ID: 1113754463

View in Genome Browser
Species Human (GRCh38)
Location 13:112801018-112801040
Sequence TAAGTATGACGTCAGCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 2, 2: 21, 3: 88, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113754463_1113754467 13 Left 1113754463 13:112801018-112801040 CCCTACAGCTGACGTCATACTTA 0: 1
1: 2
2: 21
3: 88
4: 225
Right 1113754467 13:112801054-112801076 AGATGGTTTCACCCTAAGATTGG 0: 1
1: 2
2: 2
3: 20
4: 155
1113754463_1113754468 21 Left 1113754463 13:112801018-112801040 CCCTACAGCTGACGTCATACTTA 0: 1
1: 2
2: 21
3: 88
4: 225
Right 1113754468 13:112801062-112801084 TCACCCTAAGATTGGAAAAAAGG 0: 3
1: 2
2: 7
3: 54
4: 331
1113754463_1113754466 -4 Left 1113754463 13:112801018-112801040 CCCTACAGCTGACGTCATACTTA 0: 1
1: 2
2: 21
3: 88
4: 225
Right 1113754466 13:112801037-112801059 CTTAATGGTGAAAAACGAGATGG 0: 1
1: 0
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113754463 Original CRISPR TAAGTATGACGTCAGCTGTA GGG (reversed) Intronic
900464659 1:2819812-2819834 TGTGTATGACGGCAGGTGTAGGG - Intergenic
901168958 1:7240836-7240858 TAAGTATGATGTTAGCTGTATGG - Intronic
901176768 1:7307551-7307573 TAAGTATAAAGTTAGTTGTAGGG + Intronic
906969779 1:50499341-50499363 TAGGTAAGATGTTAGCTGTAGGG + Intronic
908701073 1:66900988-66901010 TAAGTATAATGTTAGCTGTGGGG + Intronic
909194352 1:72598356-72598378 AAAGTATGATGTTAGCTGTAGGG - Intergenic
910161287 1:84275457-84275479 TAAGTATGATGTTAACTGTAGGG + Intergenic
910220187 1:84881860-84881882 TGAGTATGATGTTAGCTGTGGGG - Intronic
912479328 1:109967782-109967804 TAAGTATGATGTTAGCTGCAGGG - Intergenic
912970731 1:114280422-114280444 TAAGTATGATGTTAGCTATAGGG - Intergenic
915612976 1:157009981-157010003 TGAGTATGATGTTAGCTGTGGGG - Intronic
917650604 1:177073224-177073246 TAAGACTGACCTCAGCTTTAAGG - Intronic
918539831 1:185618920-185618942 TAAGTATGATGTTCACTGTAGGG - Intergenic
922004117 1:221511525-221511547 TAAGTATGAAGGCAGCTGTGTGG - Intergenic
923420008 1:233803928-233803950 TAAATATGATGTTAGCTATAGGG - Intergenic
923878697 1:238079001-238079023 TAAGTATGATGTGAGCTGTGAGG + Intergenic
924505219 1:244676667-244676689 TAAGTATGATATTAGCTGTGAGG + Intronic
1062778022 10:171757-171779 TAAGTATGATGTTAGCTGTAGGG - Intronic
1063333303 10:5184215-5184237 TAACTATGAGGTCAGGTCTAGGG - Intergenic
1065243424 10:23731713-23731735 TAAGTATAAGGTTAGCTGTAGGG + Intronic
1066548588 10:36529596-36529618 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1067983019 10:51108652-51108674 TAAGTATGATGTTAGCTGTGGGG - Intronic
1068564626 10:58559701-58559723 TCAGTATGGCGTCAGCTATGGGG + Intronic
1068655710 10:59574068-59574090 TAAGTATGATATTAGCTGTAGGG - Intergenic
1071236338 10:83654394-83654416 TAAGTATGATGTTAACTGTGGGG + Intergenic
1072026576 10:91465538-91465560 TAATTATGATGTTAGCTGTAGGG + Intronic
1072338838 10:94426271-94426293 TAAGTATGATGTTAGCTGTAGGG + Intronic
1073317056 10:102589884-102589906 CAAGTATGATGTTAGCTGTGGGG + Intronic
1074481966 10:113831590-113831612 TAAATATGATGTTAGCTGTAGGG - Intergenic
1078332218 11:10433458-10433480 TAGGTATGATGTTAGCTGTGGGG - Intronic
