ID: 1113768371

View in Genome Browser
Species Human (GRCh38)
Location 13:112894419-112894441
Sequence CCGCGCGCACCTGCCGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113768371_1113768395 22 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768395 13:112894464-112894486 GGGGGTGACGGGAGGGGGCGCGG 0: 1
1: 1
2: 12
3: 201
4: 2831
1113768371_1113768386 3 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768386 13:112894445-112894467 GGGGGCCTGGAGGGGGCGCGGGG 0: 1
1: 1
2: 13
3: 123
4: 1058
1113768371_1113768396 23 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768396 13:112894465-112894487 GGGGTGACGGGAGGGGGCGCGGG 0: 1
1: 0
2: 4
3: 114
4: 1067
1113768371_1113768385 2 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768385 13:112894444-112894466 CGGGGGCCTGGAGGGGGCGCGGG 0: 1
1: 1
2: 5
3: 121
4: 964
1113768371_1113768394 17 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768394 13:112894459-112894481 GGCGCGGGGGTGACGGGAGGGGG 0: 1
1: 0
2: 3
3: 73
4: 793
1113768371_1113768397 24 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768397 13:112894466-112894488 GGGTGACGGGAGGGGGCGCGGGG 0: 1
1: 0
2: 3
3: 71
4: 789
1113768371_1113768381 -6 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768381 13:112894436-112894458 GCGCGGGGCGGGGGCCTGGAGGG 0: 1
1: 0
2: 11
3: 127
4: 906
1113768371_1113768393 16 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768393 13:112894458-112894480 GGGCGCGGGGGTGACGGGAGGGG 0: 1
1: 0
2: 7
3: 73
4: 873
1113768371_1113768387 4 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768387 13:112894446-112894468 GGGGCCTGGAGGGGGCGCGGGGG 0: 1
1: 3
2: 11
3: 162
4: 1529
1113768371_1113768391 14 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768391 13:112894456-112894478 GGGGGCGCGGGGGTGACGGGAGG 0: 1
1: 0
2: 2
3: 162
4: 1223
1113768371_1113768390 11 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768390 13:112894453-112894475 GGAGGGGGCGCGGGGGTGACGGG 0: 1
1: 0
2: 12
3: 62
4: 834
1113768371_1113768382 -5 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768382 13:112894437-112894459 CGCGGGGCGGGGGCCTGGAGGGG 0: 1
1: 0
2: 8
3: 80
4: 792
1113768371_1113768384 1 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768384 13:112894443-112894465 GCGGGGGCCTGGAGGGGGCGCGG 0: 2
1: 2
2: 17
3: 205
4: 1469
1113768371_1113768379 -10 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768379 13:112894432-112894454 GTGCGCGCGGGGCGGGGGCCTGG 0: 1
1: 4
2: 13
3: 150
4: 1099
1113768371_1113768392 15 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768392 13:112894457-112894479 GGGGCGCGGGGGTGACGGGAGGG 0: 1
1: 0
2: 8
3: 87
4: 937
1113768371_1113768398 27 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768398 13:112894469-112894491 TGACGGGAGGGGGCGCGGGGCGG 0: 1
1: 0
2: 4
3: 64
4: 855
1113768371_1113768383 -4 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768383 13:112894438-112894460 GCGGGGCGGGGGCCTGGAGGGGG 0: 1
1: 1
2: 32
3: 273
4: 2050
1113768371_1113768389 10 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768389 13:112894452-112894474 TGGAGGGGGCGCGGGGGTGACGG 0: 1
