ID: 1113764030

View in Genome Browser
Species Human (GRCh38)
Location 13:112869735-112869757
Sequence GGAGGCTGCTGTGCTGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113764030_1113764033 -2 Left 1113764030 13:112869735-112869757 CCAGTTACAGCACAGCAGCCTCC 0: 1
1: 0
2: 2
3: 11
4: 192
Right 1113764033 13:112869756-112869778 CCCGCCCTCCAGCACCTTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 293
1113764030_1113764039 15 Left 1113764030 13:112869735-112869757 CCAGTTACAGCACAGCAGCCTCC 0: 1
1: 0
2: 2
3: 11
4: 192
Right 1113764039 13:112869773-112869795 TGCTGGCCACATGTGCTTGTAGG 0: 1
1: 0
2: 1
3: 23
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113764030 Original CRISPR GGAGGCTGCTGTGCTGTAAC TGG (reversed) Intronic
900640449 1:3685786-3685808 GGAAGCTGCTGTGCTGGGGCTGG + Intronic
901128976 1:6950290-6950312 AGAGGCTGCTGTGATGTTGCAGG - Intronic
901924370 1:12556588-12556610 AGCTGCTGCTGTGATGTAACTGG - Intergenic
903754098 1:25648591-25648613 GGAGGCTGCTGCCCAGTAAAGGG - Intronic
904349037 1:29893156-29893178 GGCTGCTGCTGTGATGTAAGGGG + Intergenic
904714185 1:32454612-32454634 GGAGGCTGCTTGGCAGTGACAGG + Intergenic
905620484 1:39441292-39441314 GCAAGCTGCTGTGCAGTATCAGG + Exonic
906673894 1:47679356-47679378 GGAGGCTCCTGCGCTGTATTGGG + Intergenic
906956258 1:50377417-50377439 GGAGGCTGCTGTGATCTAAAGGG + Intergenic
909516330 1:76511374-76511396 GCAGGCAGCTGTGCTGTTTCAGG + Intronic
912430553 1:109626364-109626386 GGAGCGTGATGTGCTGGAACGGG + Exonic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
914894641 1:151658257-151658279 GGAGGCAGCTGTGTTCTAAGCGG + Exonic
915331453 1:155115225-155115247 TGGGGCTGCTGTGCTGGGACTGG + Intergenic
915826111 1:159078720-159078742 GGAGGCAACTGTGCTGAAAAAGG + Intronic
917978647 1:180255980-180256002 GCTGGCTGCTGTGCTGTGCCTGG - Intronic
919976945 1:202619042-202619064 GGAGGCTGCTGGGCTGTGGAAGG - Intronic
921350507 1:214229913-214229935 GGAGGCTCCTGTGTTGTGAGAGG - Intergenic
1067781308 10:49209343-49209365 TGTGCCTGCTGTGCTGTCACTGG - Intergenic
1067912338 10:50358643-50358665 GGAGGCTGGAGTGCAGTGACAGG - Intronic
1068083346 10:52346758-52346780 GGGGGCTGCTGTGATGTGGCTGG + Intergenic
1069772932 10:70910913-70910935 TGAGGCTGCTGAGCTGTGCCAGG + Intergenic
1071726305 10:88201464-88201486 TGAGGCTGTTGTGCTGTGAGAGG + Intergenic
1073352407 10:102829302-102829324 GGAGGCTGTTGTGCTGGTCCAGG - Intergenic
1075980785 10:126737348-126737370 GGATGCTGCTGCCCTTTAACGGG - Intergenic
1076981698 11:208265-208287 GGCGACTGCTGGGCTGCAACGGG - Intronic
1077143391 11:1034638-1034660 GGAGGCTGCAGAGCTGTGACCGG + Intronic
1077542899 11:3155854-3155876 AGGGGTTGCTGTGCTGGAACCGG + Intronic
1078653370 11:13216307-13216329 GGAGGCTGCTGAGCTTGAAGGGG - Intergenic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1080720512 11:34843709-34843731 GGAGGCTGCATTGCTGGCACTGG - Intergenic
1083434070 11:62630750-62630772 CGAGGCTGATGTGCTGGAAGTGG - Exonic
1084093417 11:66894278-66894300 GGAGGCAGCTGGGCTGCAGCTGG - Intronic