1078403799 11:11050260-11050282 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1078942450 11:16023048-16023070 TAATTATGATGTCATCTGGAAGG - Intronic
1079700974 11:23547131-23547153 TAGGTACGATGTTAGCTGTAGGG + Intergenic
1080319835 11:30994802-30994824 TGAGTATGATGTCAGCTGTAGGG - Intronic
1080994747 11:37585070-37585092 TAAGTAAGGCGCTAGCTGTATGG + Intergenic
1081723891 11:45311988-45312010 TAAGTATAATGTTTGCTGTAGGG + Intergenic
1083070740 11:59977932-59977954 TTATAATGACTTCAGCTGTAAGG + Intergenic
1084633113 11:70369106-70369128 TAAGTATGATGTTCACTGTAGGG + Intronic
1084985068 11:72862146-72862168 TAAGTATGAAGTTAGCAGTAGGG - Intronic
1089194328 11:116684385-116684407 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1089686675 11:120153818-120153840 TAAGTATAATGTCAATTGTAGGG + Intronic
1090122297 11:124043595-124043617 TAAGCATGACGTCAGCTGTGGGG + Intergenic
1090130063 11:124131926-124131948 TAAGTATGGTGTTTGCTGTAAGG + Intronic
1090143160 11:124287948-124287970 TAAGCATGATGTTAACTGTAAGG + Intergenic
1090301829 11:125648777-125648799 TAAGTATGATGTTAGCTGTGGGG + Intronic
1091257064 11:134197909-134197931 TGAGTACGACGTTAGCTGTGAGG - Intronic
1091324388 11:134674837-134674859 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1091412159 12:250172-250194 TAAGTATGATGTTAGCTGTAGGG - Intronic
1092299796 12:7236093-7236115 TGAGTATGATGTGAGCTGTGGGG - Intergenic
1093248928 12:16775598-16775620 TAAGTATGATGTTAGCTGTAAGG - Intergenic
1093616319 12:21229976-21229998 TAAGTATGAAGTTAGATGTAGGG + Intronic
1095825617 12:46527710-46527732 GAAGTATGGCATTAGCTGTAGGG - Intergenic
1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG + Intergenic
1096014969 12:48262507-48262529 TAAGTATGATGTGAACTATAGGG + Intergenic
1096128909 12:49141565-49141587 TAAGTATAGTGTTAGCTGTAGGG + Intergenic
1099466678 12:82996630-82996652 TCAGTTTGACATTAGCTGTATGG + Intronic
1099788036 12:87292528-87292550 TAAATATGATATTAGCTGTAGGG - Intergenic
1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG + Intronic
1101127952 12:101658421-101658443 TAAGTATAACTTTAGCTGTTGGG - Intronic
1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG + Intronic
1106683868 13:32035985-32036007 TTAGTATGAGGTCAGCTCTGGGG + Intronic
1108012321 13:46030256-46030278 TAGGTATGACGTTAGCCGTAGGG - Intronic
1108097270 13:46916354-46916376 TAAGTATAATGTCAGCTGTAGGG + Intergenic
1108368150 13:49738946-49738968 TAAGTGTGATGTTAGCTGTGAGG + Intronic
1108567667 13:51717050-51717072 TAAGGATGATGTTAGCTGCAGGG - Intronic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1114941769 14:27621966-27621988 TAAGTATAATGTTAGCTGTAAGG - Intergenic
1115317666 14:32042359-32042381 TCAATATGATGTTAGCTGTAGGG + Intergenic
1115456126 14:33605228-33605250 TGAGTATGATGTCAGTTATAGGG - Intronic
1118131609 14:62970890-62970912 TGAGTATGATGTTAGTTGTAGGG - Intronic
1119092118 14:71793610-71793632 TAAGTAAGATGTTAGCTGTTGGG + Intergenic
1120833620 14:89020802-89020824 TACGTATGATGTTAGCTGTGGGG + Intergenic
1121246881 14:92467432-92467454 TAAGTATGATGTTAGCTTTGGGG - Intronic
1121961983 14:98268886-98268908 TAACTCTCACGTCAGCTCTAAGG + Intergenic
