ID: 1113769009

View in Genome Browser
Species Human (GRCh38)
Location 13:112896851-112896873
Sequence CCCGCCTCACAGATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113769000_1113769009 12 Left 1113769000 13:112896816-112896838 CCCAATGCAGGTTCCTGAGTCCC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113769002_1113769009 -1 Left 1113769002 13:112896829-112896851 CCTGAGTCCCACCACAGAGCTTC 0: 1
1: 0
2: 1
3: 32
4: 291
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113769003_1113769009 -8 Left 1113769003 13:112896836-112896858 CCCACCACAGAGCTTCCCGCCTC 0: 1
1: 0
2: 3
3: 14
4: 197
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113769004_1113769009 -9 Left 1113769004 13:112896837-112896859 CCACCACAGAGCTTCCCGCCTCA 0: 1
1: 0
2: 0
3: 32
4: 497
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113768998_1113769009 23 Left 1113768998 13:112896805-112896827 CCCTCTGGCATCCCAATGCAGGT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113768999_1113769009 22 Left 1113768999 13:112896806-112896828 CCTCTGGCATCCCAATGCAGGTT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94
1113769001_1113769009 11 Left 1113769001 13:112896817-112896839 CCAATGCAGGTTCCTGAGTCCCA 0: 1
1: 0
2: 3
3: 13
4: 150
Right 1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG 0: 1
1: 0
2: 1
3: 14
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113769009 Original CRISPR CCCGCCTCACAGATGGAACA GGG Intronic
905216504 1:36412092-36412114 ACTGCCTCACAGATGAAAAATGG - Intergenic
906041256 1:42789421-42789443 CCCACCTCTCAGATGGGAGAAGG + Intronic
914372537 1:147041535-147041557 CATGCCTCACAGAAGGAAAATGG + Intergenic
917975938 1:180237648-180237670 CCAGACTGACAGAGGGAACAGGG - Intronic
920363571 1:205436121-205436143 CCCGCCCCTCAGATGGAACACGG + Intronic
920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG + Intergenic
921292018 1:213667027-213667049 CCCACCTCACTGATGAAACCAGG - Intergenic
1069313072 10:67063450-67063472 CCTGCCTCACTGTTGGAACTTGG - Intronic
1069984192 10:72272906-72272928 CCCGCCTGAATGATGAAACACGG + Intergenic
1076567559 10:131409311-131409333 CCCGTCTCTCAGCTGCAACAAGG + Intergenic
1084898989 11:72295625-72295647 GCCGGCTGACAGATGGAAAAGGG - Exonic
1087324811 11:96708693-96708715 CCCTCCTCACAGCTGGCAGATGG + Intergenic
1094382800 12:29861870-29861892 CCAGCCTTACAGATTGAATAAGG - Intergenic
1095864655 12:46958122-46958144 CCAGCTTCACAGATGGATAATGG + Intergenic
1096649774 12:53056455-53056477 CCCGAGTCTCAGATGGAGCAAGG - Intronic
1097694659 12:62764735-62764757 CCACCTTCACAGATGGATCACGG - Intronic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1104824031 12:131695652-131695674 CCCCCCACACAGATGTAACTTGG + Intergenic
1106542103 13:30699267-30699289 CCCTCCTCACAGAAGGAAGCAGG + Intergenic
1106857445 13:33868443-33868465 ACCGCCTCACAGATGAAAAATGG + Intronic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG + Intronic
1114198037 14:20496108-20496130 GCCGCCTCACAGTTGGAATCAGG + Intergenic
1114568653 14:23650326-23650348 CCAGCCTCACAAGCGGAACATGG - Intergenic
1117018182 14:51540274-51540296 CCGGCCTGACAACTGGAACATGG - Intronic
1118730336 14:68661498-68661520 CCAGCATCACAGAAGGAACCAGG - Intronic
1119304962 14:73600342-73600364 CCTGCCTCCTAGATGGAAAAGGG + Intergenic
1124292642 15:28467655-28467677 CCAGAGTCACAGATGGAAAAGGG + Intergenic
1124980443 15:34565002-34565024 CCCGGCTCTCAGCTGAAACATGG - Intronic
1128766798 15:70256066-70256088 CCCACTTCACAGATGAAACACGG + Intergenic
1129886298 15:79040195-79040217 CCAGCCTCTCAGACGGAACCTGG + Intronic
1131300688 15:91197102-91197124 CCAGCCTCACATCTGAAACAGGG - Intronic
1131425642 15:92343620-92343642 CCTGCTTCACAGCTGGAACCAGG - Intergenic
1132345254 15:101104269-101104291 CCCGTCCCACAGATGGTCCAGGG + Intergenic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1139147604 16:64343279-64343301 CCTGCCTCACAGATGTTCCAAGG + Intergenic
1141712940 16:85710448-85710470 CCCGCATCACAGATGAAAACCGG + Intronic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1151658742 17:75507891-75507913 CCCGCCTCCCAGCTGGCCCAGGG + Intronic
1155682486 18:28505796-28505818 CCCGCCTTACAGGTTGAAAATGG + Intergenic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1162311782 19:9912491-9912513 CCCCCCAAACAGATGGAACAGGG + Intronic
1164480696 19:28609091-28609113 CCCTCCTGCCAGATTGAACAAGG - Intergenic
