ID: 1113758509

View in Genome Browser
Species Human (GRCh38)
Location 13:112831349-112831371
Sequence CGGGCAGGGCACAGCAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113758509_1113758516 9 Left 1113758509 13:112831349-112831371 CCTGACTTGCTGTGCCCTGCCCG 0: 1
1: 0
2: 0
3: 17
4: 284
Right 1113758516 13:112831381-112831403 TACATCTTCACAGACAAGACCGG 0: 1
1: 0
2: 3
3: 13
4: 160
1113758509_1113758517 20 Left 1113758509 13:112831349-112831371 CCTGACTTGCTGTGCCCTGCCCG 0: 1
1: 0
2: 0
3: 17
4: 284
Right 1113758517 13:112831392-112831414 AGACAAGACCGGCACCCTCACGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113758509 Original CRISPR CGGGCAGGGCACAGCAAGTC AGG (reversed) Intronic
900636966 1:3670792-3670814 CGGGCGGGGCCCAGCAGGTCAGG - Intronic
900739857 1:4324173-4324195 AGGGCAGGGCACAGCAAGGTGGG + Intergenic
901883466 1:12207293-12207315 GGGGCAGGTCACAGAGAGTCAGG - Exonic
902437843 1:16409673-16409695 AGGGCAGGGCCCAGCAGGACAGG + Exonic
902894344 1:19468573-19468595 AGGGCAGGGCAGAGCAGGGCAGG + Intronic
905371631 1:37485599-37485621 CAGACACGGCACAGCCAGTCAGG - Intergenic
906636789 1:47415731-47415753 GGGGCAGGGCAGAGCCAGGCCGG - Intergenic
907045518 1:51297940-51297962 TGGGCAGGGCACAGCAGGGCAGG - Intronic
907830459 1:58060024-58060046 AGGGGAGGGCACACCAAGCCAGG + Intronic
907962448 1:59296531-59296553 CGGGCAGGGCTGGGCAAGGCGGG - Intergenic
908683882 1:66692524-66692546 AGAGCAGTGCACAGGAAGTCTGG - Intronic
910435905 1:87205563-87205585 CGGGAAGGGAAAAGCACGTCAGG - Intergenic
911233599 1:95385768-95385790 TGGGCAGGTCACCTCAAGTCAGG + Intergenic
915277936 1:154802470-154802492 GGGGCAGGGCCCAGGAAGTATGG + Intronic
915415890 1:155742710-155742732 CTGGCAGGGCACAGTGACTCAGG + Intergenic
915532864 1:156513522-156513544 CGGGCAGGTCACCTGAAGTCAGG + Intergenic
915722858 1:157996618-157996640 CTGGCAGAGAACAGCAGGTCTGG + Intronic
915731168 1:158055524-158055546 CGGCCAGGGCACAGGAAGTGGGG - Intronic
917491254 1:175500508-175500530 CGGGCAGGGAAAACCAAGGCTGG + Intronic
919407247 1:197200992-197201014 CGGGCAAGGCACAGCTCTTCAGG + Intergenic
919762481 1:201106721-201106743 TGGCCAGGGCACAGGATGTCGGG - Intronic
921361646 1:214335245-214335267 GGGTCAGGGCACAGCCAGGCTGG + Intronic
921417066 1:214900777-214900799 CGGGCAGGTCACTTCAGGTCAGG + Intergenic
922483452 1:225955569-225955591 GGGGCAGGGCTCAGCCAGACTGG - Intergenic
922897119 1:229109033-229109055 CGGGCAGGGCTGTGCAATTCAGG - Intergenic
923211657 1:231808918-231808940 CAGGGAGGGCACAGAGAGTCGGG + Intronic
923790239 1:237105467-237105489 CGGGCAGGTCACTTGAAGTCAGG + Intronic
923798139 1:237180065-237180087 CGGACATGGCTCAGTAAGTCGGG - Intronic
924042266 1:239995467-239995489 AGGGCAGGCCACAGGAGGTCAGG + Intergenic
1062961960 10:1578973-1578995 TGGGCAGGGACCAGCAAGCCTGG + Intronic
