1162261731 19:9539635-9539657 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1162263376 19:9550434-9550456 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1162266793 19:9582508-9582530 TAGGGGTCGGGCAGTTTTATAGG - Intronic
1162329397 19:10018303-10018325 TGGAGGTGGGGCAGATTTTATGG + Intronic
1162432281 19:10636316-10636338 TGGAGGAGGGGAAGGTCTGTGGG - Exonic
1162708235 19:12571960-12571982 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1162986839 19:14276263-14276285 AAGGGGTGGGGCAGTTTTATAGG - Intergenic
1164080540 19:21858371-21858393 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1164202759 19:23031957-23031979 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1164219069 19:23177250-23177272 TAGGCGTGGGGCAGTTTTATAGG - Intergenic
1164258497 19:23549770-23549792 TAGGAGTGGGGCAGTTTTATAGG - Intronic
1164259259 19:23554917-23554939 TAGGGGTGGGGCAATTTTATAGG - Intronic
1165248928 19:34514358-34514380 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1165317923 19:35067868-35067890 TAGGGGTGGGGCCGTTTTATGGG + Intergenic
1165497312 19:36160708-36160730 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1166192825 19:41186836-41186858 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1166396791 19:42447069-42447091 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1166411380 19:42557653-42557675 TGGGGGTGGGACAGTTTTACAGG - Intronic
1167883900 19:52484820-52484842 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1167901697 19:52627178-52627200 ATGGGGTGGGGCAGTTTTATAGG - Intronic
1167917865 19:52756727-52756749 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1168211560 19:54894411-54894433 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1168227516 19:55006941-55006963 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
924990864 2:311921-311943 TGGAGGTGGTGTAATTCTGTGGG + Intergenic
925544180 2:5001080-5001102 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
926243365 2:11104733-11104755 TGGTGGCGGGGCAGTGCTCTTGG - Intergenic
926414073 2:12632121-12632143 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
926815891 2:16797386-16797408 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
927133904 2:20082858-20082880 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
927134673 2:20087988-20088010 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
927481155 2:23455199-23455221 TGGAAGTGGGACAATTTTATGGG - Intronic
927632324 2:24785261-24785283 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
928410224 2:31048818-31048840 AGGACGTGGGGCACTTCTCTGGG - Intronic
929383228 2:41378124-41378146 TAGGGGTGGGGCAGTTTTACAGG - Intergenic
929384299 2:41385578-41385600 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
930112198 2:47688209-47688231 TAGGGATGGGGCAGTTTTATAGG - Intergenic
930272945 2:49277850-49277872 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
931026725 2:58118813-58118835 TAGGGGTGGGGCCGTTTTATAGG + Intronic
931850877 2:66249410-66249432 TAAAGGTGGGGCCGTTTTATAGG - Intergenic
931947916 2:67331782-67331804 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
932071679 2:68626905-68626927 TGGAGGAGGGACTGCTCTATTGG + Intronic
932295490 2:70620761-70620783 TAGGGGTGGGGCCGTTTTATAGG - Intronic
932335818 2:70930881-70930903 TGGAGCTGGGGCAGGTGTACCGG - Intronic
932853720 2:75213845-75213867 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
932873910 2:75430959-75430981 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
932973435 2:76573739-76573761 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
933012734 2:77088538-77088560 TAGGGGTGGGGCCGTTTTATAGG - Intronic
933013569 2:77093981-77094003 TAGGGGTGGGGCAGTTTTATAGG - Intronic
933073867 2:77897499-77897521 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
933138531 2:78764132-78764154 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
933329200 2:80875913-80875935 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
933551934 2:83789061-83789083 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
933790400 2:85879496-85879518 AGGGGGAGGGGCAGTTCTAGGGG - Intronic
934142146 2:89056830-89056852 TAGTGGTGGGGCAGTTTTATAGG - Intergenic
934227095 2:90143716-90143738 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
934886663 2:98031167-98031189 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
934888434 2:98045309-98045331 TAGGGGTGAGGCAGTTTTATAGG + Intergenic
934930890 2:98421880-98421902 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
935213047 2:100954735-100954757 TGGAGTTGGAGAAGTTGTATGGG - Intronic
936682513 2:114790586-114790608 TAAAGGTGGGGCCGTTTTATAGG + Intronic
937968800 2:127534487-127534509 TTGAAGTGGGGCAGTTTTGTGGG - Intergenic
938099553 2:128489522-128489544 GGGAGGAGGGGCAGTTCCAGTGG - Intergenic
940183614 2:150959967-150959989 TGGGGGTGGGACAGTTTTATAGG - Intergenic
940726682 2:157343183-157343205 TAGGGGTGGGACAGTTTTATAGG + Intergenic
940726977 2:157345310-157345332 TAGGAGTGGGGCAGTTTTATGGG - Intergenic
940951828 2:159683840-159683862 TTGAGATGGGGCAGTTGTCTTGG - Intergenic
941528998 2:166641585-166641607 CAGGGGTGGGGCAGTTTTATAGG + Intergenic
941936219 2:170983098-170983120 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
942729789 2:179051701-179051723 TAGGGGTGGGGCCGTTTTATGGG + Intergenic
