ID: 1113767161

View in Genome Browser
Species Human (GRCh38)
Location 13:112888734-112888756
Sequence TGGGAGCCCCAGCATCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113767161_1113767174 30 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767174 13:112888787-112888809 CTCAGTGGCGGGTCCTGAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 170
1113767161_1113767162 -8 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767162 13:112888749-112888771 GGCTCCCAGAGCCGCCCACGTGG 0: 1
1: 0
2: 0
3: 22
4: 184
1113767161_1113767170 15 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767170 13:112888772-112888794 CCTGTGGCGCACTTGCTCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1113767161_1113767165 -1 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767165 13:112888756-112888778 AGAGCCGCCCACGTGGCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1113767161_1113767173 27 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767173 13:112888784-112888806 TTGCTCAGTGGCGGGTCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 145
1113767161_1113767171 18 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767171 13:112888775-112888797 GTGGCGCACTTGCTCAGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 64
1113767161_1113767172 19 Left 1113767161 13:112888734-112888756 CCGCGCTGATGCTGGGGCTCCCA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1113767172 13:112888776-112888798 TGGCGCACTTGCTCAGTGGCGGG 0: 1
1: 0
2: 2
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113767161 Original CRISPR TGGGAGCCCCAGCATCAGCG CGG (reversed) Intergenic
900481898 1:2903432-2903454 TGGGAGACCCTGCAACAGCCTGG - Intergenic
901670929 1:10856128-10856150 TGGGACCCCCAGCCTGGGCGAGG + Intergenic
902181271 1:14690333-14690355 TGGGAGCCCCAGATTTAGGGAGG + Intronic
902639091 1:17755284-17755306 GGGGAGCCCCAGCAGCGGGGAGG + Intergenic
903323987 1:22559232-22559254 AGGGAACCCCAGCAGCAGCCCGG + Intergenic
903901025 1:26645448-26645470 TGAGACCCCCAGCTTCAGGGTGG + Intergenic
904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG + Intergenic
905241722 1:36585903-36585925 AGGGAGCCGGAGCCTCAGCGCGG + Intergenic
907178781 1:52552638-52552660 CGGGAGCCCCAGCCACAGTGTGG + Intronic
907820873 1:57967159-57967181 TGGGAGCCACAGCTACAGTGGGG + Intronic
911289753 1:96043037-96043059 TGGGAGCCCTATTATCAGAGTGG - Intergenic
912562515 1:110560835-110560857 TGGGAGCAGCAGCCTCTGCGGGG - Intergenic
916119366 1:161513818-161513840 TTGCAGCCTCAGCATCAGCGTGG + Intronic
916129128 1:161595476-161595498 TTGCAGCCTCAGCATCAGCGTGG + Intronic
916502852 1:165401383-165401405 TGGGAGGCGCAGCAGCAGCTTGG + Exonic
919748275 1:201021935-201021957 TGTCAGCCCCAGCAGCAGCCTGG + Intronic
921029928 1:211327634-211327656 TGGGACCCGCAGCAAGAGCGTGG - Intronic
921414633 1:214871590-214871612 TGGCAGCCTCAGCATCAAGGTGG - Intergenic
923406261 1:233664220-233664242 TGGGAGCTACAACTTCAGCGAGG - Intronic
923561863 1:235047682-235047704 TGGGAGCCCCGGCAGGAGAGAGG + Intergenic
924184809 1:241476844-241476866 TGGGAGCACAGGCATCAGAGAGG - Intergenic
1062901366 10:1149155-1149177 AGGGAGTGCCAGCATCAGAGGGG - Intergenic
1063160929 10:3418032-3418054 TGGGAGCCCATGCATCAGAAGGG + Intergenic