1062989997 10:1806331-1806353 CGTGGAGGGCAGGGCAAGTCAGG - Intergenic
1063001035 10:1923378-1923400 AGGGCAGGGCACAGGGAGTGTGG - Intergenic
1067109965 10:43393366-43393388 CGGGCAGGTCACCTGAAGTCAGG + Intronic
1067692306 10:48509643-48509665 CGGGGAGGGCCCAGCGAGTCTGG - Intronic
1069848035 10:71386255-71386277 TGGACAGGGCTCAGAAAGTCAGG - Intergenic
1069881355 10:71595762-71595784 CAGGCAGGCCACATCAAGGCTGG - Intronic
1072756099 10:98022126-98022148 CGGGCAGATCACAGGAGGTCAGG + Intronic
1075849967 10:125578914-125578936 CGACCAGGGCACAGCATGTGGGG - Intronic
1076250789 10:128982482-128982504 CCTGCAGGGCACAGCCAGCCTGG - Intergenic
1076642706 10:131929628-131929650 CGGGCAGAGCACAGCCCCTCAGG - Intronic
1076737478 10:132465281-132465303 GGGGCAGGGCAGGGCAAGGCAGG - Intergenic
1076791055 10:132776949-132776971 CGGCCAGGGCACAGCTCATCTGG - Intronic
1077096590 11:801659-801681 GGGTCAGGGCACAGCCAGTCAGG + Intronic
1077099966 11:818359-818381 CGGGCGGATCACAGAAAGTCGGG - Intergenic
1077316425 11:1921293-1921315 CGGGCTGGGCACAGCAGGGCGGG + Intronic
1078626046 11:12959202-12959224 AGGGCAGGGCAGGGCAAGGCAGG + Intergenic
1081655124 11:44851984-44852006 GGGGGAGGGCACAGAAATTCTGG - Intronic
1082965993 11:58966634-58966656 CGGGCAGAGCACCTGAAGTCAGG + Intronic
1083622449 11:64055893-64055915 CAGGCAGGGCACAGCAGGTGAGG + Intronic
1083746022 11:64736871-64736893 CGGGCTGGGTCCAGCCAGTCAGG + Exonic
1084899213 11:72297232-72297254 CGGGCAGGGCCCAGCATCCCTGG - Intronic
1085017788 11:73186524-73186546 CAGGCAGGAGCCAGCAAGTCTGG - Intergenic
1085837424 11:79971947-79971969 CTGGCAGGGAGCAGCAATTCAGG + Intergenic
1087008045 11:93488253-93488275 CACGCAGGGGCCAGCAAGTCCGG + Intronic
1088939606 11:114439805-114439827 CGGGCGGTGCAGGGCAAGTCCGG + Intronic
1090097495 11:123757298-123757320 AGGAAAGAGCACAGCAAGTCAGG - Intergenic
1090370988 11:126252462-126252484 TGGGCTGGGCACAGCAGCTCAGG + Intronic
1092557052 12:9569795-9569817 CGGGGAGGGCATCGCAAGGCGGG - Intergenic
1094108941 12:26840537-26840559 CGGGCAGGTCACTGGAGGTCAGG + Intergenic
1094841025 12:34342758-34342780 CGCGCAGGGCCCAGCCACTCCGG - Intergenic
1095097869 12:38157716-38157738 GGGGAAGGGGACAGCACGTCAGG + Intergenic
1099185561 12:79512485-79512507 CATGCAGGGCACTTCAAGTCTGG + Intergenic
1099848612 12:88062004-88062026 CGGGCAGATCACTGGAAGTCAGG - Intronic
1102499966 12:113345248-113345270 CGGGCAGATCACTGCAGGTCAGG - Intronic
1105336498 13:19475451-19475473 CGGGCAGATCACATGAAGTCAGG - Intronic
1107891937 13:44921618-44921640 CGGGAAGGACAGAGCAGGTCGGG - Intergenic
1108693063 13:52877505-52877527 CAGGCAGGGCACAGCAGCCCTGG - Intergenic
1109062126 13:57632709-57632731 GGCGGAGGGCGCAGCAAGTCGGG + Exonic
1111924732 13:94450352-94450374 CAGGCAGGGCGCAGCAAGGATGG + Intronic