942976373 2:182023472-182023494 TGGAGGTGGGGCAGTTGCCAAGG - Intronic
943061287 2:183044344-183044366 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
943196574 2:184759880-184759902 TAGAGGTGGGGCTGTTTTATAGG - Intronic
943439928 2:187915999-187916021 TGGAGGTGGGGCAGCTGGCTGGG + Intergenic
943807111 2:192135973-192135995 TAGGGGTGGGGCCGTTTTATAGG - Intronic
943896029 2:193360941-193360963 TAGAGGTGTGGAAGTTCTACTGG - Intergenic
944148386 2:196530946-196530968 AGGAGGTGGGAGAGTTCTAGAGG - Intronic
944591451 2:201221566-201221588 TAGGGGTGGGGCCGTTTTATAGG - Exonic
945360801 2:208894033-208894055 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
945362163 2:208905337-208905359 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
945554437 2:211262044-211262066 TAGGGGTGGGGTAGTTTTATAGG - Intergenic
945857866 2:215090169-215090191 TAGGGGTGGGGCAGTTTTATAGG - Intronic
945858683 2:215095895-215095917 TAGGGGTGGGGCAGTTTTATAGG - Intronic
946781364 2:223195216-223195238 TAGGGGTGGGGCCGTTTTATAGG + Intronic
947617864 2:231569756-231569778 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
947755818 2:232564242-232564264 TGCAGGTGGAGCAGTTCTGGAGG + Exonic
948391167 2:237612518-237612540 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
948752922 2:240142950-240142972 TGGCGGTGGGGCAGTGCAAGTGG - Intronic
948892070 2:240912321-240912343 CTGAGGTGGGGCAGCTTTATGGG - Intergenic
1168820051 20:766657-766679 TAGGGGTGGGGCAGTTTTATAGG - Intronic
1168839660 20:901463-901485 ATGGGGTGGGGCAGTTTTATAGG - Intronic
1170068382 20:12340383-12340405 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1172442695 20:34977322-34977344 TGGAGGTGGGGTATTTTTCTGGG + Intronic
1173101551 20:40093405-40093427 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1173102379 20:40098871-40098893 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1173632201 20:44525039-44525061 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1173952569 20:47005034-47005056 TGGAGGTGGGTAAGCTGTATAGG - Exonic
1175317546 20:58059544-58059566 TGGAGGTTGTGCAGTGCTAAGGG + Intergenic
1175504645 20:59472967-59472989 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1177080310 21:16631318-16631340 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1177376243 21:20274083-20274105 TAGGAGTGGGGCAGTTTTATAGG - Intergenic
1177840235 21:26227997-26228019 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1177884780 21:26734386-26734408 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1179062073 21:37988517-37988539 TGGGGGTGGGGCAGTTTTATAGG - Intronic
1179445049 21:41425248-41425270 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1179893000 21:44346582-44346604 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1180560575 22:16611608-16611630 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1180561147 22:16615011-16615033 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1181487672 22:23241766-23241788 TGGAGGTGGGGCAGGGCTGGGGG - Intronic
1181803724 22:25362753-25362775 TGGACGTGGGGCTGTGCTAGGGG - Intronic
1182032063 22:27167229-27167251 TGGAAGTGGGGCAGATGTGTAGG - Intergenic
1182841195 22:33391366-33391388 GGGAGGTGGGGAAGAACTATGGG + Intronic
1183046936 22:35227870-35227892 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1183636443 22:39066210-39066232 TAGGGGTGGGGCAGTTTTATAGG + Intronic
1183636698 22:39068050-39068072 TAGGGGTGGGACAGTTTTATAGG + Intronic
1183646577 22:39130613-39130635 TAGGGGTGGGGCAGTTTTATAGG - Intronic
1184375348 22:44108587-44108609 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1184545078 22:45162406-45162428 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
949190027 3:1240882-1240904 TAGGGGTGGGGCTGTTTTATAGG + Intronic
949190656 3:1244737-1244759 TAGGGGTGGGGCTGTTTTATAGG + Intronic
949592472 3:5508833-5508855 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
949827909 3:8182580-8182602 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
950814226 3:15681809-15681831 TGAAGGTGGGGCAGTGCAACTGG + Intronic
950844397 3:16000475-16000497 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
951315817 3:21189134-21189156 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
951316503 3:21193919-21193941 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
953176839 3:40561162-40561184 TAGGGGTGGGGCCGTTTTATAGG - Intronic
953177662 3:40566538-40566560 TAGGGGTGGGGCCGTTTTATAGG - Intronic
953598891 3:44344769-44344791 TAGGGGTGGGGTAGTTTTATAGG + Intronic
953599703 3:44350142-44350164 TAGGGGTGGGGCAGTTTTATAGG + Intronic
953715469 3:45313545-45313567 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
953833905 3:46326852-46326874 TAGAGGTGGGGCAGTTTTATAGG + Intergenic
954162065 3:48729916-48729938 TAGGGATGGGGCAGTTTTATAGG + Intronic
954588239 3:51755941-51755963 TAGGGGTGGGGCAGATTTATAGG + Intergenic
954749426 3:52805279-52805301 TGGAGGTGGGGCAGGCCAGTAGG - Intronic
954971744 3:54657012-54657034 TAGGGGTGGGGCTGTTTTATAGG + Intronic
955380917 3:58437320-58437342 TAGCGGTGGGGCCGTTTTATAGG + Intergenic
955702150 3:61692587-61692609 TAGGGGTGGGGCCGTTTTATAGG + Intronic
957316346 3:78581326-78581348 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
957394154 3:79618590-79618612 TAAGGGTGGGGCAGTTTTATAGG - Intronic
957394581 3:79621305-79621327 TAGGGGTGGGGCAGTTTTATAGG - Intronic