1066625674 10:37402977-37402999 TGGGATCCCCTGCAACAGAGGGG + Intergenic
1070159646 10:73858492-73858514 TGGGAGCTCCAGCATCCGGTGGG - Intronic
1070298851 10:75188234-75188256 TGGGAGCCTCAGCCTCACCTGGG - Intergenic
1073111711 10:101066621-101066643 TGTGAGTCCCAGCATCAGCCAGG + Intronic
1073509703 10:104035287-104035309 TGTGTGGTCCAGCATCAGCGTGG - Exonic
1075731078 10:124637216-124637238 TGTGAGGCCCAGCACCAGCAAGG - Intronic
1075930524 10:126291615-126291637 TGAGAGCCTCAGCATCAGGAGGG + Intronic
1076231484 10:128823261-128823283 TGTGACCCACAGCATCCGCGAGG - Intergenic
1076355321 10:129848347-129848369 TGGCGGCCCCACCATGAGCGGGG + Intronic
1076542375 10:131222520-131222542 TGGGAGTCCCAGCACCAGGCTGG - Intronic
1077487669 11:2846523-2846545 TGGGGGCCCTAGCATGAGTGAGG - Intronic
1077758241 11:5059568-5059590 TGGGATCCCCAGCAACAGGAAGG + Exonic
1077760621 11:5092713-5092735 TGGGATCCCCAGCAACAGGAAGG - Intergenic
1078090715 11:8263021-8263043 AGGGAGCCCCAGCCTCCGCGCGG + Intronic
1079459746 11:20669436-20669458 TGGGAGCCCGGGCAGGAGCGCGG - Intergenic
1080044001 11:27789374-27789396 AGGGAGACCCAGCATGAGCTTGG - Intergenic
1081780312 11:45706094-45706116 TGCCAGCCCCATCACCAGCGTGG - Intergenic
1083159810 11:60848066-60848088 TCTGAGCCCCAGCCTCAGCCTGG - Intronic
1083288368 11:61675565-61675587 TGGAAGACCCAGCATCGGAGGGG + Intergenic
1083541682 11:63515878-63515900 TGGGATCCCTGGCATCAGAGTGG - Intronic
1083747699 11:64744812-64744834 CGGGAGCCGCAGCCGCAGCGAGG - Intronic
1084509957 11:69597252-69597274 TGGGAACCCCAGGAGCACCGGGG + Intergenic
1085529110 11:77181283-77181305 GGGGAGCCCCTGCAGCAGCCAGG - Intronic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1088741937 11:112774389-112774411 TGGGACCTCCAGCATCAGGTTGG - Intergenic
1094326919 12:29250829-29250851 GGGGAGCCCCAGCATCCTAGAGG + Intronic
1098471942 12:70855356-70855378 TGGCAGCTCCAGCCTCAGCTAGG + Intronic
1101177328 12:102167704-102167726 TGTGAGACTCAGCATCAACGTGG - Intronic
1102051010 12:109861975-109861997 TGGCAGCCCCAGCCCTAGCGGGG - Intronic
1103447111 12:121001619-121001641 TGAGAGGCCCTGGATCAGCGTGG + Exonic
1104530502 12:129565700-129565722 TGGGAGCTGCAGTAGCAGCGAGG - Intronic
1104543849 12:129693547-129693569 TGACAGACCCAGCCTCAGCGCGG + Intronic
1105239900 13:18599480-18599502 TGCCAGCTCCAGCAGCAGCGCGG - Intergenic
1108678700 13:52760962-52760984 TGGGAGGCCCAGCATGGGCCAGG + Intergenic
1112199578 13:97261866-97261888 ATGGAGGCCCAGCCTCAGCGAGG - Intronic
1112601536 13:100860225-100860247 TGGGACACCCAGCAACAGGGTGG - Intergenic
1113549941 13:111184959-111184981 TGGGAGCTCCACCACCAGCCTGG - Intronic
1113767161 13:112888734-112888756 TGGGAGCCCCAGCATCAGCGCGG - Intergenic
1114146109 14:19980015-19980037 CGAGGGCCCCAGCATCAGCTGGG + Intergenic
1114853416 14:26408268-26408290 TGGGTGGCCCAGCAACAGCCAGG + Intergenic
1119400258 14:74358148-74358170 GGGGAGTCCCAGCAGCAGAGAGG - Exonic
1119427026 14:74542321-74542343 TGGGAGTCCCAGCAGCCGAGGGG - Intronic
1121620971 14:95348111-95348133 TGGGAGCCCCAAAACCAGCTTGG - Intergenic
1123491338 15:20784582-20784604 TGCCAGCTCCAGCAGCAGCGCGG + Intergenic
1123547840 15:21353673-21353695 TGCCAGCTCCAGCAGCAGCGCGG + Intergenic
1127927623 15:63562090-63562112 GGGGAGCCCCAGCACCATGGGGG - Intronic
