ID: 1113755817

View in Genome Browser
Species Human (GRCh38)
Location 13:112809924-112809946
Sequence CAGGTCCGTCAGCGCGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113755812_1113755817 -8 Left 1113755812 13:112809909-112809931 CCAGTGGAAGGCATCCAGGTCCG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1113755817 13:112809924-112809946 CAGGTCCGTCAGCGCGGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1113755808_1113755817 27 Left 1113755808 13:112809874-112809896 CCTTCGTAGTTGGAATCGGAGTG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1113755817 13:112809924-112809946 CAGGTCCGTCAGCGCGGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113755817 Original CRISPR CAGGTCCGTCAGCGCGGCCG GGG Intronic
900181349 1:1312383-1312405 CAGGTCAGTGAGCGCAGCAGCGG + Intronic
900631031 1:3635402-3635424 CAGGACTGTCCGCGTGGCCGTGG + Intronic
901628960 1:10638984-10639006 CAGGGCCGCCAGCGCCGCCAAGG + Exonic
902531150 1:17091488-17091510 AAGGTCAGTCAGCTCGGCCAGGG - Intronic
903130917 1:21279122-21279144 CGGCTCCGTCAGCTCGGGCGAGG - Intronic
903448451 1:23437110-23437132 CAGGTCGGTCCCCGGGGCCGGGG - Exonic
903538457 1:24082644-24082666 CAGGTCAGTCAGCGAGGCTGGGG - Exonic
904063030 1:27726052-27726074 CGGGTCGGTGAGCGCGGCCCGGG + Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
1105007034 12:132727902-132727924 CAGGCCCGTCAGCCAGGCTGTGG - Intronic
1107467896 13:40666139-40666161 CAGGTGCACGAGCGCGGCCGGGG + Exonic
1112402323 13:99087127-99087149 CAGGTCCGCCTGGCCGGCCGCGG - Intergenic
1113310488 13:109127324-109127346 CATGTCAGTCTGCGCGGCCGTGG + Exonic
1113755817 13:112809924-112809946 CAGGTCCGTCAGCGCGGCCGGGG + Intronic
1113874278 13:113584858-113584880 CCGGTCCGGCCGCGCGGGCGGGG - Exonic
1118729804 14:68658331-68658353 CAGGTCTGTCAGTGCTGCCCAGG - Intronic
1121117883 14:91356362-91356384 CATGTCAGTCAGCGAGGCCCGGG + Intronic
1122264100 14:100538674-100538696 CGGGGCCGCCACCGCGGCCGTGG + Exonic
1122403353 14:101480803-101480825 CTGGTCCATCAGCACGCCCGGGG - Intergenic
1129309439 15:74695876-74695898 CAGGCCCGTCGGCGCGGAGGTGG - Exonic
1129948222 15:79560540-79560562 CCGGTCCGGCCGCGCGGGCGGGG + Intergenic
1132550515 16:552123-552145 CAGCTCGGCCAGCGCGCCCGTGG + Exonic
1132765959 16:1534298-1534320 CAGGGCCACCAGCACGGCCGCGG - Exonic
1132883037 16:2170764-2170786 CAGGGCTGTCACCGCAGCCGTGG + Intronic
1142764462 17:2057587-2057609 TAGGCCCGTCGGGGCGGCCGGGG - Exonic
1145379102 17:22377286-22377308 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145379580 17:22379656-22379678 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145380059 17:22382026-22382048 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145380539 17:22384401-22384423 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145381017 17:22386748-22386770 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145381500 17:22389123-22389145 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145382229 17:22392897-22392919 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145382706 17:22395262-22395284 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145382988 17:22396625-22396647 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145383082 17:22397095-22397117 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145383560 17:22399448-22399470 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145384511 17:22404118-22404140 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145384830 17:22405580-22405602 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145384957 17:22406210-22406232 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1145385603 17:22409645-22409667 CAGGTCCGCCTGCGTGCCCGAGG + Intergenic
1150388638 17:64778747-64778769 CCGGTTCGTGAGCGCGGCTGTGG - Intergenic
1152567538 17:81106905-81106927 CAGGTCAGTGGGCGGGGCCGGGG + Exonic
1152683899 17:81684259-81684281 CTGGACCCTCGGCGCGGCCGTGG + Intronic
1154011795 18:10580623-10580645 CAGGTCCTTCAGCCCCGCCCAGG + Intergenic