1091320689 11:134647232-134647254 GGAGGCTCCTGTGCTGGGAGGGG - Intergenic
1091622221 12:2097807-2097829 GGTGGCTGCTGGGCTGCACCTGG + Intronic
1094278812 12:28711106-28711128 GGAGGCAGAGGTGCTGAAACTGG + Intergenic
1101563146 12:105879396-105879418 GGAGCCTGCTGAGCTGTTCCAGG + Intergenic
1105344418 13:19560348-19560370 GGGGGCTGCCCTGCTGCAACTGG - Intergenic
1108187421 13:47901982-47902004 GGAGGCTGGTTTGTAGTAACAGG - Intergenic
1108322539 13:49302368-49302390 GGAGGCTCCTGTGCTGGGCCTGG + Intergenic
1112153118 13:96786080-96786102 TGTGGCTGCAGTGCTGTAAGGGG - Intronic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1113775846 13:112944172-112944194 GGAGGCTCCTGGGCTGTGAGGGG + Intronic
1118212445 14:63778107-63778129 GGAGGCTGGTGGGCGGTGACTGG + Intergenic
1119076234 14:71642280-71642302 GGAGGCTTCTGGCCTTTAACTGG - Intronic
1120542689 14:85769791-85769813 GGCTGCTGCTGTGCTATTACAGG + Intergenic
1120758361 14:88265033-88265055 GGAGGCTGCTGGGCTGGTCCAGG - Intronic
1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG + Intronic
1122600039 14:102916706-102916728 TGAGGTTGCTGTGCTCTGACTGG - Intergenic
1122728113 14:103773667-103773689 TGAAGATTCTGTGCTGTAACTGG - Intronic
1122890949 14:104731990-104732012 GGAGGCTGCTGCCCTCTCACAGG - Intronic
1123008462 14:105335665-105335687 GGAGGCTGCTGTGGAGTGAGAGG - Intronic
1123031936 14:105456066-105456088 GGAGGCCGCTGTGCTGGGTCTGG + Intronic
1124492605 15:30167426-30167448 GGAGGCTGCTGGGCTGTGGAAGG - Intergenic
1124750929 15:32370899-32370921 GGAGGCTGCTGGGCTGTGGAAGG + Intergenic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1128080378 15:64853701-64853723 GGAGTGTGCTGTGCTGGAAAGGG + Intronic
1129793896 15:78361512-78361534 TGAAGCTGCAGTGCTGTAATTGG - Intergenic
1132711906 16:1272602-1272624 GGAGGCTGCTGGGCTGTGACGGG - Intergenic
1135559544 16:23465380-23465402 GCAGGCTGCTGTCCTGAAAGTGG - Exonic
1142213229 16:88818198-88818220 TGAGGCTGCAGAGCTCTAACGGG + Intronic
1142319501 16:89371922-89371944 GCAGCCTCCTGTTCTGTAACAGG - Intronic
1142359790 16:89620614-89620636 GGAGGTGGCTGTTCTGTAGCTGG + Exonic
1143217083 17:5233218-5233240 GGAGGCTGATGGGCTGAAGCGGG - Intronic
1147202834 17:38814954-38814976 GCAGGCTGCTCTTCTGAAACAGG - Exonic
1147320020 17:39640471-39640493 GGAGGATCCTGTGCTGAAACCGG + Intronic
1147673729 17:42191210-42191232 GGAGGCTGCTTTGCTTTCACAGG - Exonic
1148286727 17:46400081-46400103 GGAGGCTGCTGCCCTCTCACAGG + Intergenic
1148308893 17:46617671-46617693 GGAGGCTGCTGCCCTCTCACAGG + Intronic
1151395700 17:73821281-73821303 GGACGCTGCTGCGGTGTAAATGG - Intergenic
1153368142 18:4282777-4282799 GCATGCTGCTGTGTCGTAACTGG - Intronic
1153478722 18:5525201-5525223 GGTGGCTGCTGGGCTGTCAGGGG - Intronic
1155336170 18:24767453-24767475 GGAGGCTGTTGAGTTGTGACTGG + Intergenic
1156521159 18:37723360-37723382 GGAGGCTGGAGTGATGAAACTGG + Intergenic
1157563560 18:48664622-48664644 GGAGGCTGCTCTGCTGCACAGGG + Intronic
1157682710 18:49619449-49619471 GGAGGCAGCTGAGCTGGAAAGGG + Intergenic
