ID: 1113755490

View in Genome Browser
Species Human (GRCh38)
Location 13:112808282-112808304
Sequence GGGGATGTTAAGAGGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 229}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113755478_1113755490 6 Left 1113755478 13:112808253-112808275 CCCATCCCAGGGCAGTGGGCGGG 0: 1
1: 0
2: 2
3: 23
4: 277
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755467_1113755490 26 Left 1113755467 13:112808233-112808255 CCTCCCTGGCTGTGTCCCCTCCC 0: 1
1: 3
2: 12
3: 96
4: 818
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755469_1113755490 22 Left 1113755469 13:112808237-112808259 CCTGGCTGTGTCCCCTCCCATCC 0: 1
1: 1
2: 6
3: 61
4: 504
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755468_1113755490 23 Left 1113755468 13:112808236-112808258 CCCTGGCTGTGTCCCCTCCCATC 0: 2
1: 0
2: 3
3: 54
4: 461
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755474_1113755490 10 Left 1113755474 13:112808249-112808271 CCCTCCCATCCCAGGGCAGTGGG 0: 1
1: 0
2: 7
3: 54
4: 545
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755480_1113755490 5 Left 1113755480 13:112808254-112808276 CCATCCCAGGGCAGTGGGCGGGC 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755472_1113755490 11 Left 1113755472 13:112808248-112808270 CCCCTCCCATCCCAGGGCAGTGG 0: 1
1: 0
2: 7
3: 78
4: 729
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755466_1113755490 27 Left 1113755466 13:112808232-112808254 CCCTCCCTGGCTGTGTCCCCTCC 0: 2
1: 2
2: 11
3: 97
4: 942
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755476_1113755490 9 Left 1113755476 13:112808250-112808272 CCTCCCATCCCAGGGCAGTGGGC 0: 1
1: 0
2: 2
3: 48
4: 434
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755465_1113755490 28 Left 1113755465 13:112808231-112808253 CCCCTCCCTGGCTGTGTCCCCTC 0: 1
1: 3
2: 9
3: 132
4: 941
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755482_1113755490 0 Left 1113755482 13:112808259-112808281 CCAGGGCAGTGGGCGGGCGTTTT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229
1113755481_1113755490 1 Left 1113755481 13:112808258-112808280 CCCAGGGCAGTGGGCGGGCGTTT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113755490 Original CRISPR GGGGATGTTAAGAGGGGGTC AGG Intronic