ID: 1113757289

View in Genome Browser
Species Human (GRCh38)
Location 13:112821907-112821929
Sequence CAGACAACCCATATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113757287_1113757289 -9 Left 1113757287 13:112821893-112821915 CCTTATAACACAGCCAGACAACC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1113757289 13:112821907-112821929 CAGACAACCCATATGCAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113757289 Original CRISPR CAGACAACCCATATGCAGCC TGG Intronic
900337853 1:2173655-2173677 CCGACAGCCCAGAGGCAGCCTGG + Intronic
903151913 1:21415644-21415666 CAGCCAAGGCATCTGCAGCCGGG - Intergenic
905108679 1:35578706-35578728 CAGACAATCTCTAAGCAGCCAGG + Intronic
905656794 1:39690913-39690935 CAGACAACCCATATCCAAACAGG + Intronic
910984403 1:92991698-92991720 CACACCATCCAGATGCAGCCAGG - Intergenic
913202887 1:116510507-116510529 CCGGCAACCCACATGTAGCCTGG - Intergenic
918495696 1:185133356-185133378 CAGATAAACCATATGAATCCGGG - Intronic
920733311 1:208509015-208509037 CATACAGCACATAAGCAGCCAGG - Intergenic
1063603238 10:7500670-7500692 CAGCCAACCCCTCTGCACCCCGG - Intergenic
1067143749 10:43678646-43678668 CAGACAACCCTTCTCCTGCCTGG - Intergenic
1067229829 10:44398390-44398412 CAGACAGCCCAGATTCATCCCGG - Intergenic
1068209214 10:53898260-53898282 GAAACAACCCATATGGGGCCGGG - Intronic
1068509291 10:57943933-57943955 CACACAACCACTATGCAGCATGG + Intergenic
1068594655 10:58889653-58889675 CAGTCAACCCATTTGCAGATGGG + Intergenic
1070142803 10:73751172-73751194 CAAACTGGCCATATGCAGCCTGG - Exonic
1075221406 10:120588100-120588122 CAGACTTCCCATAGGCAGGCAGG - Intronic
1075253142 10:120900280-120900302 CCGAGAACCCAGAGGCAGCCTGG - Intronic
1075568471 10:123521307-123521329 GAGACAACCCATAACCACCCAGG + Intergenic
1075926527 10:126255711-126255733 GAGACAACCCTCATGGAGCCAGG - Intronic
1077303816 11:1858976-1858998 CCGACAACCCACAAGCAGCTTGG - Intronic
1083089303 11:60183870-60183892 CAGTAAACTCATATGCAGGCTGG + Intronic
1085186988 11:74583970-74583992 CAATCAACCTATATGCAGGCAGG - Intronic
1086818753 11:91407114-91407136 CAGACAAACCCTATGCAGACAGG - Intergenic
1087615819 11:100486080-100486102 GAGACAACTCAAATGCAGCAAGG + Intergenic
1089214375 11:116827018-116827040 CAGACAACTCAGATCCAGCCAGG + Intergenic
1089785458 11:120904010-120904032 AAGACAACACAGAAGCAGCCAGG - Intronic
1097709966 12:62907464-62907486 CAGAGAACCCAAAGGCAGCATGG - Intronic
1098752015 12:74305469-74305491 CAGACAACACAAATGTATCCAGG - Intergenic
1099856591 12:88176298-88176320 CAGGCTACCCATGTTCAGCCAGG + Exonic
1100774670 12:97961120-97961142 CACACAACCCAAAAGCAGCAGGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1107213224 13:37884184-37884206 CAGAGAACCATTCTGCAGCCAGG + Intergenic
1108115890 13:47127611-47127633 CAGACAACCCAAATGCAAAATGG - Intergenic
1109350985 13:61180886-61180908 CAGACAACACATATCCAGGAAGG + Intergenic
1112988384 13:105480619-105480641 CAGACAAGCCATCTGCAAGCTGG + Intronic
1113757289 13:112821907-112821929 CAGACAACCCATATGCAGCCTGG + Intronic