1159140744 18:64390982-64391004 GGAGACTGCTGTCCTGAAATTGG + Intergenic
1159799397 18:72878886-72878908 GGAGGCTGCTATTCTCTAGCAGG - Intergenic
1160668803 19:346245-346267 GTGAGGTGCTGTGCTGTAACAGG + Intergenic
1160828408 19:1091357-1091379 CCAGGCTGCTGTGCTGTGACGGG - Intronic
1161853764 19:6752680-6752702 GGAGGCTGCTCTGGGGTAGCCGG - Exonic
1162668894 19:12237992-12238014 GGAAGCTACTGGGCTGGAACAGG + Intronic
1165775267 19:38400662-38400684 GGAGGCTGCTGTGATGGTTCAGG + Intergenic
1165899630 19:39163052-39163074 GGAGCCTGCTGTGCCGGGACGGG + Intronic
926778967 2:16449535-16449557 GGAGGCTGCTTGGCTGAAGCTGG - Intergenic
927595459 2:24392992-24393014 GGAGGCTGCTGTGTTGGTAGTGG + Intergenic
927822341 2:26278862-26278884 GGACTCTGCTATGCTGTAATAGG + Intronic
929434912 2:41921166-41921188 GTGGGCTGTTGTGCTGTCACAGG - Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
929922086 2:46179882-46179904 AGGGGCTGCTGTGCTGTCAGGGG - Intronic
930221261 2:48748952-48748974 TGAGGATGCTGTGGTGTGACAGG - Intronic
930447351 2:51490662-51490684 GGAGGTTGCTGTTATTTAACTGG - Intergenic
934047727 2:88186227-88186249 GGAGGCTGCTCAGCTGGATCTGG + Exonic
935808467 2:106772095-106772117 GAAGGCTGCACTGCTGTCACTGG + Intergenic
937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG + Intergenic
938169701 2:129064312-129064334 GGAGGCTGCTGTGATGACTCAGG - Intergenic
940007279 2:149019526-149019548 GGAGCCTACTGTGCTGTAGATGG - Intronic
940612108 2:156005831-156005853 GGAAGCTGCTGTGATGCACCTGG - Intergenic
941693549 2:168527104-168527126 GGAGGCTGCTTGGCTGGAAGAGG + Intronic
941909331 2:170747917-170747939 GCAGTCTGCTGTGCTGATACAGG + Intergenic
944615395 2:201453798-201453820 GGAGTTTGCTGTGCTGCAAAAGG - Intronic
947710448 2:232310834-232310856 GGAGGCAGCTGTGCTGCCCCAGG - Intronic
948359923 2:237412866-237412888 GGAGTCTGCTGTGCTGGATGGGG - Intronic
948598623 2:239096048-239096070 GGAGGCTACTGTTCTGGAGCAGG - Intronic
1170461434 20:16580436-16580458 GGGGCCTGCTTTGCTGTGACTGG - Intergenic
1170479982 20:16755811-16755833 GGAGCCTTCTGAGCTGCAACTGG + Intronic
1170789713 20:19497636-19497658 AGAGGCTGCTGTGGTGTAGAAGG + Intronic
1170942400 20:20859354-20859376 GGAGGCTGCTGTGAGGGCACAGG + Intergenic
1172244173 20:33434242-33434264 GGAGGATGCTGGGCTGTGGCTGG - Intronic
1175015196 20:55782499-55782521 GGAGGCTTCTCTGCTTTAAAGGG + Intergenic
1175292988 20:57890698-57890720 TGAGGGTGGTGTGCTGAAACTGG + Intergenic
1176045094 20:63088431-63088453 GGCTGCAGCTGTGGTGTAACAGG + Intergenic
1177893655 21:26836602-26836624 GGAGGCTGCTGAGGGGTAGCAGG - Exonic
1178139820 21:29669998-29670020 AGAGGCTGCTGTGCTTGAAACGG - Intronic
1179543393 21:42099098-42099120 GGAGGCTGGAGTGCTGTACAGGG + Exonic
1179681683 21:43026150-43026172 GGAGGGTGCTGAGCAGTGACGGG - Intronic
1180185033 21:46135273-46135295 GGATGCTGGTGTGGTGTAATTGG - Intergenic
1180740597 22:18050764-18050786 GGAGGCTTCTGTGCTAAAGCAGG + Intergenic
1180745982 22:18089297-18089319 AGAGGCTGCTGAGCTGAAAATGG + Exonic