1112002476 13:95223727-95223749 CGGGCAGATCACATGAAGTCAGG - Intronic
1112172064 13:96984155-96984177 CCGCCAGGGCACAGCTACTCAGG - Intergenic
1113064511 13:106359871-106359893 TATGCAGGGCTCAGCAAGTCAGG + Intergenic
1113758509 13:112831349-112831371 CGGGCAGGGCACAGCAAGTCAGG - Intronic
1113889579 13:113728834-113728856 CGGGGAGGGCACAGCCCGGCTGG + Intronic
1113948873 13:114060193-114060215 TGGGCAGGGCACGGCAGGACCGG + Intronic
1114643183 14:24238281-24238303 CTGGCTGGGCACAGTGAGTCAGG + Exonic
1118661063 14:68013043-68013065 CGGACAGGGCACAGCAGGAATGG + Intronic
1119361800 14:74056425-74056447 CGGGCAGGTCACCTCAGGTCAGG - Intronic
1119701605 14:76759655-76759677 CAGACAGGGCACAGCAGGGCTGG + Intergenic
1119795208 14:77390221-77390243 CGGGCAGATCACCGGAAGTCAGG - Intronic
1121486650 14:94321529-94321551 AGGGCAGGTTACAGCAAGACAGG + Intronic
1122373382 14:101242011-101242033 TGGGCAGGCCACAGGAAGCCAGG - Intergenic
1122471824 14:101973385-101973407 CGGGCAGATCACTTCAAGTCAGG - Intronic
1122623721 14:103073832-103073854 AGGGCAGGGCCCAGGATGTCAGG + Intergenic
1122793605 14:104194845-104194867 CAGGCAGGGCCCAGCATGCCAGG + Intergenic
1124139309 15:27063519-27063541 TGGTCAGGGCAGAGCAAGCCAGG - Intronic
1124641119 15:31397246-31397268 CGGGCAGGGCAGGGCAGGGCAGG + Intronic
1124700744 15:31909867-31909889 GGGGCAGAGCTCAGGAAGTCTGG + Intergenic
1125564687 15:40667665-40667687 TGGGCAGGTCACATGAAGTCAGG + Intergenic
1125728351 15:41879590-41879612 GGGGCAAGGGACAGCCAGTCTGG - Intronic
1129255180 15:74330320-74330342 GGGGCAGGGCAAAGCCAGTGAGG + Exonic
1129757219 15:78105691-78105713 TGGGCAGGGCAGAGCAGGGCAGG - Intronic
1129859446 15:78849033-78849055 TGGGCAGGGCACAGTGACTCAGG + Intronic
1129978103 15:79839873-79839895 GGGGCTGGGCACAGCAGCTCAGG + Intronic
1131800867 15:96068265-96068287 CGGGCGGATCACAGGAAGTCAGG + Intergenic
1132503906 16:297394-297416 CGGGCAGGGGACAGCGGGTGGGG - Intronic
1132731791 16:1366471-1366493 CGGGCAGGACTCAGCATCTCAGG + Intronic
1135469846 16:22720657-22720679 CGGGCAGAGCACATGAGGTCAGG - Intergenic
1136500599 16:30668114-30668136 CGGGAAGGGCCCTGCATGTCAGG + Intronic
1137476000 16:48810774-48810796 CGGGGCGGGCACAGCGGGTCGGG + Intergenic
1137655013 16:50152644-50152666 CGGCCAGGGCGCAGCAGGGCGGG + Intergenic
1137723447 16:50641332-50641354 TGGGCAGGGGACAGGAAGGCAGG - Intergenic
1138179034 16:54930224-54930246 CGCCCAGGGCGCAGGAAGTCCGG - Intergenic
1138180287 16:54936543-54936565 CGGGCAGCGGACAGCGACTCAGG - Intergenic
1138898829 16:61244106-61244128 CGAGCAGAGCACAGCCTGTCAGG - Intergenic
1138964984 16:62073233-62073255 AGGGCAGGGCAGGGCAAGGCAGG + Intergenic
1139492559 16:67294178-67294200 AGGGAAGGGCACAGTAACTCTGG + Intronic
1141567912 16:84915776-84915798 AGTCCAGGGCACAGCAAGCCTGG + Intronic