1122356575 14:101126327-101126349 TAAACATGACTTCAGCTGTCTGG - Intergenic
1123133136 14:106003895-106003917 AAAGCATGAGGTGAGCTGTAAGG + Intergenic
1123583168 15:21734331-21734353 AAAGCATGAGGTGAGCTGTAAGG + Intergenic
1123619818 15:22176928-22176950 AAAGCATGAGGTGAGCTGTAAGG + Intergenic
1123979011 15:25582127-25582149 TCAGTATAAAGTTAGCTGTAGGG - Intergenic
1124607669 15:31183338-31183360 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1125247340 15:37656003-37656025 TTAGTATGATGTTAGCTGTAGGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126200939 15:45985396-45985418 TAAGTATGATGTTATCTGTGGGG + Intergenic
1126714278 15:51497730-51497752 TACGTATGACATTAACTGTATGG + Intronic
1128397374 15:67242003-67242025 AGAGTCTGACGTCAGCTGAAAGG + Intronic
1129307805 15:74680528-74680550 TTAGTATAATGTTAGCTGTAGGG - Intronic
1130035439 15:80356711-80356733 TAAGTATGAAGTTTGTTGTAGGG + Intronic
1132411852 15:101585513-101585535 TAAGTATAATTTTAGCTGTAAGG + Intergenic
1133578678 16:7121142-7121164 TAAGTATGATATTAGCTGTGGGG - Intronic
1134876674 16:17706369-17706391 TACTAATGAAGTCAGCTGTAGGG - Intergenic
1136714574 16:32267728-32267750 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136753314 16:32661687-32661709 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1136814799 16:33208678-33208700 CAAGTATGATGTTAGCTGTGGGG + Intronic
1136821275 16:33318758-33318780 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136827838 16:33375297-33375319 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136832904 16:33474068-33474090 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1137298044 16:47116113-47116135 TAAGTATGGTGTCAGCTGTAGGG + Intronic
1137520164 16:49186971-49186993 TAAGTAGGATATTAGCTGTAGGG + Intergenic
1137535310 16:49317732-49317754 TAAGTGTGATATTAGCTGTATGG + Intergenic
1138983874 16:62303340-62303362 TAATGATGACTTCAACTGTATGG + Intergenic
1139293444 16:65878529-65878551 TCAGAATGACGTCACCTGGAAGG - Intergenic
1139414051 16:66792303-66792325 TAAGTATGATGTTTGCTGTAGGG - Intronic
1139565810 16:67775331-67775353 TGAGTATGATGTTAGCTGTGGGG - Intronic
1140159956 16:72479297-72479319 TAAGTATAATATTAGCTGTAGGG - Intergenic
1140623438 16:76763866-76763888 TAAGTATGACGTTAGCTGTAGGG - Intergenic
1140973230 16:80033850-80033872 TAAGTATGATGTTAACTGTGGGG - Intergenic
1202993375 16_KI270728v1_random:31652-31674 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1203055476 16_KI270728v1_random:922041-922063 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1144188350 17:12818357-12818379 TAAATATGATGTGAGTTGTAGGG - Intronic
1145368598 17:22287675-22287697 TCAGTATGATCTTAGCTGTAGGG + Intergenic
1148199253 17:45738912-45738934 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1148585489 17:48775926-48775948 TAAGTATGATGTTAGCTGTCAGG - Intronic
1150021844 17:61624104-61624126 TAGGTATGATATTAGCTGTAGGG + Intergenic
1150024408 17:61657097-61657119 TAAGTATGATGTAAACTGTGTGG + Intergenic
1152548540 17:81016926-81016948 TAAGTGTGATGTTATCTGTAGGG - Intergenic