1: 0
2: 3
3: 94
4: 992
1113768371_1113768380 -7 Left 1113768371 13:112894419-112894441 CCACGGGCGGCAGGTGCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1113768380 13:112894435-112894457 CGCGCGGGGCGGGGGCCTGGAGG 0: 1
1: 2
2: 11
3: 119
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113768371 Original CRISPR CCGCGCGCACCTGCCGCCCG TGG (reversed) Intronic
900171923 1:1273534-1273556 CCGTTCGCGCCCGCCGCCCGCGG - Intronic
901317325 1:8317999-8318021 CCGGGCTCCCCTCCCGCCCGCGG + Intronic
901676572 1:10889013-10889035 CCGCCCGCCCCGGCCGCCCAGGG - Intergenic
902431629 1:16367590-16367612 CCGCGCCCACTTGCTGGCCGTGG + Intronic
904006632 1:27366475-27366497 CCGCGCGCAGCCCCGGCCCGGGG + Exonic
904030108 1:27528271-27528293 CCCAGCGCACCTGGCGCCCCCGG - Intergenic
904782858 1:32964041-32964063 CCGCGCTCACCCGCAGTCCGGGG + Exonic
905803757 1:40861851-40861873 CATCGCGCACCTGCAGCCTGTGG - Exonic
906306776 1:44724656-44724678 CCGCGCGCACCTCCAGCGTGAGG - Exonic
906325596 1:44843417-44843439 CCGCGCCTCCCTCCCGCCCGCGG + Intergenic
915224925 1:154405246-154405268 CCCCGCGCACCGGCCGACCGAGG - Exonic
915238454 1:154502443-154502465 CCGCGCGCCCCTCCCCTCCGCGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1067113962 10:43420587-43420609 CCGGGCGCGCCTGCTGCGCGGGG + Intergenic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1072336651 10:94403468-94403490 CCGCGATCACCTGCCCCCGGCGG + Exonic
1074055986 10:109923308-109923330 CCGCGCGTCCCTGCCCGCCGAGG + Intronic
1076650309 10:131982474-131982496 CCGCTCGCAGCTCCCGCCCCGGG - Intergenic
1076999596 11:315989-316011 CCGCGCACCCCCGACGCCCGTGG - Intergenic
1079361997 11:19777273-19777295 CCGCGCGCAGCAGCGGCCCCGGG + Intronic
1081831458 11:46119869-46119891 CCGCGCGCCCCTCCCCCCGGCGG + Intronic
1083648458 11:64186418-64186440 CCGCTCCCGCCCGCCGCCCGCGG - Intronic
1083758280 11:64802816-64802838 CCGCCCGCACCCCGCGCCCGCGG + Intronic
1084412093 11:69011149-69011171 CCGCGCACTCCTCCCGCCCGGGG + Intronic
1091353586 11:134916618-134916640 CCCCACGCACCTGCTGCCAGTGG + Intergenic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1092743277 12:11649970-11649992 CCGCGCGCTCCAGACCCCCGGGG + Exonic
1093164566 12:15789785-15789807 CCGAGCGCTCCCTCCGCCCGGGG - Intronic
1094653541 12:32399850-32399872 CCCCTCCTACCTGCCGCCCGGGG + Intronic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1097572821 12:61355452-61355474 CCACGCCCACCTGCCTCCCTGGG - Intergenic
1099202099 12:79689991-79690013 CCGGCCGCACCTGCCGTCCCCGG - Exonic
1102323151 12:111956644-111956666 CGGCGCGCACCTGCAGTCCCAGG - Intronic
1102681911 12:114696566-114696588 CCGCGCACGCCTGGCGCCCGCGG - Intergenic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1105353084 13:19633536-19633558 CCCCGCCCACCTGCGTCCCGCGG + Intergenic
1112343967 13:98576143-98576165 CCCCGTGCACCTGCGGACCGGGG - Intronic
1112494757 13:99895998-99896020 CCCCGCGCTCCTCCTGCCCGCGG - Exonic
1112574730 13:100625525-100625547 CCGCGCTTACCAGACGCCCGAGG + Exonic
1112580633 13:100674379-100674401 CCGGGCGCACCCGGCGCCTGCGG - Intronic