1142188199 16:88704760-88704782 CGGGCAGGTCACCGGAGGTCAGG + Intronic
1142807871 17:2380848-2380870 CGGGCACTGCACAGCCTGTCTGG + Exonic
1143140474 17:4739493-4739515 CGGTCGGGGCACAGCAGGGCCGG - Exonic
1145961944 17:28891997-28892019 TGGGCAGGGAACAGTAAGACGGG + Intronic
1146311958 17:31776259-31776281 TGGGCAGGGGTCAGCAAGTTGGG + Intergenic
1146785781 17:35720111-35720133 CGGGCTGGGCACAGGATGACAGG + Intronic
1146957225 17:36942718-36942740 CGGGGAGGGCGCAGGACGTCAGG - Intronic
1147446164 17:40476443-40476465 GGGGGAGGGCTCAGCAAGACAGG + Exonic
1147556482 17:41482411-41482433 CTGGGAGGGCACAGCAGGGCTGG - Intergenic
1147644952 17:42027941-42027963 CAGGCAGGGCACAGCAGAGCAGG - Intronic
1147768780 17:42853861-42853883 TGTGCAGAGCACAGCAAGGCAGG - Intronic
1148107723 17:45128245-45128267 CGGGTGGGACACAGCAAGTGGGG + Intronic
1148340356 17:46869769-46869791 CGGGCAGGTCACTTGAAGTCAGG + Intronic
1148867304 17:50635185-50635207 CGGGAAGGGCAGAGCAGGGCAGG - Intronic
1149215522 17:54349405-54349427 AGGGAAGAGCCCAGCAAGTCAGG + Intergenic
1152367460 17:79864856-79864878 GAGGCAGGGCAGAGCAAGGCAGG - Intergenic
1152693953 17:81734569-81734591 CGGGGAGGGCACGGCAGGGCCGG + Intergenic
1152699179 17:81810788-81810810 AGGGCAGGGCAGAGCAGGGCAGG - Intronic
1153575066 18:6511930-6511952 CAGGCAGGGCACACCAGCTCCGG + Intronic
1154157029 18:11951787-11951809 CCTGCAGGGCACAGAGAGTCTGG - Intergenic
1154501960 18:15001621-15001643 AGGGCAGGGCAAGGCAAGGCAGG - Intergenic
1154512451 18:15122490-15122512 CGGGCAGGGTCGAGCAACTCTGG + Intergenic
1156290699 18:35747080-35747102 AGGGCAGGGCAGGGCAAGGCTGG - Intergenic
1157286590 18:46381245-46381267 CACGGAGGGGACAGCAAGTCTGG - Intronic
1157535604 18:48455292-48455314 AGGGCTGGGCACAGCACTTCGGG - Intergenic
1159875765 18:73809243-73809265 CTGGCAAGGCACAGGATGTCCGG - Intergenic
1160511338 18:79455288-79455310 CGGGCAGGGCTCAGCGGGTGGGG + Intronic
1160597755 18:79988784-79988806 GGGGCAGGGCACGGCGAGCCCGG - Intronic
1161172360 19:2819289-2819311 CGGGCAGATCACTGGAAGTCAGG + Intergenic
1161653778 19:5500683-5500705 TGGGCATGGAACAGCCAGTCAGG - Intergenic
1162411789 19:10510510-10510532 GGGGCAGGGGCCAGCACGTCTGG + Intergenic
1163133410 19:15291133-15291155 GGAGCAGGGCATAACAAGTCAGG - Intronic
1163548426 19:17952294-17952316 CGGGCAGGGCGCAGGGACTCCGG + Intronic
1163830938 19:19546896-19546918 GGGGCAGGCAACAGCAAGCCAGG + Intergenic
1166929096 19:46290427-46290449 TGGGCAGGGCTCAGCAGGTATGG - Intergenic
1167503222 19:49858686-49858708 CGGCCAGGGCAGAGCGAGCCCGG + Intronic
1167539535 19:50076413-50076435 CGGGCAGATCACAGGAGGTCAGG - Intergenic
1168021163 19:53609755-53609777 CGGGCAGGTCACCTGAAGTCAGG + Intergenic
925887749 2:8407751-8407773 AGGGCAGGTCACAGGACGTCTGG + Intergenic
926292172 2:11539894-11539916 CGGGCAGGGGCCAGGAAGCCTGG + Intronic