1152593546 17:81226145-81226167 TAAGTATGATGTCAGCTGAGGGG + Intergenic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1155513635 18:26602102-26602124 TAAGTATGATGTTAGTTGTGGGG + Intronic
1156338797 18:36191991-36192013 TAAGTATGATGTTAGCTGTGGGG - Intronic
1156380094 18:36551027-36551049 TAAGTATGATGTTATCTGCAGGG + Intronic
1156439002 18:37165368-37165390 TAAGTATGATTTTAGCTGAAGGG + Intronic
1156926763 18:42590848-42590870 TAAGTGTGTTGTTAGCTGTAGGG + Intergenic
1157275341 18:46306626-46306648 TAAGTATGCTGTTAGGTGTAGGG + Intergenic
1157540586 18:48501765-48501787 TAAGTATAATGTAAGCTGTGGGG - Intergenic
1157637509 18:49173959-49173981 TAAGTATGATTTTAGCTGTAAGG + Intronic
1157646286 18:49276182-49276204 TAAATATGATGTGAGCTGTGGGG + Intronic
1160580395 18:79880986-79881008 TATGTATGTTGTTAGCTGTAGGG - Intronic
1163226780 19:15967638-15967660 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1165065981 19:33227936-33227958 TAAACATGATGTCAGCTGTAGGG - Intergenic
1166614610 19:44231989-44232011 AAAGTGGGAAGTCAGCTGTATGG - Intronic
925784231 2:7413887-7413909 TAAGCATGATGTTAGTTGTAGGG + Intergenic
926485635 2:13452765-13452787 TAAGTATAATCTTAGCTGTAGGG + Intergenic
927037755 2:19198079-19198101 TAAGTATGATGTTAGCTATAGGG - Intergenic
927302442 2:21531129-21531151 TAAGTATGACGTTAGATGAAGGG + Intergenic
927444497 2:23146390-23146412 TAAGCATGATGTTAGCTGTGGGG - Intergenic
928892936 2:36226440-36226462 TTAGTATGAAGTTAGATGTAGGG - Intergenic
930305681 2:49671745-49671767 TAAGCATGAAGTCAGCTAAATGG - Intergenic
930323012 2:49879171-49879193 TAAATATGACATCATCTGCATGG + Intergenic
931003673 2:57821665-57821687 TAATTATAATGTTAGCTGTAGGG - Intergenic
931273592 2:60724019-60724041 AAAGTATGATGTTAGTTGTAAGG - Intergenic
931772465 2:65509981-65510003 TAAGTATGATGCTAGCTGTAGGG + Intergenic
932293108 2:70600082-70600104 TAAGTATACTGTTAGCTGTAGGG + Intergenic
932964151 2:76451006-76451028 TCAGTATGATGGTAGCTGTAGGG - Intergenic
933838782 2:86268030-86268052 TAAGTCTAATGTTAGCTGTAGGG - Intronic
933882442 2:86683514-86683536 TACCTATGACATTAGCTGTAGGG + Intronic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
935231706 2:101103732-101103754 TAAGTATGATGTTAACTGTGGGG - Intronic
935320352 2:101881637-101881659 TATGTATGACGTTAGCTGTAAGG + Intronic
935343346 2:102079145-102079167 TAAGTATAATGTTAGCTGTGGGG - Intronic
937420580 2:121751603-121751625 TAACTATGATGTTAGCTGTAGGG - Intronic
937604806 2:123786346-123786368 TAAGTATGACATTAGCTGTGGGG + Intergenic
937850621 2:126630743-126630765 TGAATATGATGTTAGCTGTAGGG - Intergenic
937959534 2:127445220-127445242 TAAGTACGATGTTAACTGTAGGG + Intronic
938181039 2:129183184-129183206 TAAGTATGATGTTAGCTAAAGGG + Intergenic
938222671 2:129584481-129584503 TAAGTATGATGTTAGCTGTGGGG - Intergenic
938572944 2:132577985-132578007 TAAGTGTAACGTTAACTGTAGGG + Intronic
939138703 2:138327026-138327048 TAAGTATGATGTTAGCTGCTAGG - Intergenic
939841380 2:147192449-147192471 TGAGTATGATGTTAGCTGTAGGG - Intergenic
940313157 2:152300531-152300553 TAAGAACGATGTTAGCTGTAGGG + Intergenic
941402822 2:165052430-165052452 TAAGTATGATGGTAGCTGTAGGG - Intergenic
941539098 2:166760235-166760257 TAAGTATAATATTAGCTGTAGGG + Intergenic