1154274692 18:12948495-12948517 CAGCCCCGGCAGCGCGGCCTGGG - Intronic
1157916278 18:51666958-51666980 CAGGTCCGGCAGCGGGACAGAGG - Intergenic
1160256459 18:77251640-77251662 CAGGTCCCACAGCGCCGCGGCGG - Intronic
1160491125 18:79337314-79337336 CAGGTCCCTCAAGGTGGCCGCGG + Exonic
1160818259 19:1046250-1046272 CAGGTCGGTCAGGGGGTCCGCGG - Exonic
1162033124 19:7925834-7925856 CAGGTGCGAAAGCGCGGCCGCGG + Intronic
1163747608 19:19057546-19057568 CAGGTCCCGCAGGGCGGCCTTGG - Exonic
1165511587 19:36269407-36269429 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165512138 19:36271930-36271952 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165512686 19:36274429-36274451 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165513237 19:36276972-36276994 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165513792 19:36279525-36279547 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165514341 19:36282059-36282081 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165514895 19:36284598-36284620 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165515447 19:36287129-36287151 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165515997 19:36289667-36289689 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165516548 19:36292202-36292224 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165517100 19:36294730-36294752 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165517652 19:36297253-36297275 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165518205 19:36299788-36299810 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165518756 19:36302323-36302345 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165519304 19:36304853-36304875 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1165519853 19:36307368-36307390 CAGGTCCGCCTGCGTGCCCGTGG + Intergenic
1166367272 19:42284123-42284145 CTGGTCCGTCTGCCCGCCCGGGG + Intronic
1167080603 19:47274360-47274382 CGGGGCCGTCAGCGGGGGCGTGG + Intergenic
926325893 2:11784996-11785018 GAGGTCCCTCAGCCCGTCCGAGG - Exonic
931252878 2:60549683-60549705 CAGCTCGGCCAGCTCGGCCGCGG + Intronic
932812176 2:74834641-74834663 AAGGTAAGTCAGCGCGGGCGGGG + Exonic
935275692 2:101474033-101474055 CAGGTCCCTCCGCGCTGCGGCGG + Intronic
946312970 2:218892990-218893012 CTGGCCCGTCGGCGCGGCCCGGG - Exonic
1174486136 20:50862500-50862522 CAGGCCCGGCAGTGCTGCCGGGG + Intronic
1178314890 21:31559355-31559377 AGGCTCCGTCAGCGCGGCCCGGG + Intronic
1180987190 22:19911936-19911958 CAGGTGTGTCTGCGCGGCAGGGG + Intronic
1181126388 22:20704234-20704256 CAGGGCGGTGGGCGCGGCCGCGG + Intergenic
1183253600 22:36746690-36746712 CAGGTCTATCAGCCCAGCCGAGG + Intergenic
951543632 3:23806119-23806141 GAGGCCCGGCGGCGCGGCCGGGG - Intronic
961322305 3:126084196-126084218 GAGGTCCGGCCGCCCGGCCGGGG - Exonic
962218844 3:133546278-133546300 CGGGTCGGTGAGCGCGGCCCGGG - Intergenic
979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG + Exonic
996442957 5:123512495-123512517 CCAGTCCGTCAGCGCCGGCGGGG - Intronic
1005709508 6:28489951-28489973 CAGGTGCGTCTGCGGGGCCCAGG + Intergenic
1006396220 6:33789096-33789118 CAGGTCCGACAGGCCGGCCATGG + Exonic
1018079610 6:160247558-160247580 CAGGTCCCTCAGGGTGGCCCTGG + Intronic
1036723699 8:11200989-11201011 CGGCTCCGGCCGCGCGGCCGAGG + Exonic
1045259398 8:100559341-100559363 CAGGTCCAGCTGCTCGGCCGGGG - Intronic
1055612012 9:78032373-78032395 CCGGCCCGGGAGCGCGGCCGCGG + Intergenic
1058053250 9:100427142-100427164 CCGGTCCGTCGGCGCCGCCGAGG - Intronic
1060114341 9:120928796-120928818 CAGGTCGGTGAGCCCGCCCGAGG + Intronic
1061778918 9:132984497-132984519 CAGGGCCTTGAGCGCGGCCCTGG + Intronic
1061811285 9:133163876-133163898 CAGGGCAGGCAGCGGGGCCGCGG + Exonic
1062392304 9:136338708-136338730 CAGGTGCGTGGGCGCGGACGCGG + Exonic
1062720903 9:138043474-138043496 GAGGCCCCTCAGCGCGGCAGAGG + Intronic
1199264888 X:145818215-145818237 CGGGACCGTCCGCGCGGGCGTGG + Exonic