957452031 3:80391303-80391325 TAGGGGTGGGGCTGTTTTATGGG - Intergenic
957729541 3:84115599-84115621 TAGGAGTGGGGCAGTTTTATAGG + Intergenic
957872647 3:86108810-86108832 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
957904212 3:86537182-86537204 TAGAGGTGGGACCGTTTTATAGG + Intergenic
957905137 3:86543612-86543634 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
957986271 3:87575624-87575646 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
958421687 3:93938305-93938327 TAGGGGTGGGGCCGTTTTATAGG - Intronic
958462182 3:94412839-94412861 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
958751477 3:98196655-98196677 TAGGGGTGGGGCTGTTTTATAGG - Intronic
959287879 3:104440044-104440066 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
959288698 3:104445458-104445480 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
959485290 3:106922879-106922901 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
959486080 3:106928095-106928117 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
959543588 3:107569484-107569506 TAGGGGTGGGGCCGTTTTATAGG + Intronic
959688776 3:109176514-109176536 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
959972598 3:112423028-112423050 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
960309650 3:116105473-116105495 TAGGGGTGGGGCCGTTTTATAGG + Intronic
960310496 3:116110913-116110935 TAGGGGTGGGGCCGTTTTATAGG + Intronic
960863068 3:122171411-122171433 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
961011661 3:123440496-123440518 TGGGGGTAGGGCTGTTCTCTGGG - Intronic
961293984 3:125869361-125869383 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
961731062 3:128965262-128965284 TAGGGGTGGGGCCGTTTTATAGG - Intronic
961881519 3:130064838-130064860 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
963112102 3:141696412-141696434 TAGAGGTGGGACAGTTTTATAGG + Intergenic
963246933 3:143072434-143072456 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
963320643 3:143805790-143805812 TAGGGGTGGGGCCGTTTTATAGG - Intronic
963321033 3:143809574-143809596 TGGAGGTGGGGCTGTTTTTAAGG + Intronic
963468300 3:145710710-145710732 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
963520182 3:146354088-146354110 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
963520938 3:146359327-146359349 TAGAGGTGGGGCCATTTTATAGG - Intergenic
963683983 3:148414558-148414580 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
965262133 3:166500716-166500738 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
965336023 3:167431550-167431572 TAGGGGTGGGGCCGTTCTATAGG - Intergenic
965336844 3:167436994-167437016 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
965450623 3:168833573-168833595 TAGGGGTGGGGCAGTTTTACAGG + Intergenic
965458342 3:168931029-168931051 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
965458603 3:168933067-168933089 TAGGGGTGGGACAGTTTTATAGG + Intergenic
965640386 3:170823468-170823490 TAGGGGTGGGGCCGTTTTATAGG + Intronic
966066239 3:175825359-175825381 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
967496702 3:190150068-190150090 TAGGGGTGGGGCTGTTTTATGGG - Intergenic
968062319 3:195735073-195735095 TGCAGGTGGGGCAGGTCCAGAGG - Intronic
968379671 4:80582-80604 TAGGGGTGGGGCAGTTTTATAGG + Intronic
968392869 4:207181-207203 TGGAGGTGGGGCAATTTACTGGG + Intergenic
968993835 4:3932944-3932966 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
969138389 4:5049469-5049491 TATGGGTGGGGCAGTTTTATAGG + Intergenic
969345688 4:6568398-6568420 TGGGGGTGGGACAGTGCTCTTGG + Intergenic
969906502 4:10401513-10401535 TGGAGGTGAGTCACTTCTAGTGG - Intergenic
969929536 4:10617151-10617173 GGGAGGTGAGGAAGTTCTATGGG - Intronic
970533275 4:17003789-17003811 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
970723587 4:19016626-19016648 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
971103532 4:23496723-23496745 GCGGGGTGGGGCAGTTTTATAGG - Intergenic
971180938 4:24328074-24328096 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
971199789 4:24501289-24501311 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
971980797 4:33747566-33747588 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
973004746 4:44993047-44993069 TGGAGATGGGGAAGTTCACTGGG - Intergenic
973632792 4:52835058-52835080 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
973944860 4:55945889-55945911 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
975934213 4:79559374-79559396 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
976217279 4:82727240-82727262 TGCAGGTGGTGCAGTTGTACAGG - Intronic
976695722 4:87918013-87918035 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
976696200 4:87922118-87922140 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
976739406 4:88343076-88343098 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
976740218 4:88348894-88348916 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
976884905 4:89970193-89970215 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
976983924 4:91268663-91268685 TAGGGGTGGGGCTGTTTTATAGG + Intronic
977446839 4:97141406-97141428 TAGAGGTGGGGCCATTTTATAGG + Intergenic
977506875 4:97913512-97913534 AGGAGGAGGAGCTGTTCTATAGG - Intronic
977781960 4:100991807-100991829 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
