ID: 1113777220

View in Genome Browser
Species Human (GRCh38)
Location 13:112954634-112954656
Sequence AGGGGGCATGGGTGGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 441}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113777208_1113777220 1 Left 1113777208 13:112954610-112954632 CCACTGGGCTCTGACTGGCTCCC 0: 1
1: 0
2: 7
3: 54
4: 380
Right 1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 441
1113777207_1113777220 2 Left 1113777207 13:112954609-112954631 CCCACTGGGCTCTGACTGGCTCC 0: 1
1: 0
2: 4
3: 18
4: 264
Right 1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 441
1113777202_1113777220 18 Left 1113777202 13:112954593-112954615 CCCTCAGTGGGCTCTTCCCACTG 0: 1
1: 1
2: 4
3: 112
4: 1058
Right 1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 441
1113777203_1113777220 17 Left 1113777203 13:112954594-112954616 CCTCAGTGGGCTCTTCCCACTGG 0: 1
1: 0
2: 4
3: 35
4: 323
Right 1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113777220 Original CRISPR AGGGGGCATGGGTGGGCTCA GGG Intronic
900112700 1:1015251-1015273 AGGGTGCATGGGTGGGGGAAGGG - Intergenic
900385680 1:2409557-2409579 AGGGGACAAAGTTGGGCTCAGGG - Intronic
900988541 1:6087041-6087063 AGGGGGCAGGGGCGGGCTCTGGG - Intronic
901005967 1:6171674-6171696 AGGAGGGACTGGTGGGCTCAAGG - Intronic
901234716 1:7661658-7661680 AGGGGACCTGGGTGGGGCCAAGG - Intronic
901292089 1:8131965-8131987 ATAGGTCATGGGTGGCCTCAAGG + Intergenic
901632941 1:10656741-10656763 AGGGAGGAGGGGTGGGGTCAGGG + Intronic
901668298 1:10838763-10838785 AGGGGGCCTGGCTGGGCCCTGGG + Intergenic
902380570 1:16050491-16050513 GTGGGGGATGGGTGGGCTCTAGG - Intronic
902808564 1:18875554-18875576 AGGGGCACTGGGAGGGCTCAGGG - Intronic
903499620 1:23794033-23794055 AGGGGGCATGAGTGGGTAGAGGG - Intronic
903540301 1:24092923-24092945 TGAGGGCATGGGTGGGCGCAGGG - Intronic
903927883 1:26843899-26843921 AGGGGGCATGAGGGGGCTCCTGG - Intronic
903972151 1:27126018-27126040 TGGGGGCATGTTTGTGCTCAAGG - Intronic
904326461 1:29729742-29729764 ACGGGGCATGGGTGGGCTGTGGG + Intergenic
904499258 1:30904798-30904820 AGGGAGCATGGATGGGGTCAGGG - Intronic
904671911 1:32172304-32172326 AGGGAGCAAGGATGGCCTCAGGG + Exonic
904676856 1:32204103-32204125 ATGGGGCATGGCTGGGACCATGG + Intronic
905624104 1:39475614-39475636 AGGGGGCATGCACAGGCTCAGGG + Intronic
906448260 1:45922207-45922229 GGCGGCCATGGGTGGGCCCAGGG + Intronic
906609672 1:47192667-47192689 AGGGAGCATGGGTGGACACTTGG + Intergenic
906656082 1:47549243-47549265 AGTGGGCAGTGGTGGGTTCAAGG + Intergenic
907455936 1:54575462-54575484 AGGGGGCAGGGATGGGAGCAGGG + Intronic
907482522 1:54754792-54754814 AAGGGGCAGGGATGGGCCCAGGG - Intergenic
907483015 1:54757708-54757730 TGGGGGCAGGGGTGGGCTGGGGG + Exonic
914050483 1:144126406-144126428 TTGGGATATGGGTGGGCTCAGGG + Intergenic
914128699 1:144839039-144839061 TTGGGATATGGGTGGGCTCAGGG - Intergenic
914433588 1:147641083-147641105 TGGGGGGAGGGGTGGGCTAAGGG - Intronic
914825945 1:151138124-151138146 TGGGGTCAGGGGAGGGCTCAGGG + Intronic
915111232 1:153565754-153565776 CTGTGGCCTGGGTGGGCTCAGGG - Exonic