1181029982 22:20145010-20145032 GGGAGCAGCTGTGCTGTCACAGG - Intronic
1182558127 22:31140136-31140158 GGAGGCTGCAGTCATGTAGCTGG - Exonic
1182986505 22:34723113-34723135 GGAGTCTGCTGAGCTGTATGGGG - Intergenic
1183078871 22:35443689-35443711 GGAGGCTGCAGGGCTGGAAGTGG - Intergenic
1183169447 22:36175516-36175538 GGAGGCTGCTGACCTCCAACAGG + Intergenic
1184110167 22:42389632-42389654 GGAGGGTGCTGGGCTGTGGCTGG + Intronic
1185220699 22:49627828-49627850 GGAGGCTCCTGTCCTGTTTCAGG + Intronic
1185288842 22:50014210-50014232 GGGGGCTGCTGTACTGTGGCAGG + Intergenic
949485767 3:4536138-4536160 GGAGGCTGCAGAGGTGCAACTGG + Intronic
950812665 3:15664374-15664396 GGTGGCTGCTAGGCTGCAACAGG + Intergenic
950833053 3:15894014-15894036 GGGAGCAGCTGTGCTGGAACTGG + Intergenic
951765636 3:26195238-26195260 GGAGGCTGCTGCTCTGCAAGTGG + Intergenic
953083861 3:39647760-39647782 GGACCCAGCTGAGCTGTAACTGG - Intergenic
953405357 3:42657148-42657170 GGAGGCTGCTGTGGTAGAGCCGG + Intronic
958558003 3:95704836-95704858 GGGGGCTGCACTGCTGTAACAGG - Intergenic
959575516 3:107928593-107928615 GCATGCTGCTGTGCTGTATCAGG - Intergenic
960992259 3:123319630-123319652 GGAGGCCCCTGTGCTGAACCAGG - Intronic
961055175 3:123781408-123781430 GGAGGGTGCTGTGCTCTTAGAGG + Intronic
962827498 3:139110699-139110721 GGAGGCTGCTGTGGCTGAACAGG - Intronic
962915768 3:139902135-139902157 GGAGGCTGCTGGGGTGATACAGG - Intergenic
966967648 3:185011156-185011178 ATAGGCTGCTCTGCTGTTACTGG - Intronic
968890735 4:3367185-3367207 GGAGGCAGCTGTGGTGCAGCGGG - Intronic
969879211 4:10159090-10159112 GGAGGCCTCTGTGCTGGAGCAGG - Intergenic
971172214 4:24245120-24245142 GCAGCCTGTTGTGCTGTCACTGG - Intergenic
974369197 4:60992254-60992276 GGAGGCTGGTGTGATGTGTCTGG + Intergenic
985491571 5:182750-182772 GGAGGCTGCTGGGCTCTTCCTGG - Exonic
988851784 5:35187788-35187810 GGAGGCTCCTGTGCTCCAGCAGG - Intronic
988852051 5:35189962-35189984 GGAGGCTCCTGTGCTCCAGCAGG - Intronic
989070580 5:37506822-37506844 GGGGGCTGCTGTTCAGGAACAGG + Intronic
992106626 5:73453410-73453432 AGAGGCTGCTGACCTGGAACAGG - Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
995991062 5:118240219-118240241 AGAGGATGCTGTCCTCTAACAGG - Intergenic
997598408 5:135122559-135122581 GAAGGCGGTTGTGCTGTCACAGG + Intronic
998847799 5:146327666-146327688 GGAGGCTGCAGTGTTGTGGCTGG + Intronic
1001276232 5:170353723-170353745 AGAGGCAGCTGTGCTGTTCCCGG + Intronic
1005762559 6:28980773-28980795 GGTGGCTGCTGCGCTGTGAAAGG - Intergenic
1006727685 6:36211502-36211524 GGATGCAGCTGTGCTGGAGCAGG + Exonic
1007236126 6:40392401-40392423 GGAGGCTGCGGGGCTGGGACGGG - Exonic
1007633269 6:43284239-43284261 GCGGGCTGCTGGGCTGCAACAGG - Exonic
1010249895 6:73696372-73696394 GGCGGCTGCTGTGCAGCAGCGGG + Intronic
1013534872 6:111054855-111054877 GGAGTCTGTTCAGCTGTAACAGG - Intergenic
1014049106 6:116930983-116931005 GGAGGCTGCTGTGTTGGTCCAGG + Intronic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1018663525 6:166112571-166112593 CGAGGATGCTGTTCTGTCACTGG + Intergenic