927479592 2:23441577-23441599 TGGGCAGGGCTCAGCAAGGATGG + Intronic
927696050 2:25240518-25240540 CGGGGAGGGCACGGGAAGACAGG + Intronic
927957963 2:27221373-27221395 TGGGCAGAGCACAGCATGCCTGG + Intronic
929031618 2:37654543-37654565 TGGGGAGGGGACAGCAAGTATGG + Intronic
929902891 2:46021101-46021123 GGGGCAGGGCACAGTGAGTTTGG + Intronic
930829037 2:55723932-55723954 CTGGCAGGTCAAATCAAGTCCGG - Intergenic
932457287 2:71857757-71857779 CAGACAGGGGAGAGCAAGTCGGG - Intergenic
932735217 2:74249656-74249678 AGGGCAGGGAGCAGCACGTCAGG + Intronic
933363318 2:81315449-81315471 CGGGCAGATCACTGTAAGTCAGG + Intergenic
935568903 2:104638452-104638474 CGGGGAGGGCAAAGGAGGTCTGG - Intergenic
936664118 2:114574875-114574897 TGGGCAGGGCACAGCGAGGCAGG + Intronic
937203413 2:120220501-120220523 CGGGCAGATCACCTCAAGTCAGG + Intergenic
940636176 2:156299875-156299897 TGGGCAGGGCACAGCAGGAATGG + Intergenic
945796524 2:214371303-214371325 CGGGCAGATCACATGAAGTCCGG + Intronic
946049521 2:216850302-216850324 CGGTCACTGCATAGCAAGTCGGG - Intergenic
946165647 2:217862208-217862230 AGGGCAGGGCATGGCAAATCTGG + Intronic
946329491 2:219001477-219001499 CGGGCAGGGCAAGGCAGGGCGGG + Intergenic
946391453 2:219419074-219419096 CGGGCAGGGCACAGGAGGCTAGG + Intronic
948691320 2:239706884-239706906 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691333 2:239706919-239706941 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691346 2:239706959-239706981 AGGGCAGGGCAAGGCAAGGCAGG - Intergenic
948691362 2:239707004-239707026 AGGGCAGGGCAAAGCAGGGCAGG - Intergenic
948691376 2:239707054-239707076 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691414 2:239707159-239707181 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691421 2:239707179-239707201 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691428 2:239707199-239707221 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691439 2:239707234-239707256 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691446 2:239707254-239707276 AGGGCAGGGCAAAGCAGGGCAGG - Intergenic
948691492 2:239707389-239707411 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691508 2:239707439-239707461 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691529 2:239707494-239707516 AGGGCAGGGCAAAGCAGGGCAGG - Intergenic
948691538 2:239707524-239707546 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691564 2:239707604-239707626 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691583 2:239707659-239707681 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691596 2:239707694-239707716 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948691616 2:239707754-239707776 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