1128456547 15:67834650-67834672 TGGGAGCCCCAGAACCCGCGGGG - Intergenic
1130577686 15:85106838-85106860 GGGGAGCCACAGAATCAGAGTGG + Intronic
1131075768 15:89494047-89494069 GGAGAGCCCCAGCATCAAGGAGG - Intronic
1202956170 15_KI270727v1_random:80903-80925 TGCCAGCTCCAGCAGCAGCGCGG + Intergenic
1134019095 16:10909057-10909079 TGGGAGTCCCTGCAGCAGCATGG + Exonic
1134630089 16:15750105-15750127 TGGGAGCCCCAGGGTCTGGGCGG + Intronic
1137921920 16:52498478-52498500 TGGGAGCCCCCGCATGATCCTGG + Intronic
1138030573 16:53556449-53556471 TGTGAGCACCAGCCTCAGTGAGG - Intergenic
1141155214 16:81592585-81592607 TGGGAGCCCCAGGATGAGCAGGG - Intronic
1142175389 16:88642826-88642848 GGGGCCCCCCAGCATCAGTGTGG + Intergenic
1143118983 17:4595724-4595746 TGGGAGCCCCAGCATGGGGTTGG + Intronic
1145052991 17:19678713-19678735 CGTGAGCCCCACCATCAGTGTGG + Exonic
1146477226 17:33172745-33172767 TGGTAGCCTCAGCATCACCTGGG + Intronic
1146950119 17:36899909-36899931 TGGCAGCCCCAGCATCTGGAGGG - Intergenic
1148126379 17:45239379-45239401 TGGGAGCACCAGCCTCAGACAGG + Intronic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1151742256 17:75991602-75991624 GGGGAGCTCCAGCATCAGCAGGG + Exonic
1152032805 17:77854441-77854463 AGGGAACCCCAGCTTCAGCCAGG + Intergenic
1153280266 18:3408298-3408320 TGAGAGCACCAGCATCACCCAGG + Intergenic
1154206882 18:12345110-12345132 AGGGTGCGCCAGCATCAGCCTGG - Intronic
1154254232 18:12768684-12768706 GGGGAGCCCCAGCATCCCTGGGG + Intergenic
1154448933 18:14459294-14459316 TGCCAGCTCCAGCAGCAGCGCGG + Intergenic
1156160386 18:34351308-34351330 TGGGAGGACCAGCTTCAGAGAGG + Intergenic
1156468136 18:37361044-37361066 TGGGGGCCCCAACATGAGTGGGG - Intronic
1160131383 18:76227893-76227915 TGGCAGCTCCAGCTCCAGCGAGG + Intergenic
1160955999 19:1691960-1691982 GGGGAGCCCCAGTGTCAGGGAGG + Intergenic
1162398934 19:10432968-10432990 TGGCAGCTCCAGCATGAGAGGGG - Intronic
1163265295 19:16217211-16217233 TGGGAGGCCCAGCATAGGTGGGG + Intronic
1163520569 19:17789191-17789213 TGGGAGCCCCAGGAGGAGGGTGG + Intergenic
1163559462 19:18010221-18010243 TGGCAGCTCCAGCAGCAGCTTGG - Exonic
1165433327 19:35784409-35784431 AGGGAGGCCCAGCTTCAGTGGGG - Intronic
1165854583 19:38871727-38871749 TGGGAGCCACAGTGTCAGTGGGG + Intronic
1165940438 19:39412586-39412608 TGTGAGCCCCGGCGACAGCGGGG + Exonic
1166120842 19:40685278-40685300 TGGGAGCACCAACAGCAGAGGGG + Intronic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166737256 19:45093388-45093410 TGGGAGACCCGGCCTCAGCTGGG - Exonic
927513520 2:23658917-23658939 CGGAGGCCCCAGCCTCAGCGTGG + Intronic
927517867 2:23682550-23682572 TGGGAGCTCCAGCTTCATCCTGG - Intronic
927899562 2:26809458-26809480 GGGGAGGCCCAGCATCACTGGGG + Intergenic
929795520 2:45055726-45055748 TGGGAGCCCTGGCAACAGAGAGG - Intergenic
934770819 2:96906786-96906808 TGGGAGCCCCAGCAGCAGCTGGG + Intronic
935250713 2:101257833-101257855 TGGGGGTGCCAGCATCAGCTGGG - Exonic
937322651 2:120970262-120970284 TGCTAGCCCCACCATCACCGTGG - Intronic
937439259 2:121902921-121902943 CGGGAGCCGCAGCATCGGCAGGG - Intergenic
938789868 2:134666972-134666994 TGGAAGCCACAGCATCACAGAGG - Intronic
939370863 2:141298544-141298566 TGGGAGGCTCAGCATCATAGGGG + Intronic
941883660 2:170506513-170506535 TGGGAGCCCCAGCATAAAGTAGG - Intronic