1113082753 13:106535271-106535293 CCGCGCCCACCCGCCAGCCGCGG - Intergenic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1113800860 13:113085672-113085694 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800878 13:113085729-113085751 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800896 13:113085786-113085808 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800915 13:113085843-113085865 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1119106807 14:71932552-71932574 CCGCGCACCCTTGCCGACCGGGG + Exonic
1122286309 14:100654834-100654856 CCGCCCGACCCTGCCCCCCGGGG + Intergenic
1122888906 14:104723765-104723787 AGGAGCGCACCTGCCCCCCGTGG - Intergenic
1124426884 15:29570399-29570421 CCGCCGGAACTTGCCGCCCGCGG + Intronic
1128635359 15:69299107-69299129 CCACGCGCACCCGCCCTCCGCGG + Intronic
1131074915 15:89489542-89489564 CCCCGCCCACCTGTCTCCCGGGG + Intronic
1131493678 15:92883418-92883440 CCCCGCCCACCTGCCGCCCGCGG - Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132900451 16:2251385-2251407 CCGCCCGCTCCGTCCGCCCGAGG + Exonic
1133020194 16:2963737-2963759 CCGCACGCCCCTCCCGCCCCTGG - Intergenic
1133168555 16:3965750-3965772 CGGCGCCCACCCGCTGCCCGAGG - Exonic
1136146712 16:28320627-28320649 CCGCGCGCGCAAGCCCCCCGGGG + Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138588057 16:57984604-57984626 CCGCGCGGGCCTGACCCCCGTGG + Intronic
1139544791 16:67645115-67645137 CGGCGCGCACCTTCCGCCGCCGG + Exonic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1144185125 17:12789677-12789699 CCGCGCGCAGCTCCCTCCCGAGG - Exonic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1144953209 17:19004822-19004844 CTGCGGTCACGTGCCGCCCGGGG + Intronic
1146398414 17:32486463-32486485 GCGCCCGCAGCTGCCGGCCGCGG - Intergenic
1147341266 17:39754457-39754479 CCGCGGGCATCTGCAGCGCGCGG - Intergenic
1148233035 17:45949192-45949214 CGCCGCGCACCAGGCGCCCGCGG - Intronic
1148849336 17:50547273-50547295 CCGCCCGTACCTGCGGCTCGCGG - Exonic
1150433480 17:65137277-65137299 GGGCGCCCACCTGCCGCCAGGGG - Intergenic
1151313980 17:73311000-73311022 CCGCGCGCACCCGCCCCAAGCGG + Intronic
1151453566 17:74213528-74213550 CTGCGCTCACCTCCCGGCCGGGG - Exonic
1152406614 17:80101595-80101617 ACGCGCGCCCTGGCCGCCCGCGG - Intergenic
1152781498 17:82229094-82229116 CCGCGCCTACCTGCCGCCGCTGG - Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1158954114 18:62523460-62523482 CCCCGCGGAGCCGCCGCCCGAGG + Exonic
1159369895 18:67516630-67516652 CCGAGAGAACCCGCCGCCCGCGG - Exonic
1160164039 18:76495082-76495104 CCGCGCCCACCGCCCGCCCGCGG + Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160631250 18:80247529-80247551 CCCCGCGCTCCTCCCGCGCGCGG - Exonic
1160717812 19:584358-584380 CCGGGAGCAGCTGCCGCCCGGGG - Intergenic
1160863954 19:1249190-1249212 GCGCGCCCACCCGCCGGCCGCGG - Intronic
1161157429 19:2739931-2739953 CTGCCCGCACCTACCTCCCGGGG + Exonic
1162341880 19:10096212-10096234 GCGCGCGCAGCTGCAGCACGAGG - Exonic
1163442661 19:17329490-17329512 CCGCCTGCAGCTGCCGCTCGAGG + Intronic
1163631445 19:18419775-18419797 CCGCGCCCACGTGCCCCGCGCGG - Intronic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1165928697 19:39342687-39342709 CCGCCCGCCGCCGCCGCCCGCGG - Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1166528361 19:43527087-43527109 CCACCCGCACCTGCCGCAGGAGG + Exonic