978001445 4:103559157-103559179 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
978047330 4:104146816-104146838 TGGAGGTGGGGCGGGTACATGGG - Intergenic
978244093 4:106551505-106551527 TAGGGGTGGGACAGTTTTATAGG - Intergenic
978302772 4:107290694-107290716 TAGGGGTTGGGCAGTTTTATAGG + Intergenic
978303488 4:107295588-107295610 TAGGGGTTGGGCAGTTTTATAGG + Intergenic
978439080 4:108714715-108714737 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
978540452 4:109811060-109811082 GTGGGGTGGGGCAGTTTTATAGG + Intergenic
978585727 4:110273847-110273869 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
978873399 4:113607676-113607698 TAGGGGTGGGACAGTTTTATAGG - Intronic
979054154 4:115975814-115975836 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
979146300 4:117252372-117252394 TAGAGGTGGGGCCTTTTTATAGG - Intergenic
979641107 4:123013065-123013087 TAGGGGTGGGGCCGTTTTATAGG + Intronic
979850651 4:125567120-125567142 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
979895437 4:126150229-126150251 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
980302494 4:131012185-131012207 TAGAGGTGGGGCTGTTTTATAGG - Intergenic
980389398 4:132123755-132123777 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
980416466 4:132495553-132495575 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
980471925 4:133263673-133263695 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
980472675 4:133268620-133268642 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
980491151 4:133531447-133531469 TAGAGGTGGGGCCATTTTATAGG + Intergenic
980611324 4:135167549-135167571 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
980829522 4:138113038-138113060 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
980903581 4:138928099-138928121 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
982180827 4:152746823-152746845 TGGGGGTGGGGCCATTTTATAGG + Intronic
982319515 4:154063666-154063688 TAGAGGTGAGGCAGTTTTATAGG - Intergenic
982396197 4:154918443-154918465 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
982490324 4:156021712-156021734 ATGGGGTGAGGCAGTTCTATAGG - Intergenic
983056025 4:163100053-163100075 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
983359327 4:166708773-166708795 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
983359533 4:166710301-166710323 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
983414273 4:167436142-167436164 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
983638279 4:169920050-169920072 TAGGGGTGGGGCACTTTTATAGG - Intergenic
983707386 4:170677910-170677932 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
983708030 4:170682200-170682222 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
983883187 4:172955764-172955786 TAGGGGTGGGGCCGTTTTATAGG + Intronic
984021421 4:174488412-174488434 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
984393924 4:179170232-179170254 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
984437843 4:179726760-179726782 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
984700281 4:182814605-182814627 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
984700989 4:182818781-182818803 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
985057664 4:186049385-186049407 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
985238676 4:187905451-187905473 TCGGGGTGGGGCAGTTTTAGGGG + Intergenic
986185059 5:5427920-5427942 TGTAGGAGGGACAGTTATATAGG + Intronic
986254677 5:6092253-6092275 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
986369250 5:7063429-7063451 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
986554544 5:8998481-8998503 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
987276820 5:16371761-16371783 TGGAGGCTGGGCACTTCTAGAGG - Intergenic
987282467 5:16425290-16425312 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
987679605 5:21118048-21118070 TAGGGATGGGGCAGTTTTATAGG + Intergenic
988847293 5:35141106-35141128 TGGAGATGGGGCAGCTATCTTGG + Intronic
989643799 5:43607467-43607489 TAGGGGTGGGGCAGTTTTATAGG - Intronic
989659668 5:43786724-43786746 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
989661053 5:43798046-43798068 TAGGGGTGGGGCAGTTTTATGGG - Intergenic
989687892 5:44110602-44110624 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
990367466 5:55085633-55085655 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
992439963 5:76789303-76789325 TAGCAGTGGGGCAGTTTTATAGG + Intergenic
992515675 5:77490344-77490366 TTGCAGAGGGGCAGTTCTATTGG - Intronic
992515774 5:77491315-77491337 TAGGGGTGGGGCCGTTTTATAGG - Intronic
992787471 5:80183763-80183785 TAGGGGTGGGGCCGTTTTATAGG - Intronic
992960495 5:81953527-81953549 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
992961341 5:81959099-81959121 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
993836324 5:92824037-92824059 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
994325517 5:98441200-98441222 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
994545118 5:101156153-101156175 TAGGGGTGGGGCAATTTTATAGG + Intergenic
996452118 5:123637110-123637132 TGCAGATGGAGCAGTTCAATGGG + Intergenic
996725916 5:126673344-126673366 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
996912393 5:128670436-128670458 TAAAGGTGGGGCCGTTTTATTGG + Intronic