944447352 2:199805021-199805043 CAGAAGCCCCAGCATCAGCTGGG - Intronic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
946073654 2:217055544-217055566 TGGAAACCCCAACATCAGCTGGG + Intergenic
946899017 2:224354783-224354805 TGGGAGGCCCTACATCAGGGCGG - Intergenic
946960770 2:224983597-224983619 TGGCCGCCCCAGCCTCAGTGAGG + Intronic
947815201 2:233032127-233032149 GGGGAGCCCACGCAGCAGCGGGG + Intergenic
948335944 2:237207169-237207191 TGGGAGCCACATCGTCAGCACGG + Intergenic
948749619 2:240124222-240124244 AGGGGGCCTGAGCATCAGCGAGG - Intergenic
948873762 2:240816984-240817006 TGGGATCCCCACCCTCAGCCTGG - Intronic
1169228555 20:3871510-3871532 TGGAAGCCCCTGCCTCAGTGGGG - Exonic
1169737048 20:8848596-8848618 TGGGTACCCCAGCATTAGGGAGG + Intronic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1170791344 20:19511966-19511988 TGGGAGCTCCAGGGTCAGGGTGG - Intronic
1173450085 20:43156280-43156302 TAGGAGCTACAGCATCAGAGGGG + Intronic
1174341813 20:49901834-49901856 TGGGAGCCCACACAGCAGCGTGG + Intergenic
1176447285 21:6831233-6831255 TGCCAGCTCCAGCAGCAGCGCGG - Intergenic
1176825453 21:13696259-13696281 TGCCAGCTCCAGCAGCAGCGCGG - Intergenic
1178996472 21:37405226-37405248 TGGGACCCACAGCATCTGCCTGG - Intronic
1182858027 22:33535223-33535245 TTGGACCCACAGCATCAGCGTGG - Intronic
1182872656 22:33662349-33662371 CAGGAGCCCCAGCATCAGTGAGG + Intronic
1184707581 22:46225003-46225025 TGGGAGGCCTAGAATCAGCCAGG + Intronic
1184799953 22:46753097-46753119 TGGGAGCCTCTGCTTCAGTGAGG + Intergenic
1184892526 22:47388730-47388752 TGGGAGCAGCAGCATCTGGGAGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
951624473 3:24644893-24644915 TGGGAGCCCAACCCTCAGCAGGG + Intergenic
952689247 3:36184987-36185009 TAGGAGCCCCAGAAACAGAGAGG - Intergenic
953885339 3:46711861-46711883 TGGCAGCCCCAGCTTCAGCCTGG + Intergenic
954302160 3:49705790-49705812 TGGGAGCACATGCCTCAGCGAGG + Intronic
954392198 3:50273699-50273721 CGGGAGCCCCCGCCGCAGCGGGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
959840560 3:110969557-110969579 TTGGAGTCTCAGCATCGGCGGGG - Intergenic
962927049 3:140004544-140004566 AGAGGGCCCCAGCATCAGAGAGG - Intronic
964717453 3:159737251-159737273 TGGGAGCCACTGCATCAGAGGGG - Intronic
966750119 3:183313876-183313898 TGGGAGCCCCACCACCACCTTGG + Intronic
966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG + Intergenic
971209531 4:24602455-24602477 TGGGAGCCCCAGGAATAGGGTGG - Intergenic
975186394 4:71409057-71409079 TGGGAGGCCCAGAATCATGGAGG - Intronic
975393943 4:73853482-73853504 TGGGAGGGCCAGCAGCGGCGAGG + Intronic
981582237 4:146261311-146261333 TGAGGGCCACAGCACCAGCGGGG + Intronic
981629161 4:146798252-146798274 CAGGAGCCCCAGGAACAGCGGGG + Intronic
982781947 4:159500355-159500377 AGGGAGCCCCAGCAGCTGAGTGG - Intergenic
985147261 4:186906061-186906083 TGAGAGTCCCAGCCCCAGCGAGG - Intergenic
985520931 5:373685-373707 TGGGACCCCCAGGCTCAGGGAGG + Intronic
985651169 5:1108454-1108476 CGGGAGCCCCTGCAGCAGCTGGG - Intronic
985666688 5:1184723-1184745 TGGGGGCCCAAGCATCCGCTAGG - Intergenic
998269170 5:140691346-140691368 TGGTTGCCCCAGCCTCAGCAAGG + Exonic
999806502 5:155086312-155086334 TGGCAGCACCAGCATCACCTGGG - Intergenic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1004193919 6:13487479-13487501 TGGGATCCCGAGCTGCAGCGCGG + Exonic