1019277490 7:183378-183400 GGAAGCTGCTGTGCTGTCGCTGG - Intergenic
1020149724 7:5672730-5672752 GGAGGCTGCTGTGGTCTTCCTGG + Intronic
1021692016 7:23239920-23239942 GGAGCCTGTAGTGCTGTAAGAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1025031225 7:55558628-55558650 AGAGGCTACTGTGCTGTGTCAGG + Intronic
1026256725 7:68718651-68718673 GGAGGCTGCTGCCCTGCACCTGG + Intergenic
1028209361 7:88054439-88054461 GGAGGGAGCTGTGGTGGAACAGG - Intronic
1029259689 7:99293442-99293464 GGAGGCTGCTGGGCACTACCTGG + Intergenic
1032223160 7:130009350-130009372 GGAGGCCGCTGGGCTGAAAGAGG + Intergenic
1035238446 7:157515185-157515207 GGAGCCTGCTGAGGGGTAACAGG + Intergenic
1036664455 8:10729942-10729964 GGAGGCTCCTCTGCTGGGACAGG - Intronic
1038779806 8:30560420-30560442 GGTGGCTGCTGGGCTATGACTGG - Intronic
1042137195 8:65643933-65643955 GGAGGTCGCTGGGCTGTCACTGG - Intergenic
1042253072 8:66775414-66775436 GGAGGCAGGTGTGGTGTGACGGG + Intronic
1043202630 8:77390015-77390037 CCAGGCTGCTGTGCTGTGGCGGG + Intergenic
1044727573 8:95205708-95205730 AGAGGCTGCTGTGATGCAGCAGG + Intergenic
1046530625 8:115440533-115440555 AGAGGCTGCTGTCCTTTCACTGG - Intronic
1048371017 8:133776283-133776305 GGAGGCTGCTGGGCAGGAGCTGG - Intergenic
1049454698 8:142680989-142681011 GGAAGCTGCAGTGCTGGGACTGG - Intronic
1052050507 9:23842422-23842444 GGAGGCTGGTTTTCTGCAACAGG - Intergenic
1053291913 9:36885918-36885940 GGAGGCCACTGTGCTCTAGCAGG - Intronic
1053819663 9:41953379-41953401 GGAGTCTGCTGAGCAGAAACGGG + Exonic
1054109930 9:61097032-61097054 GGAGTCTGCTGAGCAGAAACGGG + Intergenic
1054610927 9:67234093-67234115 GGAGTCTGCTGAGCAGAAACGGG - Intergenic
1055037393 9:71832504-71832526 GGGGGTTGCTTTGTTGTAACTGG - Intergenic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1056299771 9:85229063-85229085 GGAGTCTCCTGTGTTGTAATTGG + Intergenic
1056732080 9:89174941-89174963 GGAGGCTGCTGGTCTTTAGCAGG - Intronic
1056899092 9:90582344-90582366 GGAGGCTCCTGGGCTGGAGCAGG + Intergenic
1056981203 9:91313788-91313810 GGAGGCCTCTGTGCAGTATCTGG + Intronic
1057313120 9:93953977-93953999 GGAGGCTCCTACGCTGTAGCCGG - Intronic
1057758772 9:97856145-97856167 GGAGGCTGCTGAGGTGTAGCAGG - Exonic
1058458511 9:105160641-105160663 GATGGCTGCTGTCCTGGAACAGG - Intergenic
1060827621 9:126695770-126695792 GGAGGCTGCTGGGGTGTAGCTGG + Intronic
1061382971 9:130269538-130269560 GGGGGTGGCTGTGCTGAAACGGG - Intergenic
1061569847 9:131470473-131470495 GGAGGCTGCTGTTCGGTTCCAGG + Intronic
1061724039 9:132571691-132571713 GGAGGATGTTGTGCTGTTAATGG + Intronic
1061987825 9:134140366-134140388 GGGGCCTCCTGTGCTGTAGCAGG + Intronic
1062246751 9:135572539-135572561 GGATGGTGCTGTGCAGTTACAGG + Intergenic
1185449594 X:275353-275375 GGCGGCTGCTGTCCTGGCACAGG - Intergenic
1189669459 X:43392554-43392576 GGAGGCTGAAGTTTTGTAACTGG - Intergenic
1197654864 X:129106075-129106097 GGAGGCTGCTGTAATGGTACAGG - Intergenic
1201486156 Y:14496539-14496561 GGAGGGTGCTGTCCTGGGACAGG + Intergenic