948753418 2:240145095-240145117 CAGGCAGGACACAGCCAGGCAGG - Intergenic
1171406692 20:24916548-24916570 AGTGCTGGGCACAGCAAGGCAGG + Intergenic
1173111484 20:40194793-40194815 CGGGCAGGTCACCTCAGGTCAGG + Intergenic
1173888385 20:46481639-46481661 GGAGCAGGGCACAGGCAGTCAGG + Intergenic
1175220245 20:57412514-57412536 AGGGCAGAGCAGAGCAAGCCAGG - Intergenic
1175836994 20:62002277-62002299 CAGGCAGGGCATAGCAGGCCTGG - Intronic
1175856354 20:62122843-62122865 CGGGGAGGGCACCGCAGGCCGGG - Intronic
1175861731 20:62153950-62153972 AGGGGAGGGGACAGCAAGTGAGG - Intronic
1176297522 21:5082122-5082144 TGGGCAGGGCTCAGCAGGGCTGG + Intergenic
1176865875 21:14054905-14054927 GGGGCAGGGCAAATCAGGTCAGG + Intergenic
1179859507 21:44179826-44179848 TGGGCAGGGCTCAGCAGGGCTGG - Intergenic
1180563059 22:16637190-16637212 CGGGCAGATCACATGAAGTCAGG + Intergenic
1180833803 22:18919815-18919837 CGGTCAGGCCACAGCAAGGGCGG + Intronic
1181465912 22:23110492-23110514 CTCTCAGGGCACAGCAAGGCAGG + Intronic
1183252191 22:36738039-36738061 AGGGCAGGGCAGAGCAGGGCAGG - Intergenic
1183319552 22:37156752-37156774 CGGGCAGGGGAGAGCAGGTTTGG + Intronic
1183491715 22:38120462-38120484 CGGGCAGGGCAGAGCCAGGCAGG + Intronic
1183491728 22:38120506-38120528 CGGGCAGGGCAGAGCCAGGCAGG + Intronic
1184264039 22:43337299-43337321 CGGGCAGGGGACAGCAGGAGAGG + Intronic
1184512555 22:44942070-44942092 CTGACATGGCACAGCAAGTCTGG + Intronic
1184651041 22:45919581-45919603 CGGGCTGGGCACAGCAAGGATGG + Intergenic
1185402327 22:50625530-50625552 CGGGGAGGGGTCAGCAGGTCGGG + Intronic
1203283889 22_KI270734v1_random:145113-145135 CGGTCAGGCCACAGCAAGGGCGG + Intergenic
949502442 3:4693752-4693774 CGAGAAGGGCACAGCCAGGCTGG - Intronic
951960230 3:28310054-28310076 AGGGAAGGGCACAGAAGGTCTGG - Intronic
952872015 3:37909450-37909472 GGGGCAGGCCACAGGCAGTCTGG - Intronic
953044800 3:39284813-39284835 CAGGCAGGGAACAGCAAGAGGGG + Intergenic
961829409 3:129615811-129615833 CAGGCAGGGCACAGCAAGGGCGG + Intergenic
964017037 3:151960424-151960446 TGGGCAGGGTACACCAAGCCTGG - Intergenic
964245202 3:154643724-154643746 AGGGCAGGTCACAGAAGGTCAGG + Intergenic
967189370 3:186972475-186972497 CGGGCAGATCACAGGAGGTCAGG - Intronic
967560541 3:190913018-190913040 AGGGCACGGCTCAGCAAGTGTGG - Intergenic
969183026 4:5456401-5456423 CGGCCAAGGCCCAGCAAGTGGGG + Intronic
969651615 4:8471487-8471509 CACGCAGGACAGAGCAAGTCGGG + Intronic
972345993 4:38192703-38192725 CGGGCAGGGCAGGGCAGGGCAGG + Intergenic
975229013 4:71908702-71908724 TGGGCTGGGCAAAGCAAGTGAGG + Intergenic
976082941 4:81376034-81376056 CGGGGAGGGCACAGCGATTGTGG - Intergenic
978510062 4:109507499-109507521 CGGGCAGGTCACCTGAAGTCAGG - Intronic
978850047 4:113324023-113324045 CAGGCAGTCCACAGTAAGTCTGG - Intronic