916557108 1:165902700-165902722 AGGGGGCATGGGTGGGAGCTGGG + Intronic
920529286 1:206690264-206690286 AGGGGTCAGGGCTGGGGTCAGGG - Intronic
920730411 1:208478282-208478304 TGGTGGTATTGGTGGGCTCAAGG + Intergenic
920866898 1:209760437-209760459 AAGGAGGGTGGGTGGGCTCAAGG + Intronic
922607622 1:226900350-226900372 AGGGGGCAGGGGGGTGCACATGG - Intronic
922768535 1:228169025-228169047 ATGTGGCATGGGTGGGCTTAGGG + Intronic
923336703 1:232977220-232977242 CAGGGGCATGTGTGGGGTCAGGG - Intronic
1064077662 10:12282652-12282674 AGGGGGAATGGGTGGGATGGGGG - Intergenic
1064964345 10:21000212-21000234 AGGGGGCATGGGGGGCCAGAGGG + Intronic
1066457654 10:35585862-35585884 ATGGGGCAGGGGTGGGCGCTGGG - Intergenic
1067739216 10:48881915-48881937 AGGGGGCTGGGGTAGGCCCAGGG - Intronic
1067849196 10:49744245-49744267 AGGTCCCAAGGGTGGGCTCAGGG - Intronic
1069625199 10:69863453-69863475 AGGAGGCATGGGTGGGGGCTAGG + Intronic
1069642292 10:69963750-69963772 AGGGTGGATGGGTGTGCTCTTGG - Intronic
1070401769 10:76059101-76059123 ATTGGGCATGGGTGGGCTTTGGG + Intronic
1070597232 10:77841157-77841179 CGGGGGCTTGGATGGGCCCATGG - Intronic
1070890919 10:79941792-79941814 AGGGTGCATGAGGGGGCTCTGGG - Intronic
1072426841 10:95337133-95337155 AGGAGGCAAGGGTGGGGTCAGGG + Exonic
1072437959 10:95430824-95430846 AGGAGTCAGGGCTGGGCTCAGGG + Intronic
1073093446 10:100965196-100965218 AGGGGACTGGGGTGGGCTGAGGG - Intergenic
1073541527 10:104319447-104319469 TGGGGGCCAGGGTGGACTCAGGG - Intronic
1074247945 10:111713713-111713735 AGTGGCCATGGGCAGGCTCAGGG + Intergenic
1074503216 10:114044306-114044328 AGCGGGCATGGGTCTGCTGATGG + Exonic
1074703472 10:116111865-116111887 CGTGGGGAAGGGTGGGCTCAGGG - Intronic
1075700641 10:124467389-124467411 AGGGGGCAGGGAGGGGGTCATGG + Intronic
1076237080 10:128871707-128871729 TGGGGGCATGAGAGGGCTCGGGG + Intergenic
1076518222 10:131062099-131062121 AGGGGACATGGGCAGTCTCAGGG - Intergenic
1076550631 10:131275788-131275810 AGGGGGAAAGGCTGGGCTCCTGG - Intronic
1076569480 10:131422975-131422997 AGGGGCCATGGTGGGGATCAGGG + Intergenic
1076670374 10:132117654-132117676 AGGGTGCAGGCGTGGGCTCGGGG + Intronic
1076856355 10:133117258-133117280 AGTGGGCAGGGGTGGGCTCCGGG - Intronic
1077061336 11:619085-619107 AGGGTCCCTGGGAGGGCTCAGGG + Exonic
1077213242 11:1383104-1383126 AGGTGGCACGGGTGGGCAGACGG - Intergenic
1077272782 11:1689657-1689679 AGGCAGCATGGGTGGGCGCTGGG - Intergenic
1077281906 11:1749663-1749685 AGGGGGCCTGCTGGGGCTCAGGG - Intronic
1077316102 11:1920028-1920050 AGGGGGCAAGTCGGGGCTCAGGG + Intronic
1077476853 11:2794548-2794570 TGGGGGCCCGGCTGGGCTCAGGG - Intronic
1078451898 11:11446702-11446724 AGGGGGCAAGGCTGGGAGCATGG - Intronic
1079696918 11:23492943-23492965 AGGGGGCATGGCTGGATTAATGG - Intergenic
1080292182 11:30683308-30683330 AGTGGGCATGTGTGAGTTCATGG + Intergenic
1081745685 11:45470935-45470957 AGGAGGCATGGGAAGCCTCAAGG - Intergenic
1081761909 11:45582513-45582535 AGAGGGAATGTGTGGGCTGAAGG + Intergenic
1082961387 11:58921650-58921672 AGGGGTCATGGATGCGGTCATGG - Intronic