1124510261 15:30318302-30318324 CATACAACCCATATTCACCTTGG + Intergenic
1124732628 15:32212251-32212273 CATACAACCCATATTCACCTTGG - Intergenic
1127299020 15:57634430-57634452 CTGCAAACTCATATGCAGCCAGG - Intronic
1127616865 15:60694780-60694802 AAATCAACCCATATGCAGCGAGG + Intronic
1129152426 15:73697300-73697322 CAGCCAAACCATGTGCATCCTGG - Intronic
1129293257 15:74584695-74584717 CAGACAACCAAGATGTAGCTGGG - Intronic
1129804922 15:78447901-78447923 CAGACAACCAATTTACAGTCTGG - Intronic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1133742542 16:8662337-8662359 CAGACAAACAATATTCACCCTGG - Intergenic
1134419475 16:14071856-14071878 CAGACACCCCCTCTGAAGCCTGG - Intronic
1135088046 16:19490486-19490508 CAAACAACCCACAGGTAGCCAGG - Exonic
1138452233 16:57100198-57100220 CAGTAAAACCAAATGCAGCCGGG - Intronic
1138741920 16:59320952-59320974 AAGAGAACCCAAATGTAGCCAGG - Intergenic
1141948058 16:87323763-87323785 CAGCCAAGGCAGATGCAGCCAGG + Intronic
1144019701 17:11229407-11229429 CAGAGAACTCATTTGCAGCCAGG - Intergenic
1144318419 17:14087773-14087795 CAGACATACCATATGCAGAGAGG - Intronic
1146365251 17:32219530-32219552 CACACAAGGCATATGCAGACTGG - Intronic
1150737124 17:67750640-67750662 CAGACAAACCCTAGGCAGACAGG + Intergenic
1152198171 17:78929733-78929755 CACCCAGCCCAGATGCAGCCTGG + Intergenic
1157784792 18:50471941-50471963 CAGAGAAACCAAATGCAGGCTGG + Intergenic
1157909014 18:51597636-51597658 CACACAAGCCAGATGCAGCCTGG - Intergenic
1163415077 19:17181393-17181415 CAGAGAAGCCATCTGCAGCAGGG + Intronic
1166292661 19:41873048-41873070 CAAGCAACCCAGCTGCAGCCTGG + Intergenic
925023361 2:588676-588698 CAGAGACCCCATGTGCACCCAGG + Intergenic
927436570 2:23071711-23071733 CACACTACCCCTATGCAGCTTGG + Intergenic
934613137 2:95755282-95755304 CAGACACCCTACATGCACCCAGG + Intergenic
934691507 2:96364095-96364117 CAGAAAACCCATTACCAGCCAGG - Intronic
938825663 2:135003119-135003141 CAGACCAGCCATCTGCAACCAGG + Intronic
939044363 2:137232470-137232492 CACACACCCCTTATGCAGCACGG - Intronic
945235855 2:207630692-207630714 CTGAGAACCCAGGTGCAGCCAGG - Intergenic
948795577 2:240400608-240400630 CAGACAAGGCCTGTGCAGCCAGG + Intergenic
1169146120 20:3253641-3253663 CAGACAACCGCTTTGCAGACAGG + Intronic
1170789020 20:19492423-19492445 GAGACAACGCATCTGTAGCCTGG + Intronic
1170909550 20:20551637-20551659 AACACAAACCATATTCAGCCTGG + Intronic
1171295742 20:24015206-24015228 CAGACCCACCCTATGCAGCCTGG + Intergenic
1172700920 20:36853140-36853162 CAGACAACACAGAGGCTGCCTGG + Intronic
1172742135 20:37177283-37177305 CAGACTTAGCATATGCAGCCAGG - Intronic
1175711944 20:61228326-61228348 CAGATCACCCACATGCACCCCGG + Intergenic
1182516967 22:30864564-30864586 CAGACAGCCCATACCCAGCAAGG - Intronic
1182926877 22:34133453-34133475 AACCCAACCCATATGCAGTCAGG - Intergenic
949790367 3:7785873-7785895 CCCACAGGCCATATGCAGCCTGG + Intergenic
951075378 3:18385325-18385347 AAGAAAACACATTTGCAGCCGGG + Intronic