1165417467 19:35703572-35703594 CACACCTCACAGATGGTAAAGGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925226072 2:2185462-2185484 TCCCCCTCACAGAAGGAACGCGG - Intronic
925226086 2:2185516-2185538 TCCGCCTCACAGAAGGAACGCGG - Intronic
925226113 2:2185615-2185637 TCCGCCTCACAGAAGGAACGCGG - Intronic
925226175 2:2185822-2185844 TCCCCCTCACAGAAGGAACGCGG - Intronic
925226203 2:2185921-2185943 TCCGCCTCACAGAAGGAACGCGG - Intronic
925226230 2:2186020-2186042 TCCGCCTCACGGAAGGAACGCGG - Intronic
926473897 2:13298037-13298059 CCCATCTCACAGATGGAAGTGGG + Intergenic
927519617 2:23690939-23690961 CCCTCCTGCCACATGGAACACGG - Intronic
929595763 2:43174664-43174686 GCCGCCTCACTGCTGCAACAGGG + Intergenic
933279277 2:80314803-80314825 CCTTCCTCAAACATGGAACAAGG + Intronic
934750262 2:96789376-96789398 CCTCCCTCACAGCTGGCACAAGG - Intronic
936519138 2:113200865-113200887 AGTGCCTCAAAGATGGAACATGG + Intronic
941394312 2:164955567-164955589 CCCGCCTCCCTGAGAGAACAGGG + Intergenic
948365831 2:237453884-237453906 CCTGCCACACAGGTGGCACATGG - Intergenic
948679826 2:239626236-239626258 ACCACCCCAGAGATGGAACAAGG + Intergenic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
1170153501 20:13249273-13249295 CCCATTTCACAGATGGAACAGGG + Intronic
1172125365 20:32622393-32622415 CCCACGCCACAGATGGTACAGGG - Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1178831845 21:36062963-36062985 CCCACTTCCCAGATGGAACGGGG - Intronic
1180933692 22:19610442-19610464 CCCGCCCCACAGAAGCCACAGGG - Intergenic
1181386391 22:22548864-22548886 CCTGCCTCACAGATGAGCCAAGG - Intronic
1182277867 22:29201850-29201872 CCCCCCTCAAAGATGCAAAACGG + Intergenic
950011412 3:9726796-9726818 CCTGCCTCACAGATGACACAAGG + Intronic
954679102 3:52331994-52332016 CCCATTTCACAGATGCAACAGGG + Intronic
956135036 3:66089878-66089900 CCAGCCTCGGAGATGGAGCAAGG + Intergenic
956872890 3:73435600-73435622 CCAGACTCACTGATGGACCAAGG - Intronic
961323903 3:126098579-126098601 CCCAGCTCCCAGATGGACCACGG + Intronic
968582548 4:1401801-1401823 CCTGCCTCACAGAGGGAGCTTGG - Intergenic
975718613 4:77229003-77229025 CCCACCTCACAGATGGGCCCAGG - Intronic
976101231 4:81565889-81565911 TCTGCCTCCCAGATGGAACATGG + Intronic
995851008 5:116545613-116545635 TGCTCCTCGCAGATGGAACACGG - Intronic
996243627 5:121232749-121232771 CCTGCGTCACAGATGGAAAATGG - Intergenic
999091035 5:148935997-148936019 CCCTCCTCATAGGTGGAAAAGGG + Intronic
1000743726 5:165003433-165003455 CCAGCCTCACAGATGAGAGAGGG - Intergenic
1000959613 5:167584499-167584521 CATGCCTCACAGATGAAAAATGG - Intronic
1001254471 5:170172752-170172774 GCCGCCTCTCACATGGGACAAGG - Intergenic
1001820801 5:174708757-174708779 CCGGCCTCAGAAATGGAATAGGG + Intergenic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1004205314 6:13586964-13586986 CTCCCCTGACAGATGGAACCAGG - Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018673879 6:166202379-166202401 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018673885 6:166202405-166202427 CACGCCTCACAGCTGGGACTGGG - Intergenic
1019347874 7:539467-539489 CCCACCTGCCAGCTGGAACAGGG + Intergenic
1020932829 7:14420962-14420984 ACTGCGTCACAGATGGAAAATGG + Intronic
1025029706 7:55547202-55547224 CCAGCCTCAGAGGTGGGACAGGG - Intronic
1025965282 7:66263980-66264002 CCCAGCTGACACATGGAACAGGG - Intronic
1030534706 7:110751627-110751649 GCTGCCTCACAGCTGTAACACGG + Intronic
1037121200 8:15289504-15289526 CCCACTTCACAGATGATACAAGG + Intergenic
1044027426 8:87191068-87191090 CCCAGCTTACAGATGGCACATGG - Intronic
1048313654 8:133346184-133346206 CCCTGCTCAAGGATGGAACAAGG - Intergenic
1048386667 8:133918600-133918622 CCAGCTTCCCAGATGCAACAGGG - Intergenic
1048402105 8:134081782-134081804 CATGCCTCACAGATGGGAGATGG - Intergenic
1049519135 8:143079416-143079438 CCCGCCTCACCGGGGGCACAGGG - Intergenic
1050337702 9:4605440-4605462 CCTGCTCAACAGATGGAACAGGG + Exonic
1053042614 9:34887504-34887526 CCAGCCTGTCAGAAGGAACAAGG - Intergenic
1054839960 9:69727564-69727586 CCAGCATCACAAATTGAACAGGG + Intronic
1060526059 9:124321957-124321979 CCTGCCTCACAGAAGGAGCAGGG + Intronic
1060664390 9:125424146-125424168 CCCGCCTCACAGAGCGGTCAAGG + Intergenic
1203760282 EBV:9444-9466 CCCGTGTCACATGTGGAACAGGG + Intergenic
1187525560 X:20051227-20051249 CCCACCTCCCAGATGTAATATGG + Intronic
1195617851 X:106927305-106927327 CCCCCCTAACAGATGGCCCAGGG + Intronic
1196789538 X:119451583-119451605 TCCACCTCACAGATGTGACAGGG - Intronic
1197207470 X:123802225-123802247 CCTTCCTCACAGATGTGACAAGG - Intergenic