999242834 5:150137516-150137538 TGGAGCTGCGGGAGTTCTCTGGG - Intronic
999906604 5:156148056-156148078 TGGAGGAGGGGTAGTTCTAGCGG - Intronic
1000158265 5:158573768-158573790 GCGTGGTGGGGCAGTTCTCTTGG - Intergenic
1000607536 5:163340459-163340481 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1001330990 5:170762195-170762217 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1001579292 5:172788012-172788034 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1001930738 5:175671096-175671118 TGGGGATGGGGCAGTGCTTTGGG + Intronic
1002611307 5:180420187-180420209 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1002992523 6:2250984-2251006 GGGAGGTGGTGCAGTTATAAAGG - Intergenic
1003100610 6:3173720-3173742 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1003430524 6:6033299-6033321 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1004167511 6:13270035-13270057 TGAAGTGGGGGCAGTTCTGTGGG - Intronic
1004283888 6:14302488-14302510 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1004496234 6:16165878-16165900 TGGGGGTAGGGCAGTCTTATGGG - Intergenic
1004507531 6:16259126-16259148 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1004508363 6:16264596-16264618 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1004574897 6:16886250-16886272 TGGGGGTGGGGCCGTTTTATAGG - Intergenic
1004575706 6:16891511-16891533 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1004768099 6:18754258-18754280 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1004768929 6:18759594-18759616 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1004807065 6:19214222-19214244 TAGGGGTGGGTCAGTTTTATAGG + Intergenic
1004837515 6:19544677-19544699 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1005672583 6:28122339-28122361 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1005786850 6:29252482-29252504 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1006085010 6:31589273-31589295 TAGTGGTGGGGCAGATTTATTGG + Intronic
1006525295 6:34599456-34599478 GGGAGGGAGGGCAGTACTATTGG + Intronic
1007012770 6:38433596-38433618 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1007084180 6:39131629-39131651 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1009464085 6:63950456-63950478 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1009711784 6:67332032-67332054 TGGAAGTGGAGGAGTTATATGGG + Intergenic
1009749663 6:67867744-67867766 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1010826483 6:80482916-80482938 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1012066855 6:94559275-94559297 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1014614196 6:123582450-123582472 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1014718279 6:124890702-124890724 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1014719374 6:124897625-124897647 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1014793505 6:125701962-125701984 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1014794362 6:125707428-125707450 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1015270118 6:131329001-131329023 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1015437092 6:133202036-133202058 TGGAGGTGGGGAAGAACCATGGG - Intergenic
1015928071 6:138329932-138329954 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1016205305 6:141460546-141460568 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1016302671 6:142649812-142649834 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1016518475 6:144923470-144923492 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1016750964 6:147630614-147630636 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1017269530 6:152490619-152490641 TAGGGGTGGGGCAGTTTTATAGG - Intronic
1017270427 6:152497032-152497054 CAGAGGTGGGGCAGTTTTATAGG - Intronic
1017606912 6:156144632-156144654 AGGAGGTGTGGCAGTGCTGTAGG + Intergenic
1018077306 6:160228913-160228935 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1019309103 7:351653-351675 TGGGGGTGGGGCAGGACTCTAGG - Intergenic
1020315714 7:6904065-6904087 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1020352191 7:7233150-7233172 TGGTTGTGGGGCAGTTCAACAGG + Intronic
1020456327 7:8377412-8377434 TGGAAATGGGGAAGTTCCATTGG - Intergenic
1020542104 7:9470920-9470942 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1021172408 7:17414359-17414381 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1021636990 7:22703631-22703653 TGGGGGTGGGGCCATTTTATAGG - Intergenic
1021637855 7:22709177-22709199 TGGGGGTGGGGCCATTTTATAGG - Intergenic
1021660354 7:22913691-22913713 TAGAGGTGTGGCAGTTTTATAGG - Intergenic
1021661133 7:22918791-22918813 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1021810328 7:24396561-24396583 TAAAGGTGGGGCCGTTTTATAGG - Intergenic
1022447949 7:30485146-30485168 TAGGGGTGGGACAGTTTTATAGG - Intergenic
1023732199 7:43202961-43202983 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1024169537 7:46769540-46769562 TAGGGGTGGGACAGTTTTATAGG - Intergenic
1024330025 7:48146388-48146410 TAAGGGTGGGGCAGTTTTATAGG + Intergenic
1024402512 7:48941276-48941298 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1024738095 7:52327369-52327391 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1026004942 7:66592959-66592981 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1026201495 7:68218407-68218429 TAGGGGTGGGGCAGCTTTATAGG + Intergenic