943349762 2:186783674-186783696 TCAGTATGCTGTTAGCTGTAGGG - Intergenic
944162760 2:196683131-196683153 TAAGTATGATGTCAACTGTGGGG + Intronic
947075475 2:226339813-226339835 TATGTATGATGTCATCTGTAGGG - Intergenic
1169048116 20:2553208-2553230 TAAGTATGATGTTAGTTGTAGGG + Intronic
1170014075 20:11761221-11761243 TAAGTATGATATCAGTTGTGAGG + Intergenic
1170722298 20:18893696-18893718 TCAATATGATGTTAGCTGTAGGG - Intergenic
1171041980 20:21773004-21773026 TAATTATGAATTCAGCTGGATGG + Intergenic
1172467893 20:35170395-35170417 TCACTATGACGTCAGCTCTCCGG + Intergenic
1172616757 20:36293338-36293360 TAAGTGTGATGTTAGCTATAGGG + Intergenic
1175662639 20:60828299-60828321 CAAGTATGCTGTTAGCTGTAGGG + Intergenic
1179018093 21:37611855-37611877 TTAGTATGATGTTAGCTGTAAGG - Exonic
1179903980 21:44411708-44411730 TAAGTGTGATGTTAGCTGTGGGG + Intronic
1180003842 21:45010350-45010372 TAGGTGTGATGTCAGCTGTCGGG + Intergenic
1181900371 22:26149796-26149818 TAAGGATGATGTTAGCTGTAGGG - Intergenic
1184308913 22:43628488-43628510 CATGCATGACGTCAGCTGTAAGG - Intronic
1184440004 22:44505053-44505075 TAAGTATAATGTCAGTTATAGGG - Intergenic
949292198 3:2480147-2480169 TAAGTATGATGTTAACTGTAGGG - Intronic
950519807 3:13491315-13491337 TGAGTATAATGTCAGCTGTGGGG + Intronic
950777917 3:15366226-15366248 CAAGTATGAAATTAGCTGTATGG + Intergenic
952994267 3:38862673-38862695 TAAGTAGGACCTAAGCTGTGAGG + Intronic
953487233 3:43312517-43312539 TAAGTAGGATGTTATCTGTAGGG - Intronic
955262795 3:57410901-57410923 TAAGTATGATGTTAGCTGTAGGG - Intronic
956089253 3:65647825-65647847 GAATTATTACGTCAGATGTAGGG - Intronic
959328998 3:104977908-104977930 TAAGAATGACGTCAGCAGAAAGG + Intergenic
959846782 3:111041926-111041948 TCAGTATGATGTTAGCTGTGGGG - Intergenic
961946460 3:130694893-130694915 TAAGTACAATGTTAGCTGTAGGG + Intronic
962299595 3:134226837-134226859 TGAGTATGATATTAGCTGTAGGG - Intronic
962441357 3:135420249-135420271 TAAATATGATGTTAGCTGTGGGG + Intergenic
963012435 3:140784835-140784857 TAAGTATAATGTTAACTGTAAGG - Intergenic
963725743 3:148919294-148919316 TAAGTATAATGTTAGCTGTAAGG - Intergenic
965415938 3:168392192-168392214 TAATTATGATATCAGCTATAAGG - Intergenic
966965578 3:184989221-184989243 TAAGTATGATGTTAGCTGCAAGG + Intronic
968242899 3:197107929-197107951 TTAGTATGATGTCAGCTATAGGG + Intronic
970083039 4:12310982-12311004 TGAGTATGACGTTAGCTGTGGGG + Intergenic
970181453 4:13400674-13400696 TAAGTATGACATTAATTGTAGGG + Intronic
972025821 4:34375728-34375750 AAAATATGAAGTCATCTGTAGGG + Intergenic
972121310 4:35707720-35707742 TCAGTATGATGTTGGCTGTAGGG + Intergenic
973286094 4:48418273-48418295 TAAGTATAATGTTAACTGTAGGG + Intronic
973559774 4:52123317-52123339 TAAGTATGGCATTAGCTATAGGG + Intergenic
974480851 4:62441191-62441213 TAAGTGTGATGTTAGTTGTAGGG + Intergenic
975567089 4:75768742-75768764 TAAGTATGATGTTAGCTGTAAGG + Intronic
976357816 4:84140228-84140250 TGAGTATGATGTTAGCTGTAGGG - Intergenic
979821570 4:125179897-125179919 TAAGTATGACGTTACCTGGTGGG - Intergenic
980311733 4:131140006-131140028 TAAGTATAATGTCAGCTATGGGG - Intergenic