1166808038 19:45498622-45498644 CCGCGCCCAGCGGCCGCACGGGG + Exonic
1166947097 19:46404093-46404115 CCACGCCCACCTGCCCCCTGCGG - Intergenic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
925182394 2:1825840-1825862 CCGTGTGCACCTGCCGTGCGTGG + Intronic
926202650 2:10812771-10812793 CCGCGCCCACGTCCCGCCCCAGG + Intronic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
934856901 2:97735214-97735236 CCTCGCCCACGTGCCTCCCGTGG + Intronic
936439951 2:112542659-112542681 CCGCGCTCACCTGCACCGCGAGG - Exonic
937221977 2:120346923-120346945 CCGCGCGCATCTGCCGGGAGGGG - Intronic
938796117 2:134719179-134719201 CCGCCCGCACCTGCCCCCAGGGG - Intergenic
941185630 2:162318541-162318563 CCGGCCGCACCTGCCTGCCGCGG - Exonic
942965956 2:181892246-181892268 CGGCGCGCAGCTGCCGGCAGCGG + Exonic
946966421 2:225042201-225042223 CCGCGCGCCCCAGGCGCCCGGGG - Intronic
1171977596 20:31605422-31605444 CAGCGCGCAGCTGGGGCCCGCGG - Exonic
1172837446 20:37882156-37882178 ACGCACGCACCAGCCGCCGGGGG + Intergenic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173672992 20:44810685-44810707 CCGCGCGCACCTGCCGGGCCCGG - Intergenic
1175573204 20:60039717-60039739 CCCCACCCACCTGCCGCCTGTGG - Intergenic
1176380481 21:6110311-6110333 CCGCCCGCAGCGTCCGCCCGGGG + Intergenic
1176546690 21:8205401-8205423 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176554585 21:8249591-8249613 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176565641 21:8388448-8388470 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1176566821 21:8392300-8392322 GCGCGCGCGCATGGCGCCCGCGG - Intergenic
1176573506 21:8432616-8432638 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1179742991 21:43427929-43427951 CCGCCCGCAGCGTCCGCCCGGGG - Intergenic
1182355372 22:29720334-29720356 CCGCCCGCTCCAGCCGCCCCCGG + Exonic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
1203251555 22_KI270733v1_random:121667-121689 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1203259605 22_KI270733v1_random:166749-166771 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
952942360 3:38454284-38454306 CCGCGCACACCCGGAGCCCGCGG - Exonic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
954376054 3:50194702-50194724 CGGCGCGCACCCCCCGCACGGGG + Intronic
955687970 3:61563713-61563735 ACGGGCGCTCCAGCCGCCCGAGG - Intronic
960281412 3:115784708-115784730 CACCGCCCACCTGCAGCCCGGGG + Intergenic
962722270 3:138187244-138187266 CCGGCCCCACCTGCCGCTCGCGG - Intronic
968882463 4:3308489-3308511 CCTCGCACCCCAGCCGCCCGCGG - Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
972418801 4:38867869-38867891 CCGCGCTCGCCCGCCCCCCGGGG - Intronic
972516624 4:39815578-39815600 GCGCGCCCACCTGCTGCCTGAGG + Intergenic
983533374 4:168832940-168832962 CAGCGCGCACCGGCCACGCGTGG + Intronic
984953226 4:185021324-185021346 GCGCGCGCACCGCACGCCCGCGG + Intergenic
985173485 4:187176715-187176737 CCGCCCGTGGCTGCCGCCCGTGG + Intergenic
985932319 5:3068204-3068226 CCGCTAGCACCTGCCCCCCATGG + Intergenic
993386312 5:87267610-87267632 CGGCGCGCGCCTGTCTCCCGGGG - Intergenic