1083594282 11:63911656-63911678 TGGGGCCATGGCCGGGCTCAGGG - Exonic
1083904047 11:65658686-65658708 AGGAGGCAGGGGTGGGCTCTTGG - Intronic
1084118680 11:67056592-67056614 TGGGGGCGGGGGTGTGCTCAGGG - Intergenic
1084165021 11:67371599-67371621 GAGGGCCATGGGTGTGCTCAGGG + Intronic
1084214655 11:67640767-67640789 AGGGGGCATGGAGGGGCTGGGGG + Intergenic
1084590068 11:70085321-70085343 GGGTGGCTTGGGAGGGCTCAGGG - Intronic
1085074063 11:73573962-73573984 AAGGGGCAGGGGTGGGGGCAGGG + Intronic
1085408474 11:76277882-76277904 GGCTCGCATGGGTGGGCTCAGGG + Intergenic
1087931902 11:103987506-103987528 AGGATGCTTGGGAGGGCTCAAGG - Intronic
1088653520 11:111977825-111977847 GGGGGGCCTGGGTGGGAACAGGG + Intronic
1088751596 11:112846651-112846673 AGGAGGGTTGGGTGGGATCAAGG + Intergenic
1089365178 11:117917134-117917156 AGGGTGCAGGGGTGGGTTCTGGG - Intronic
1089376175 11:117996293-117996315 AGGGGACAGGGAGGGGCTCATGG + Intronic
1089513394 11:119015815-119015837 AGTAGGAATGTGTGGGCTCATGG - Intronic
1089523739 11:119083165-119083187 AGGGGGAAAGGGTGGGAGCAGGG - Intergenic
1089603734 11:119629698-119629720 GGGGGGCATGGGGAGGCTCCTGG + Intronic
1089733714 11:120535328-120535350 TGGGGGCCTTGGTGGTCTCAAGG + Intronic
1089804198 11:121068512-121068534 AGGGAGCAAGGGTGGACTCAGGG - Intronic
1090077259 11:123587313-123587335 ATTGGGCATGGGAGGACTCAGGG - Intronic
1094157336 12:27350973-27350995 AGGGGGGGTGGGTGGGGTCTGGG - Intronic
1094839775 12:34338045-34338067 GGGGTGCATGGGTGGGGCCAGGG - Intergenic
1095876414 12:47083701-47083723 AGGAGGCATGGGTCAGCTTATGG + Intronic
1096113804 12:49043519-49043541 AGGAGTCAAGGGTGGGGTCAAGG - Intronic
1096148840 12:49296301-49296323 AGGTGGCATCGGTGGGCGCGGGG + Intronic
1097187668 12:57204354-57204376 CAGGGGTCTGGGTGGGCTCATGG + Intronic
1101038423 12:100728942-100728964 ATGGGGCAGGGGTGGGTTCGGGG - Intronic
1101333996 12:103780093-103780115 AGGGGTGATGGCTGGCCTCAAGG + Intronic
1101594220 12:106149453-106149475 AGGAGGCATGGATGTCCTCAGGG + Intergenic
1101639914 12:106580638-106580660 CGGGGGCACGGGTGGTCTCCAGG - Intronic
1101686686 12:107030784-107030806 AGGGGGCAGGGGAAGGCACAAGG + Intronic
1101778822 12:107817457-107817479 AGGTGGAATGGCTTGGCTCATGG + Intergenic
1102017332 12:109656605-109656627 AAGGGGCATGGGTGGGTGGAAGG - Intergenic
1102770633 12:115473069-115473091 TGTGGGCATGGGTGGGGTTAGGG - Intergenic
1103178515 12:118886594-118886616 AGGGGGCATGGGTGAGCAACAGG + Intergenic
1103587700 12:121968394-121968416 AGGGAGCAGGGGTGAGCCCAAGG - Intronic
1103599179 12:122043424-122043446 AGGGGGCGGGAGTGAGCTCAGGG + Intronic
1104024485 12:125015829-125015851 AGGGGCCATGAGTGGCCCCAGGG - Intronic
1104480455 12:129103373-129103395 TGGGGGCATGGGCTGGCTGATGG - Intronic
1104950243 12:132436790-132436812 CGGGGGGACAGGTGGGCTCAGGG - Intergenic
1104966642 12:132511381-132511403 AAGGGGCAGGGATGGGCCCAGGG - Intronic
1105975575 13:25469233-25469255 AGGGGGCAGGGGAAGGCTCTGGG - Intronic
1106077794 13:26475900-26475922 AGGGGGCAAGGATGGGAACAAGG + Intergenic
1107043647 13:35973817-35973839 AGGGAGCAGGGGCTGGCTCATGG + Intronic