951856527 3:27203156-27203178 CAGACAACCCATATACCAACAGG + Intronic
954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG + Intergenic
958584680 3:96070832-96070854 GAGACAACCCAGATGGTGCCAGG - Intergenic
959582288 3:107993787-107993809 CAGTGAACCAATATGCAGGCAGG - Intergenic
965118498 3:164521372-164521394 CAGGCACACCATCTGCAGCCAGG + Intergenic
965605549 3:170494731-170494753 TAAACAATGCATATGCAGCCTGG + Intronic
970419992 4:15897103-15897125 CAAAGAAGCCATGTGCAGCCAGG + Intergenic
971539932 4:27803350-27803372 CAGGCAAACCATATGGACCCTGG - Intergenic
974720995 4:65737670-65737692 CAGAGAAGCCCTATGCAGCCTGG - Intergenic
974846175 4:67353063-67353085 CAGACAAACCATATGTAGGCTGG + Intergenic
985571419 5:647576-647598 CAGACCACACAGCTGCAGCCTGG + Intronic
987965571 5:24867838-24867860 AAGACAAGACATAGGCAGCCTGG + Intergenic
990586845 5:57219645-57219667 CAGGAAACCCATATGCATCCAGG - Intronic
991205961 5:64050721-64050743 CAGACAAACCCTAGGCAGACAGG + Intergenic
993832757 5:92779836-92779858 CTGACAACCCATGTGCTGCATGG - Intergenic
994413717 5:99441643-99441665 CAGACAACAAAGATGTAGCCAGG - Intergenic
994614786 5:102090894-102090916 CAGACAATCCTTGTGCAGTCTGG + Intergenic
996919470 5:128750673-128750695 CAGACAACACATAAGCAGACAGG - Intronic
997099823 5:130956956-130956978 CTGACTAGCCATATGCAGACTGG - Intergenic
997698958 5:135882973-135882995 CAAACAACCCATTTGGAGACTGG - Intronic
999443205 5:151619077-151619099 CAGACAATCAATATTCATCCTGG - Intergenic
1004540171 6:16542209-16542231 CAGAGAACCCATTGGAAGCCTGG - Intronic
1007406951 6:41640720-41640742 CAGCCACCCCAGATGCAGACAGG + Intronic
1007599087 6:43070828-43070850 CGGACAACCCTAATGTAGCCCGG + Exonic
1011049263 6:83126409-83126431 CAGACAAATCCTAGGCAGCCAGG - Intronic
1011140022 6:84142679-84142701 CATACAACCCTTATGCTACCTGG + Intronic
1011623253 6:89262283-89262305 CATACAACCCATGTTCACCCTGG - Intronic
1012309206 6:97700402-97700424 AAGAAATCCCACATGCAGCCGGG + Intergenic
1014270309 6:119329034-119329056 CAGAAAACCTCTGTGCAGCCAGG + Intronic
1014390612 6:120857691-120857713 CAGACAACCCTTGTGGACCCTGG + Intergenic
1020838034 7:13179081-13179103 CAGACAAATAATATGCAGCAGGG - Intergenic
1023049546 7:36239241-36239263 CACACAACCCAGAGGGAGCCAGG - Intronic
1037767142 8:21779219-21779241 CAGAGAAGCCATCTGCAGTCAGG + Intronic
1038163749 8:25064768-25064790 AAGACAACCCATCTGCATTCAGG - Intergenic
1045319262 8:101069543-101069565 CAGCCAACCCAGATCCTGCCAGG - Intergenic
1057903786 9:98968870-98968892 AAGACAACCCATTTTCAGGCTGG + Intronic
1061865878 9:133491570-133491592 CAGGCAACCCACATGCATTCTGG + Intergenic
1062038252 9:134392288-134392310 CAGACCACCCATCTGCTGCCTGG - Intronic
1185814149 X:3138672-3138694 CAGAGAACCCAAATTCAGGCAGG + Intergenic
1186667864 X:11736850-11736872 CAAACAACCCAACTGCAGCAAGG - Intergenic
1188263344 X:28042083-28042105 CAGGCAACCCAGATGCTTCCGGG + Intergenic
1190264389 X:48818695-48818717 CATACAACACAGATCCAGCCAGG - Intronic
1195687679 X:107601141-107601163 CAGAGCACCCACAGGCAGCCGGG + Exonic