1026220147 7:68389023-68389045 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1027157484 7:75779174-75779196 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1027157956 7:75781798-75781820 TAGGGGTGGGGCTGTTTTATAGG - Intronic
1027158951 7:75788427-75788449 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1027471290 7:78577592-78577614 TAGGGGTGGGGCTGTTTTATAGG + Intronic
1027880819 7:83833799-83833821 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1028879131 7:95859765-95859787 TGGTGCTGGGGCAGGTCTGTAGG + Intronic
1028980176 7:96959095-96959117 TGGAGTTGAGGAAGTTCTCTTGG + Intergenic
1029316815 7:99723439-99723461 TAGGGGTGGGTCAGTTTTATAGG - Intronic
1029317752 7:99729797-99729819 TAGGGGTGGGGCAGTTTTATAGG - Intronic
1029462747 7:100705823-100705845 TGGAGGGGAGGCTGTTCTAGGGG - Intergenic
1029539734 7:101175561-101175583 TGGATCTGGGGCTGGTCTATGGG - Intronic
1030193164 7:106829936-106829958 TAGGGGTGGGGCAGTTCTATAGG - Intergenic
1030194384 7:106838383-106838405 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1030257848 7:107530786-107530808 TGGAGGGGAGGCAGCTATATTGG - Intronic
1030441181 7:109591935-109591957 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1031005139 7:116461040-116461062 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1031193148 7:118580843-118580865 TAGGGGTGGGGGAGTTTTATAGG + Intergenic
1031297113 7:120014699-120014721 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1031355542 7:120782600-120782622 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1031775995 7:125910279-125910301 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1031977081 7:128101000-128101022 TGGAGCAGGGGCAGTGCTAGGGG + Intergenic
1032398006 7:131604574-131604596 TGGAGGGGGATCAGTTCTGTGGG + Intergenic
1033172140 7:139093681-139093703 TGAGGGTGGGGCCGTTTTATAGG - Intronic
1033671327 7:143496181-143496203 TAGTGGTGGGGCAGTTCCAAAGG - Intergenic
1033675476 7:143537349-143537371 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1033696361 7:143792095-143792117 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1034018043 7:147608825-147608847 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1035048333 7:155983638-155983660 TGGCAGTGGGGCAGTGCTGTTGG - Intergenic
1036371824 8:8168938-8168960 TAGGGGTGGGGCAATTTTATAGG - Intergenic
1036471782 8:9059026-9059048 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1036486499 8:9184200-9184222 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1036549359 8:9803209-9803231 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1036550224 8:9809160-9809182 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1036640003 8:10577193-10577215 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1036879078 8:12496706-12496728 TAGGGGTGGGGCAATTTTATAGG + Intergenic
1037129920 8:15395547-15395569 TGGATGTGGGGCAGTTAGGTGGG - Intergenic
1037784612 8:21895165-21895187 TGGTGGTGGGGCTTTTCCATGGG + Intergenic
1038405629 8:27320403-27320425 GGGAGTTGGGGCAGTCCTGTGGG - Intronic
1038476714 8:27873607-27873629 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1039067994 8:33626263-33626285 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1039266411 8:35829137-35829159 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1039499263 8:38003813-38003835 TAGGGGTGGGGTAGTTTTATAGG + Intergenic
1039669461 8:39580338-39580360 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1040648615 8:49426191-49426213 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1041270892 8:56107626-56107648 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1041333521 8:56754035-56754057 TAGAGGTGGTGCAGTGGTATTGG + Intergenic
1042036378 8:64538841-64538863 TGGAAGAGGGTGAGTTCTATTGG - Intergenic
1042706632 8:71670313-71670335 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1043028799 8:75105682-75105704 TGAAGTGGGGGCAGTTTTATGGG - Intergenic
1043599461 8:81919753-81919775 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1043604455 8:81983184-81983206 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1043720599 8:83544017-83544039 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1043721502 8:83550531-83550553 TAGGGGTGGGGCAGTTTTATTGG - Intergenic
1044019079 8:87082308-87082330 TAGGGGTGGGGCAGTTTTATAGG - Intronic
1044258146 8:90090340-90090362 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1044258924 8:90095551-90095573 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1044587145 8:93878469-93878491 TAGGGGTGGGGCAGTTTCATAGG + Intronic
1044921627 8:97175325-97175347 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1044922468 8:97180601-97180623 TGGGGGTGGGGCCGTTTTATAGG - Intergenic
1045197146 8:99943987-99944009 TAAAGGTGGGGCTGTTTTATAGG - Intergenic
1045252848 8:100495898-100495920 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1046221099 8:111215764-111215786 TTGAAGTCGAGCAGTTCTATTGG + Intergenic
1046293798 8:112196139-112196161 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1046439731 8:114241918-114241940 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1046440491 8:114246949-114246971 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1046443738 8:114287599-114287621 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1046747221 8:117889111-117889133 TGGAGCTGGGGCAGCTATCTTGG + Intronic