980761678 4:137241719-137241741 TAAGTATGAACTCATATGTATGG - Intergenic
981598676 4:146458342-146458364 TAGGTATGATGTCAGCTGTTTGG - Intronic
982119045 4:152122295-152122317 TAAATATGATGTTAGATGTAGGG + Intergenic
982625747 4:157764075-157764097 TAAGTATGAGATCAGCAGTGTGG + Intergenic
984053216 4:174893083-174893105 TAGCTATGATGTCAGCTGTAGGG - Intronic
984636653 4:182118396-182118418 GAAGTATAATGTTAGCTGTAGGG + Intergenic
1202760916 4_GL000008v2_random:109714-109736 TGAGTATGATGTTAGCTGTGAGG + Intergenic
985990441 5:3554876-3554898 TAAGTATGATATTAGCTGTAGGG - Intergenic
986991674 5:13560807-13560829 TAAGTACAATGTTAGCTGTAGGG - Intergenic
988819792 5:34870984-34871006 TAAGCATGAAATCAGCTGCAGGG - Intronic
989139260 5:38186888-38186910 TGAGTATGATGTTAGCTGTGGGG - Intergenic
989461897 5:41709210-41709232 TAAGTATGATGTTAGCTGTAGGG + Intergenic
989490334 5:42044829-42044851 TAAATATGATGTTAGCTGTGGGG - Intergenic
990272820 5:54163013-54163035 TAACTCTGACAACAGCTGTAGGG + Intronic
990858156 5:60295454-60295476 TAATTATGATGTGAGCTGTTGGG + Intronic
990930432 5:61084079-61084101 TAGGTATGATATTAGCTGTAAGG + Intronic
991007995 5:61850256-61850278 TAAATATGATGTTAGCTGTGGGG - Intergenic
991140641 5:63237582-63237604 TAAGTATGATGTTTGCTGTGGGG - Intergenic
991629480 5:68641368-68641390 GAAGTATGATGTTAGCTGTAGGG + Intergenic
995064800 5:107848174-107848196 TAAGTATGATCGTAGCTGTAGGG - Intergenic
997166836 5:131669784-131669806 TAAGTATGTTGTTAGTTGTAAGG - Intronic
997406393 5:133651345-133651367 TAAGTATGATGTTAGCTATAGGG + Intergenic
998468602 5:142365424-142365446 CAAGTATGAGGTCAGCTCTTGGG - Intergenic
999549230 5:152666539-152666561 TAAGGATGATGTCAGCTGTGGGG - Intergenic
1001842492 5:174890831-174890853 TAAATATGATGTTAGTTGTAGGG + Intergenic
1003027831 6:2572812-2572834 TAAGTATATTGTTAGCTGTAGGG + Intergenic
1003198392 6:3935458-3935480 TTAGTATGAGGTTAGCTGTAGGG + Intergenic
1003307670 6:4944462-4944484 TAGGGATGCCCTCAGCTGTAGGG - Intronic
1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1003907292 6:10713734-10713756 TAAGTATAATGCCAGCTGTAGGG + Intergenic
1006487443 6:34355139-34355161 TAAGTATGATATTAGCTGTTTGG + Intronic
1007410650 6:41659308-41659330 TAAATATGGCCTCAACTGTAAGG + Intergenic
1007456384 6:41980907-41980929 TGAGTATGATGTTAGTTGTAGGG - Intronic
1008073861 6:47125682-47125704 TGAATATGATGTTAGCTGTAGGG + Intergenic
1011505262 6:88034793-88034815 TAAGTATAACAGTAGCTGTATGG + Intergenic
1011924912 6:92630270-92630292 TAAGCATGATGTTAGCTGTTAGG + Intergenic
1012415370 6:99007071-99007093 TCAGTATGATGTTGGCTGTAGGG - Intergenic
1012716796 6:102684414-102684436 TAAGTTTGATGTCACCTTTAGGG - Intergenic
1012759730 6:103283378-103283400 TAAGTATGATGTTAGCTGTTGGG + Intergenic
1012782019 6:103572574-103572596 TAAGTATGGTGTTAGCTGTATGG + Intergenic
1014958044 6:127646271-127646293 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1014961008 6:127684763-127684785 TAAGTATAATGTTAACTGTAGGG + Intergenic
1015096690 6:129423213-129423235 TAAGTATGATTTTAGCTGTTAGG - Intronic
1015324911 6:131913954-131913976 GAAGAATGATGTTAGCTGTAGGG + Intergenic
1015768212 6:136741522-136741544 TAAGTATGATGTTAGCTATAGGG - Intronic