1007633969 6:43287137-43287159 TGGGAGCTTCTGCATCAGCGTGG - Exonic
1007707126 6:43797924-43797946 CGGGAGCCCCAGTCTGAGCGAGG + Intergenic
1007707148 6:43798001-43798023 CGGGAGCCCCAGTCTGAGCGAGG + Intergenic
1008301940 6:49851625-49851647 TGGCAGCATCAGCATCAGCTGGG + Intronic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1017489649 6:154933733-154933755 TGGGAGCCCCAGTCACAGAGTGG + Intronic
1017747047 6:157456347-157456369 TGGCAGCCCCAGGATGAACGAGG - Intronic
1017916569 6:158836151-158836173 TGGGAGGCTCAGCAGCAGGGGGG + Intergenic
1018787709 6:167121236-167121258 TGGGTCCCTCAGCATCTGCGTGG + Intergenic
1019377217 7:699196-699218 TGGGTTCCCCACCATCAGCCAGG - Intronic
1019409606 7:900785-900807 TAGCAGCCCCGGCCTCAGCGTGG - Intronic
1019934025 7:4242649-4242671 AGGGTGCCCCAGCATCGGGGTGG + Intronic
1032250956 7:130256792-130256814 TGGGAGCCCCAGCCCCAGCCAGG - Intergenic
1032316071 7:130840310-130840332 TGGCAGCCTCAGCATCTGCTTGG + Intergenic
1032441265 7:131944771-131944793 TGGGAGTCCCAGCAGGGGCGAGG + Intergenic
1034274704 7:149818975-149818997 TGGGCTCCCCAGCATCTGCTGGG - Intergenic
1035857998 8:2997357-2997379 TGGGAGCCCTAGGATAAGAGAGG + Intronic
1036131795 8:6121619-6121641 TGGGAACCCCAGCAGCACTGTGG + Intergenic
1036657043 8:10683434-10683456 TGGAGCCCCCAGCATCAGAGGGG + Intronic
1036690254 8:10940633-10940655 TGGGAGCCCCAGGAGGAGGGTGG - Intronic
1039292524 8:36111790-36111812 GGGGAGCCCCAGCATCCTTGAGG - Intergenic
1040278173 8:46024468-46024490 TGGCAGCCTCTGCATCAGCCCGG - Intergenic
1043660764 8:82737106-82737128 TGGGAGGCCCACAATCAGAGTGG - Intergenic
1047432729 8:124806799-124806821 TCGGAGTTCCAGCATCAGTGTGG + Intergenic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047995909 8:130335688-130335710 TGGGAGACACAGCCTCAGCAGGG - Intronic
1049011407 8:139890060-139890082 TTTGAGCGCCAGCAGCAGCGAGG + Intronic
1049729016 8:144166463-144166485 AGGGAGCCACAGCCTCAGCTGGG - Intronic
1049901433 9:170253-170275 TGGCAGCCTCAGCCTCAGCTGGG - Intronic
1053426496 9:38013727-38013749 TGGGAGCCCCAGTCTCATGGAGG - Intronic
1053744468 9:41180560-41180582 TGGCAGCCTCAGCCTCAGCTGGG - Intronic
1054349736 9:64010460-64010482 TGGCAGCCTCAGCCTCAGCTGGG - Intergenic
1054482802 9:65684649-65684671 TGGCAGCCTCAGCCTCAGCTGGG + Intronic
1054683876 9:68250690-68250712 TGGCAGCCTCAGCCTCAGCTGGG + Intronic
1057975887 9:99605817-99605839 TGGGAGCCCCATCATTGGTGTGG - Intergenic
1059424328 9:114211206-114211228 TGGAAGCCCCAGCCCCAGCCAGG - Intronic
1060794420 9:126504507-126504529 TGGAAGCCTCTGCCTCAGCGGGG + Exonic
1061262396 9:129487539-129487561 TGGGTGCCCGGGCATCAGGGGGG - Intergenic
1061466260 9:130782565-130782587 TGGGAGCCAAAGCTTCAGAGGGG - Intronic
1061693739 9:132355556-132355578 CGGGAGCCACCGCACCAGCGAGG - Intergenic
1061905521 9:133694708-133694730 TAGGAGCCCCAGAATGAACGGGG - Intronic
1062473031 9:136714524-136714546 AGGGAGGCCCAGCATGGGCGGGG - Intronic
1203521905 Un_GL000213v1:53298-53320 TGCCAGCTCCAGCAGCAGCGCGG + Intergenic
1190732122 X:53233330-53233352 TGGGTGCCCCTGCCCCAGCGAGG + Exonic
1190979387 X:55442542-55442564 TGGGAGGCCGAGCATTAGTGTGG + Intergenic
1200100124 X:153686030-153686052 TGGGAGCCCCCACATCTGAGGGG - Intronic