1047176846 8:122549607-122549629 TGGAGGTGAGGCCCTTCCATGGG + Intergenic
1047443211 8:124897483-124897505 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1047829857 8:128617294-128617316 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1048097079 8:131308502-131308524 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1048135155 8:131741019-131741041 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1048662350 8:136618963-136618985 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1048764570 8:137830281-137830303 TGGGGGTGGGGCCATTTTATAGG + Intergenic
1049334472 8:142075727-142075749 TGGAGGTGGGGCAGGGAAATAGG + Intergenic
1049998498 9:1052176-1052198 TGGAGGTGGGGGAGTTGGAGGGG + Intronic
1050140206 9:2509981-2510003 TAGGGGCGGGGCAGTTTTATAGG - Intergenic
1050257567 9:3811015-3811037 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1050258409 9:3816481-3816503 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1050575308 9:6988866-6988888 TGGGGAGGGGGCAGTTTTATAGG - Intronic
1050867708 9:10524137-10524159 TGGAGATGAGGCCTTTCTATAGG - Intronic
1050898085 9:10909504-10909526 TAGGGGTGGGGCAGTTTTACAGG - Intergenic
1051052310 9:12948690-12948712 TAAAGGTGGGGCCGTTTTATAGG - Intergenic
1051865254 9:21673265-21673287 TGGAGCTGTGTCACTTCTATTGG + Intergenic
1052162850 9:25288455-25288477 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1052163638 9:25293967-25293989 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1052192377 9:25675081-25675103 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1052661676 9:31440612-31440634 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1053077992 9:35151337-35151359 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1053783479 9:41633830-41633852 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1054171435 9:61843972-61843994 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1054666099 9:67736840-67736862 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1055809707 9:80137609-80137631 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1055881444 9:81009349-81009371 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1055963282 9:81841228-81841250 TGCAGCTGGGGGAGCTCTATGGG + Intergenic
1056060833 9:82884047-82884069 TTGGGGTGGGGCCGTTTTATAGG - Intergenic
1056061631 9:82889355-82889377 TTGGGGTGGGGCCGTTTTATAGG - Intergenic
1056363175 9:85879343-85879365 ATGGGGTGGGGCAGTTTTATAGG + Intergenic
1056363446 9:85881231-85881253 TAGAGGTGGGGCCGTTTTATAGG - Intergenic
1056391613 9:86146379-86146401 ATGGGGTGGGGCAGTTTTATAGG - Intergenic
1056437607 9:86588702-86588724 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1056521736 9:87408185-87408207 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1056522063 9:87411010-87411032 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1056522938 9:87416570-87416592 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1056656537 9:88514253-88514275 TAGGGGTGGGTCAGTTTTATAGG + Intergenic
1056882685 9:90413008-90413030 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1056883465 9:90418213-90418235 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1057813383 9:98275020-98275042 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1058425315 9:104870779-104870801 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1059574252 9:115473496-115473518 TAAGGGTGGGGCAGTTTTATAGG - Intergenic
1059929685 9:119248764-119248786 AGGAGGTGATTCAGTTCTATGGG - Intronic
1060737363 9:126074560-126074582 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1060738231 9:126080130-126080152 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1061138923 9:128752701-128752723 TGGAGATGCTGCAGTTCTCTAGG + Exonic
1061883103 9:133577778-133577800 GGGATGTGGGGCATTTCTCTGGG + Intergenic
1062122390 9:134840863-134840885 AGGAGGTGGGGCCGTTCGATGGG - Intronic
1203786852 EBV:133068-133090 TGGAGGTGGGGAGGGTCTTTTGG - Intergenic
1185515643 X:697094-697116 TAGAGGTGGGGCAGTTTTATAGG + Intergenic
1185857933 X:3553258-3553280 TGGGGGTGGGGCCGTTTTATAGG + Intergenic
1185858915 X:3559844-3559866 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1185961049 X:4545987-4546009 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1186116305 X:6308227-6308249 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1186195970 X:7110682-7110704 TAGGGGTGCGGCAGTTTTATAGG + Intronic
1186355020 X:8782221-8782243 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1186443468 X:9605835-9605857 TGGAGGGGGAGCAGATGTATTGG + Intronic
1186784549 X:12945401-12945423 TAAAGGTGGGGCTGTTTTATAGG - Intergenic
1187086052 X:16044826-16044848 TGGGGGTGGGGCCGTTTCATAGG + Intergenic
1187139584 X:16580163-16580185 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1187277396 X:17828037-17828059 GGGAGGTGGGGAGGTTCTACTGG + Intronic
1188200078 X:27286337-27286359 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1188201269 X:27294664-27294686 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1188300513 X:28502247-28502269 TGGAGGTGGGGCTGTCTGATGGG - Intergenic
1188300579 X:28502703-28502725 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1188419214 X:29975810-29975832 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1188424336 X:30029270-30029292 TAGTGGTGGGGCAGTTTTAAAGG + Intergenic