978927654 4:114268691-114268713 GGGGCTGAGCACAGCATGTCTGG - Intergenic
979513060 4:121575681-121575703 AGGGCAGGGCAGGGCAAGGCAGG + Intergenic
981328943 4:143485388-143485410 CAGGCAGCACACAGCAAGCCTGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
988641822 5:33049178-33049200 CGGGCAAAGCACAGAAACTCAGG + Intergenic
989792923 5:45429302-45429324 TGGGCAGGGCTCAGCAAGAATGG + Intronic
992473195 5:77077531-77077553 CGGGCAGGGCGCGGCAGGTGGGG + Exonic
992688323 5:79219230-79219252 CGGGCAGATCACCGGAAGTCGGG - Intronic
993781476 5:92070934-92070956 CAGACAGGGCATAGAAAGTCGGG + Intergenic
994697923 5:103096112-103096134 CGGGCAGGTCACGGGAGGTCAGG + Intronic
996955237 5:129175531-129175553 CGGGCAGATCACTTCAAGTCAGG - Intergenic
997831087 5:137150665-137150687 CAGGCAGGGCTCAGCAAGGCAGG + Intronic
998435892 5:142108708-142108730 CGGGCAGGGCGGCGCGAGTCGGG + Exonic
999730827 5:154475827-154475849 CCGGCTGGCCGCAGCAAGTCTGG - Exonic
1000859500 5:166439242-166439264 CGGGCAGATCACTGGAAGTCAGG + Intergenic
1001773171 5:174311045-174311067 AGGGCAGGGGACAGCAAATGGGG + Intergenic
1002106234 5:176880622-176880644 CGGGCAGGGCACCTCAAGGCTGG - Exonic
1002134154 5:177097781-177097803 TGGACACGGCACAGCAACTCTGG - Exonic
1002387523 5:178879604-178879626 CGGGCAGATCACAGGAGGTCAGG - Intronic
1003211885 6:4076099-4076121 CGGGCAGATCACCTCAAGTCAGG + Intronic
1004385323 6:15167763-15167785 CGGGCAGATCACATCAGGTCAGG - Intergenic
1005442236 6:25882331-25882353 CGGCCAGGGAAGACCAAGTCTGG + Intergenic
1006544604 6:34769418-34769440 CGGGCAGATCACAGGAGGTCAGG - Intronic
1011611676 6:89157775-89157797 CGGGCAGATCACATGAAGTCAGG + Intronic
1017916637 6:158836451-158836473 CGGGCAGGTCACCTGAAGTCAGG + Intergenic
1018509139 6:164506279-164506301 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
1021403385 7:20236294-20236316 CGCTCAGGGAACTGCAAGTCTGG + Intergenic
1022500290 7:30878428-30878450 CCGGCAGGACACAGCCAGGCCGG - Intronic
1023320870 7:38996266-38996288 CGGGCAGATCACCTCAAGTCGGG - Intronic
1023771533 7:43561010-43561032 CTGGCAGGGAGCAGCTAGTCAGG + Intronic
1024216405 7:47252896-47252918 AGGGCAAGGAAGAGCAAGTCAGG - Intergenic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1030257111 7:107522239-107522261 CGGGCAGGTCACCTGAAGTCAGG + Intronic
1032018488 7:128394030-128394052 CGAGCAGGGCACAGGAGGTGTGG - Intronic
1032326337 7:130932360-130932382 CGGGCAGGTCACTTGAAGTCAGG + Intergenic
1033352225 7:140570745-140570767 GGGGCAGGGCACAGGGCGTCTGG - Intronic
1034814963 7:154164202-154164224 AGGGGAGGGGACAGCAGGTCAGG - Intronic
1035112132 7:156492091-156492113 AGGCCGGGGCACAGCAGGTCAGG - Intergenic
1035286372 7:157809866-157809888 TGGGCAGGGCCCAGCAGGACTGG - Intronic
1035314882 7:157991517-157991539 CGTGCAGGGCACAGAAACTCAGG + Intronic