1107616772 13:42177161-42177183 AGAGGGCATGAGGGGGCTTATGG - Intronic
1107687059 13:42912393-42912415 GAGAGGCATGGCTGGGCTCAGGG + Intronic
1107768471 13:43763352-43763374 AGGGGGCAAGGGAGTGCTCCTGG + Intronic
1111770017 13:92585014-92585036 AGGGGGTAAGGGGGGGCTCATGG + Intronic
1112574880 13:100626968-100626990 AGGGGGCATGGGAGCTCTCCAGG - Intronic
1113777220 13:112954634-112954656 AGGGGGCATGGGTGGGCTCAGGG + Intronic
1113826756 13:113261487-113261509 AGGGGGCAAATGTGGGCTGATGG - Intronic
1114797239 14:25730082-25730104 AGGGGGCATGAGGGGGCTTCTGG - Intergenic
1114838678 14:26235404-26235426 AGGGGGAATGAGAAGGCTCATGG - Intergenic
1117301108 14:54429289-54429311 AGGGGGCAGGAGGGTGCTCATGG + Intronic
1117953180 14:61102942-61102964 ATAGGGCTTGGGTGGGCTCAGGG + Intergenic
1118604566 14:67493324-67493346 AGGAGGCAAGGGTGGGCACTTGG - Intronic
1118790899 14:69091782-69091804 AGGGGGCAGGCGTCGCCTCAGGG + Exonic
1118821533 14:69349269-69349291 AGGGGGTGGGCGTGGGCTCAAGG - Intronic
1121258902 14:92552359-92552381 GGGGGACCTGGGTGGTCTCAGGG - Intronic
1121717012 14:96083607-96083629 TGGGCTCATGGCTGGGCTCATGG - Intronic
1121817072 14:96936677-96936699 AGGGGTCATGGCAGGGCTAAAGG + Intergenic
1122064266 14:99160465-99160487 AGGGGCCTGGGGTGGGGTCAGGG + Intergenic
1122263750 14:100537358-100537380 ATGGGCCGTGGGAGGGCTCAGGG + Exonic
1122284426 14:100642280-100642302 AGGGGGCAGGGGCCGGCTCAAGG + Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122835425 14:104428413-104428435 CGGGGGCAGGGGTGGGCCAATGG + Intergenic
1122972659 14:105158722-105158744 AGGAGCCAGGGCTGGGCTCAGGG - Intronic
1123035813 14:105471501-105471523 AGGGCGCCTGGGTGGGCTGGGGG - Intergenic
1123041772 14:105493162-105493184 AGGTGGCAGGGGCTGGCTCAGGG + Intronic
1123420354 15:20125715-20125737 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1123445506 15:20327809-20327831 TTGGGATATGGGTGGGCTCAGGG - Intergenic
1123529578 15:21132251-21132273 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1123944935 15:25234460-25234482 AGGGAGCATGGGCTGCCTCAGGG - Intergenic
1125530890 15:40412711-40412733 AGGGGGGTCGGGAGGGCTCAGGG + Intronic
1126104540 15:45138955-45138977 AGCAGGACTGGGTGGGCTCAGGG + Intronic
1127571911 15:60251796-60251818 ACGGGGGATGGGGGGGCGCAGGG - Intergenic
1127641448 15:60919397-60919419 AGGTGGCCTGTGTGGGCTCCAGG - Intronic
1127893725 15:63277321-63277343 CGGGCGCAGGGGCGGGCTCAAGG - Intronic
1128451345 15:67807486-67807508 AGGTGGCAGGTGTGGGGTCAAGG - Intergenic
1128457917 15:67843202-67843224 AGGAAGCATGGAGGGGCTCAGGG + Intergenic
1129161118 15:73748529-73748551 CGGGGGCATGGGTAGGCTCAAGG - Intronic
1129787002 15:78316259-78316281 AGGGGGCATGGCGGGGGGCAGGG - Intergenic
1130517739 15:84639135-84639157 AGGGGGAAAGGGTGGGAGCAGGG - Intergenic
1130655533 15:85789767-85789789 GGGGAGCAGGCGTGGGCTCAAGG - Intronic
1132087664 15:98921502-98921524 AGGAAGCCTGGGTGGGCTCCAGG + Intronic
1132338745 15:101064986-101065008 AGGAGGCCTTGGTGGCCTCAAGG + Intronic
1132364733 15:101249193-101249215 AGGGGGCATGGGGGAGATAAGGG + Intronic