997608155 5:135191495-135191517 GAGCGCGCACCTGAGGCCCGCGG - Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002175775 5:177400333-177400355 CCGCGACCACCTGCTGGCCGAGG - Exonic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1011054753 6:83193362-83193384 TCGCGCGCAGCTGGCGCCTGAGG + Exonic
1014632489 6:123803736-123803758 TCGCGCGCTTCTGCCGCCCCCGG + Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016949494 6:149566367-149566389 CCGCCCTCACCTCCCGGCCGCGG + Exonic
1016982189 6:149863894-149863916 CCGTGCGGCCTTGCCGCCCGCGG - Exonic
1018613281 6:165662841-165662863 CGCCGCGCCCCTCCCGCCCGCGG - Intronic
1019175276 6:170156453-170156475 CCGCGTGCACCTGCCCCGCAGGG - Intergenic
1023049182 7:36236324-36236346 CCGCGCTCACCTGGAACCCGTGG - Intronic
1026817069 7:73521697-73521719 CAGCGCGCCCCGGCCGCTCGCGG - Intronic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1032344391 7:131106041-131106063 CCGCGCGCCCCGGCAGGCCGGGG + Intergenic
1034417311 7:150971929-150971951 CAGCCAGCACCTGCTGCCCGGGG + Intronic
1036195160 8:6708073-6708095 CCGCGCGCACGTCCGGCCCGAGG + Intergenic
1039502813 8:38030648-38030670 CGGCGTGCAGCTCCCGCCCGGGG + Exonic
1040997232 8:53414069-53414091 CCGCACACACCTGCAGCCCTTGG + Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042020592 8:64369457-64369479 CGGCGCGCTCCGCCCGCCCGCGG - Intergenic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1044591413 8:93917206-93917228 CGGCGCGCACCTGGCGCTCCAGG - Exonic
1044821326 8:96157959-96157981 CTGCGCACCCCTCCCGCCCGTGG + Intronic
1044999771 8:97869275-97869297 CCGCGCTCACCTGCAGCCGCCGG - Exonic
1045111606 8:98942275-98942297 CGGCGCGCACCTGCCCATCGAGG + Intronic
1049724283 8:144138297-144138319 GCGCGCGCACCAGCCGCTCCAGG - Exonic
1049761432 8:144333666-144333688 CCGCCAGCACCTGCGGCCCCTGG + Exonic
1050537831 9:6645573-6645595 CCGGGCGCAGCCGCCACCCGGGG - Exonic
1051171538 9:14322595-14322617 CCGCGCGCCCAGGCCGGCCGTGG - Intronic
1054820468 9:69516250-69516272 CCGCCGGCGCCTGCAGCCCGGGG + Exonic
1055574555 9:77648214-77648236 CCGCGCCTACCTCCCGCCTGGGG - Exonic
1055757776 9:79573241-79573263 CCGCTCGCCCCGGCGGCCCGCGG - Intronic
1056643271 9:88388613-88388635 CCGCGCTCACCTGCGCCCCCGGG - Intronic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1056992414 9:91423944-91423966 CGGCCCGCCCCTGCCGGCCGCGG - Intergenic
1059102474 9:111483819-111483841 CCGCGCGGGCCTGGCGCACGGGG - Intronic
1059305291 9:113349433-113349455 CCGCGCTCCCATCCCGCCCGGGG - Intergenic
1061904117 9:133687982-133688004 CTGGGCGCACCGGCCGCCCCCGG + Intronic
1062332715 9:136051579-136051601 CCGCCCGCACTTTCCTCCCGTGG - Intronic
1062390579 9:136332096-136332118 CCGCCCGCTGCTGCTGCCCGTGG + Intronic
1062578707 9:137220457-137220479 CCGCGTGCACCTGCCACGTGCGG - Exonic
1062621322 9:137423664-137423686 CTGCGTGCACCTGCTGGCCGGGG + Exonic
1203467957 Un_GL000220v1:104818-104840 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1203475778 Un_GL000220v1:148790-148812 CCGCGGGGACCCGCCGCGCGTGG + Intergenic
1198310147 X:135422201-135422223 TCGCGCTCAGCTGCGGCCCGAGG + Intergenic
1199772742 X:150984408-150984430 CCGCCCGCGCCGGCCGCGCGCGG + Intronic