1036474421 8:9080306-9080328 CTAGCAGGGCACATCTAGTCAGG - Intronic
1036659683 8:10700002-10700024 TGGCCAGGCCACAGCCAGTCAGG + Intronic
1040276528 8:46016770-46016792 GGGGGAGGGGACTGCAAGTCAGG - Intergenic
1040276676 8:46017422-46017444 ATGGAAGGGGACAGCAAGTCAGG - Intergenic
1040290918 8:46123735-46123757 CTGGCAGGCCACAGAAACTCAGG - Intergenic
1044686815 8:94833997-94834019 CGGGCAGATCACTGGAAGTCGGG - Intronic
1045488126 8:102649937-102649959 CAGGCAGGTCACAGAAAGGCAGG - Exonic
1048304326 8:133273056-133273078 CGGGCAGGGCTCTGGAGGTCTGG - Intronic
1048801912 8:138201896-138201918 CGGGCAGATCACAGGAGGTCGGG + Intronic
1049153933 8:141055690-141055712 CTGGGCGGGAACAGCAAGTCTGG - Intergenic
1049322286 8:142002966-142002988 CGGGCAGGGCACAGGCAGAGAGG - Intergenic
1049344848 8:142133407-142133429 CTTGGAGGGCACAGCCAGTCCGG + Intergenic
1049653639 8:143788334-143788356 AGGGCCAGGCACAGGAAGTCAGG + Intergenic
1051850890 9:21506397-21506419 AGGTCATGGCACAGGAAGTCAGG + Intergenic
1053532884 9:38899304-38899326 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1054205110 9:62123733-62123755 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1054633249 9:67464637-67464659 GGGGCAGGGCACAGTGAGGCTGG + Intergenic
1055554305 9:77459869-77459891 TGGGCAGGGCACAGAATGCCTGG - Intronic
1056174141 9:84017713-84017735 AGGGCAGGGCAGGGCAAGGCAGG - Intergenic
1056351928 9:85758415-85758437 CGGGCAGGTCACGGGAGGTCAGG + Intergenic
1058860357 9:109112311-109112333 CGGGCAGATCACATGAAGTCAGG + Intronic
1058989220 9:110239040-110239062 AGGGCAGGGCACAGCAATGGAGG - Intergenic
1061119620 9:128634998-128635020 AGGGGAGATCACAGCAAGTCAGG + Intronic
1061824998 9:133252458-133252480 CAGGTAGGGCACAGCCAGCCTGG - Intronic
1062025687 9:134339138-134339160 CGGACAGGGCACAGGGAGGCAGG - Intronic
1062485264 9:136771331-136771353 CGGGAAGCCCACAGCAAGCCCGG - Intergenic
1062710077 9:137970723-137970745 GGGCCAGGGCACAGCAGGACTGG + Intronic
1185633156 X:1531456-1531478 CGGGCTGGGCACAGTCAGGCTGG - Intronic
1187366044 X:18666616-18666638 CGGGCTGGCCACGGCAAGTGTGG + Intronic
1189726219 X:43970178-43970200 AGGGCAGGCCACAGCAACCCAGG + Intronic
1190311812 X:49122346-49122368 CGGACAGGGCAAAGAAAGGCTGG + Intronic
1191192459 X:57680834-57680856 CGGGCAGATCACTTCAAGTCAGG - Intergenic
1195649575 X:107271177-107271199 CGGGCAGGTCACCTGAAGTCGGG - Intergenic
1197108361 X:122742926-122742948 CAGGCTGGGCACAGCACGTTGGG - Intergenic
1197939947 X:131778976-131778998 CGGCCCCGGCACAGGAAGTCGGG + Intergenic
1199654265 X:149979294-149979316 AGGGCTGGGCAAAGCCAGTCTGG + Intergenic
1200329877 X:155284484-155284506 CGGGCAGGTCACCTGAAGTCAGG - Intronic
1201763603 Y:17561597-17561619 GGGGAAGGGTACAGCACGTCAGG - Intergenic
1201837950 Y:18344393-18344415 GGGGAAGGGTACAGCACGTCAGG + Intergenic