1016374376 6:143405559-143405581 TAAGTCTGACCTCAGAAGTACGG - Intergenic
1016601827 6:145870763-145870785 TAAATATGATGTTAGCTGTAGGG + Intronic
1018863246 6:167727574-167727596 TAAGTGTGATGTTAGCTGTAGGG - Intergenic
1019169136 6:170119918-170119940 TAAATATGAAGTTATCTGTAGGG + Intergenic
1020547021 7:9545025-9545047 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1022900513 7:34804552-34804574 TAAATATGAGGTTAACTGTATGG - Intronic
1023853926 7:44169127-44169149 TAAATATGACGTTAGCTATGGGG - Intronic
1023979345 7:45058300-45058322 TAAGTATGATGTTCGCTTTAGGG + Intronic
1024122185 7:46255354-46255376 TAAGTATGATGTTAACTGTAGGG - Intergenic
1024185425 7:46943898-46943920 TAAGTATCAAGTCAGCTACAAGG - Intergenic
1024489301 7:49959127-49959149 TAAGTATGGTATTAGCTGTAGGG - Intronic
1027551565 7:79603717-79603739 CAAGTATAATGTTAGCTGTATGG + Intergenic
1028058494 7:86278816-86278838 TAAGTACGACATTAGCTATAGGG + Intergenic
1028926655 7:96364616-96364638 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1031112973 7:117633609-117633631 TAAGTATGATTTTAGCTGGAGGG + Intronic
1031444263 7:121831497-121831519 TAAGCCTGATGCCAGCTGTAAGG + Intergenic
1031620101 7:123925208-123925230 TTACTATGAGGTCACCTGTAGGG + Intergenic
1032935479 7:136725902-136725924 TAAGTATGATGTTGGCTGTGGGG - Intergenic
1033268344 7:139907148-139907170 TAAGTATGACATTAGCTGTAAGG + Intronic
1035149641 7:156858932-156858954 TAAGTATGATGTTAGCTGTGGGG - Intronic
1035597839 8:873440-873462 TAAGTATGACGTTAGTTATGTGG + Intergenic
1035835462 8:2746676-2746698 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1036678362 8:10852870-10852892 TAAGTATGACGTCATGTCGAAGG + Intergenic
1037358159 8:18044923-18044945 TAAGTATGATATTAGCTGTATGG + Intergenic
1037956191 8:23061647-23061669 TGAGTATGATGTTAGCTGTGGGG + Intronic
1039340358 8:36642249-36642271 TAAGCATAATGTTAGCTGTAAGG - Intergenic
1039660606 8:39459516-39459538 TAAGTATGATGGTAGCTGTAGGG - Intergenic
1040420305 8:47233438-47233460 TAAGTATAATGTTAGCTGTAGGG - Intergenic
1040446182 8:47496309-47496331 TAAGTCTGATGTTAGTTGTAGGG + Intronic
1040611759 8:48991515-48991537 TAAATATAACATTAGCTGTAGGG + Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1041474850 8:58252847-58252869 TAAGAATGATGTTAGTTGTAGGG - Intergenic
1042366627 8:67944387-67944409 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1042394429 8:68276165-68276187 TAAGTCTGATGCTAGCTGTAGGG + Intergenic
1045080594 8:98621511-98621533 TAATTATGATGTTAGCTGAAAGG + Intronic
1045118518 8:99010929-99010951 TAAGTATGTTGTTAGCTGTAGGG - Intergenic
1046682790 8:117190706-117190728 TAACTATGATGTTAGCTGTGGGG - Intergenic
1046856443 8:119037541-119037563 TAAGTATGGCTTCAGCTCTAGGG - Intronic
1048598365 8:135891060-135891082 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1050890341 9:10817493-10817515 TAAGTATAATATTAGCTGTAGGG + Intergenic
1052326217 9:27218988-27219010 TAAATATGACGTTAGGTATAAGG - Intronic
1053545266 9:39017126-39017148 TAATTATGATATCAGTTGTAGGG + Intergenic
1054703776 9:68441628-68441650 TAAATATGATTTTAGCTGTAGGG - Intronic