1188430757 X:30103876-30103898 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1188463702 X:30454515-30454537 TGAGGGTGGGGCCGTTTTATAGG + Intergenic
1188643755 X:32538454-32538476 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1188688896 X:33104571-33104593 TAGGGGTGGGGCCGTTTTATAGG - Intronic
1188776794 X:34230109-34230131 TAGAGGTGGGGCCGTTTTATAGG + Intergenic
1189032083 X:37460974-37460996 TAGGGGTGGGGCTGTTTTATAGG + Intronic
1189586683 X:42468900-42468922 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1189872702 X:45401110-45401132 TAGAGGTGGGGCAGTTTTATAGG + Intergenic
1189935833 X:46067303-46067325 TGGGGGTAGGGCAGTTTTATAGG - Intergenic
1190817121 X:53938668-53938690 TGGAGGTGGGGCATGTCCACTGG + Exonic
1191805268 X:65129416-65129438 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1191806073 X:65134827-65134849 TAGGGGTGGGGCAGTTTTGTAGG + Intergenic
1192075039 X:67985449-67985471 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1192730874 X:73801573-73801595 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1192731912 X:73809134-73809156 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1192913572 X:75631665-75631687 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1192914396 X:75637400-75637422 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1193942083 X:87688680-87688702 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1194180434 X:90704954-90704976 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1194185763 X:90773427-90773449 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1194186589 X:90778821-90778843 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1194308065 X:92273199-92273221 TAGGGGTGGGGCTGTTTTATAGG + Intronic
1194367577 X:93028500-93028522 TGGGAGTGGGGCGGTTTTATAGG - Intergenic
1194451778 X:94052294-94052316 TAGGGGTGGAGCAGTTTTATAGG - Intergenic
1194670869 X:96730903-96730925 TAGGGGTGGGGCCGTTTTATAGG + Intronic
1194680084 X:96841865-96841887 TAGGGGTGGGGCAGTTTTATAGG + Intronic
1194874141 X:99164899-99164921 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1195016501 X:100786732-100786754 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1195017231 X:100791618-100791640 TAGGGGTGGGGCAGTTTTATAGG + Intergenic
1195326290 X:103761267-103761289 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1195841138 X:109178658-109178680 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1195841975 X:109184024-109184046 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1195923774 X:110005391-110005413 GGGTGGTGGGGCAGTCCTGTGGG + Intronic
1196221312 X:113114098-113114120 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1196222018 X:113122515-113122537 ATGCGGTGGGGCAGTTTTATAGG + Intergenic
1196301210 X:114051494-114051516 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1196341232 X:114601386-114601408 TGAGGGTGGGGCTGTTTTATAGG + Intronic
1196342085 X:114606907-114606929 TGAGGGTGGGGCCGTTTTATAGG + Intronic
1196572972 X:117284741-117284763 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1196773382 X:119317897-119317919 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1197064580 X:122222318-122222340 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1197204427 X:123777559-123777581 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1197351566 X:125388952-125388974 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1197352382 X:125394224-125394246 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1197793377 X:130277598-130277620 TAGGGGTGGGGCAGTTTTACAGG - Intergenic
1197793757 X:130280056-130280078 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1197932750 X:131712310-131712332 TAAAGGTGGGGCTGTTTTATAGG - Intergenic
1198092409 X:133344635-133344657 GGGAGGTGGGGCAGTAATAGAGG + Intronic
1198983236 X:142423490-142423512 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1199619079 X:149683262-149683284 TAGGGGTGGGGCAGTTTTATAGG - Intergenic
1200202952 X:154295267-154295289 TGGGGGTGGGGCAGTGCTCAGGG - Intronic
1200527101 Y:4287113-4287135 TAGGCGTGGGGCAGTTTTATAGG - Intergenic
1200532383 Y:4355507-4355529 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1200533191 Y:4360897-4360919 TAGGGGTGGGGCTGTTTTATAGG + Intergenic
1200546826 Y:4527987-4528009 TAGGGGTGGGGCCGTTTTATAGG + Intergenic
1200659960 Y:5945900-5945922 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1200675782 Y:6144759-6144781 TGGGAGTGGGGCAGTTTTATAGG - Intergenic
1201240284 Y:11952242-11952264 TAGGGGTGGGACAGTTTTATAGG + Intergenic
1201296025 Y:12463930-12463952 TAGGGGTGGGGCCGTTTTATAGG - Intergenic
1201303899 Y:12534414-12534436 TAGGGGTGGGGCTGTTTTATAGG - Intergenic
1201307753 Y:12565084-12565106 TAGAGGTGGGGCCATTTTATAGG + Intergenic
1201580765 Y:15510185-15510207 TAGGGGTAGGGCAGTTTTATTGG + Intergenic
1201643853 Y:16205800-16205822 TATGGGTGGGGCAGTTTTATAGG + Intergenic
1201658962 Y:16379521-16379543 TATGGGTGGGGCAGTTTTATAGG - Intergenic
1201725062 Y:17141837-17141859 TAGTGGTAGGGCAGTTTTATAGG + Intergenic
1201856371 Y:18548861-18548883 TGGAGGTGGGGAAGTCCAAGGGG + Intronic
1201876950 Y:18771523-18771545 TGGAGGTGGGGAAGTCCAAGGGG - Intronic
1201923753 Y:19262360-19262382 TGGAGAGGGGGCAGTTCACTGGG + Intergenic