1055536783 9:77255105-77255127 TGAGTATGATGTCAGCTGTGGGG + Intronic
1055562926 9:77539122-77539144 TCAGTATGATGTCAGCTGTGAGG + Intronic
1056375455 9:86005367-86005389 TAAGTATGATGTTAGCTGTAAGG - Intronic
1057087150 9:92221829-92221851 GAGGTATAATGTCAGCTGTAAGG + Intronic
1057288457 9:93780919-93780941 TAAGGATGATGTTAGCTGTAGGG + Intergenic
1060451864 9:123750297-123750319 TAAGTATGAAGGCATCTGTATGG + Intronic
1062704359 9:137927726-137927748 TAAGTATAATGTTAGCTGTACGG + Intronic
1062719538 9:138030174-138030196 TTAGTATGATATTAGCTGTAAGG + Intronic
1187454635 X:19430403-19430425 TAAAACTGAAGTCAGCTGTAGGG - Intronic
1187637523 X:21247555-21247577 GAAGTATGACGTTAACTGTAGGG - Intergenic
1188870980 X:35371465-35371487 TAAGTATTATGTTAGTTGTATGG + Intergenic
1189527554 X:41840691-41840713 TAAGTAAGATGTTAGCTGTAGGG + Intronic
1189566981 X:42252569-42252591 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1189575300 X:42345058-42345080 TAAGTATGATGTCAGCTGTAAGG + Intergenic
1189654571 X:43229686-43229708 TAAGTATAATGTTAGGTGTAGGG - Intergenic
1189670017 X:43398477-43398499 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1189741996 X:44128427-44128449 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1190011208 X:46786560-46786582 TAAGTATGATGTTATCTATAGGG + Intergenic
1190140434 X:47838417-47838439 TAAGTATGATTTTAGCTGTAGGG + Intronic
1190469075 X:50758326-50758348 TAAGTATGATGCTACCTGTAAGG + Intronic
1190471956 X:50790819-50790841 TGAGTATGACATTAGCTGTGGGG - Intronic
1190625490 X:52334226-52334248 TAAGAATAATGTAAGCTGTAGGG + Intergenic
1191042399 X:56097830-56097852 TATGTATGATGTTAACTGTAGGG - Intergenic
1191703035 X:64063757-64063779 TAAGTATGATATTAGTTGTAGGG + Intergenic
1191707402 X:64108535-64108557 TAAATATGATGTCAACTATAGGG + Intergenic
1191749835 X:64529971-64529993 TAAGTATGATGTTAGCTGTCAGG - Intergenic
1192187904 X:68966012-68966034 TAATTATGATGTTAGCTATAGGG + Intergenic
1192548535 X:72033998-72034020 TAAGTTTAATGTTAGCTGTAGGG + Intergenic
1193097658 X:77569158-77569180 TAACTATGATGTTAGCTGTAAGG - Intronic
1193293988 X:79811906-79811928 TAAGTATAATGTTAGATGTAGGG + Intergenic
1193561306 X:83020762-83020784 TGAGTATGAGGTTAGCTGTGGGG - Intergenic
1193816632 X:86112603-86112625 TAAATATGACGTTTGCTATAAGG + Intergenic
1194391514 X:93322994-93323016 TAAGTATGATATTAGCTGTGGGG - Intergenic
1195059646 X:101181895-101181917 TAAGTATGATATCAGCTGTTAGG + Intergenic
1195589254 X:106604830-106604852 TAAGCATGATGTTAACTGTACGG - Intergenic
1195633204 X:107082125-107082147 TAAGTATAATGTTAGCTGTAGGG + Intronic
1195933912 X:110107154-110107176 AAAGTATGACCTCAGGTGGAAGG - Intronic
1195957692 X:110350327-110350349 TAAGTATGATGTTATCTGTTGGG - Intronic
1197450662 X:126611592-126611614 TAAGTGTGCTGTTAGCTGTAGGG - Intergenic
1197539414 X:127738054-127738076 TAAGTATGATGCTAGCTATAGGG - Intergenic
1197568942 X:128125298-128125320 TGAGTATGATGTTAGCTGTTAGG - Intergenic
1198446369 X:136720539-136720561 TAAGTATGATGTTAGATGTCGGG - Intronic
1199311266 X:146322947-146322969 TAAGTATGATATGAGCTTTAGGG - Intergenic
1200282318 X:154787595-154787617 GAAGTATGACGTTGGATGTAGGG - Intronic