1132626494 16:894092-894114 CAGGGGCATGGGTGGGCGGACGG - Intronic
1132653104 16:1030469-1030491 TGGGGCCACGGGAGGGCTCAGGG + Intergenic
1132828799 16:1917797-1917819 AGGGAGCAGGGGTGCGCTCCGGG - Intronic
1133510331 16:6451900-6451922 AGGGGCCATGGATGGAGTCATGG - Intronic
1133510407 16:6452210-6452232 AGGAGCCATGGGTGGAGTCATGG - Intronic
1133510448 16:6452430-6452452 AGGGGCCATGGATGGAGTCATGG - Intronic
1133528311 16:6628061-6628083 AGGGAGCCTGGCTGGGCTCATGG - Intronic
1133703912 16:8335160-8335182 AGGCAGCATGGGTGTGATCAAGG - Intergenic
1133716976 16:8459147-8459169 AGGGGGCTTGGTTGGCCTCAGGG - Intergenic
1134541790 16:15072994-15073016 AGGAGGCATGGGTGGGCAACAGG + Exonic
1135134987 16:19880891-19880913 AGGGGACATGGCTGGGGTCGAGG - Intronic
1135134994 16:19880911-19880933 AGGGGACATGGCTGGGGTCGAGG - Intronic
1135811258 16:25588730-25588752 AGGGGGCAGGGGAGGGTTCCAGG - Intergenic
1136553900 16:30996895-30996917 AGGGGGCTTGGGCAGCCTCAAGG + Intronic
1136556387 16:31010129-31010151 AGGGGGCAGGAGAGGTCTCAGGG - Intronic
1136629214 16:31479563-31479585 AGGGAGCATGTATGGGCACAAGG + Intergenic
1136709967 16:32228925-32228947 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136721242 16:32320789-32320811 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1136757942 16:32700486-32700508 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1136810164 16:33169889-33169911 GGGGGGCAGGGGCGGGCGCAGGG + Intergenic
1136816640 16:33279969-33279991 GGGGGGCAGGGGCGGGCGCAGGG + Intronic
1136839625 16:33527075-33527097 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1137581019 16:49633654-49633676 GGGGGGCATAGGTGCTCTCAGGG - Intronic
1138313942 16:56052302-56052324 AGAGGGGAGGGGTGGCCTCAGGG - Intergenic
1138497120 16:57415522-57415544 TGGGGGCATGGGCAGGCTGAGGG + Intronic
1138510707 16:57507183-57507205 AGGGTCCAGGGGTGGGCTGATGG + Intergenic
1140734712 16:77887996-77888018 GGAAGGCCTGGGTGGGCTCAAGG - Intronic
1141666430 16:85467964-85467986 ATGGGGCGTGGGAGGGGTCAGGG + Intergenic
1141766229 16:86061615-86061637 TGGGGGCCTGGGTGGGCTGCTGG - Intergenic
1142147138 16:88497411-88497433 AGGGGTCAGGGTGGGGCTCAGGG + Intronic
1142147157 16:88497456-88497478 AGGGGTCAGGGTGGGGCTCAGGG + Intronic
1142147177 16:88497501-88497523 AGGGGTCAGGGTGGGGCTCAGGG + Intronic
1142149824 16:88507760-88507782 TGGGTGCATGGGTGAGGTCAGGG - Intronic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1203005190 16_KI270728v1_random:196981-197003 TTGGGATATGGGTGGGCTCAGGG - Intergenic
1203060093 16_KI270728v1_random:960835-960857 GGGGGGCAGGGGCGGGCGCAGGG - Intergenic
1203136740 16_KI270728v1_random:1733102-1733124 TTGGGATATGGGTGGGCTCAGGG - Intergenic
1203149791 16_KI270728v1_random:1827360-1827382 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1142597622 17:1037144-1037166 AGGGGTCCAGGGTGGGCTCAAGG + Intronic
1142781606 17:2185658-2185680 AGGGGGCGAGGGCAGGCTCATGG + Intronic
1142905902 17:3041627-3041649 AGAGGGCATGGCTGGACACAGGG - Intergenic
1143496526 17:7315701-7315723 AGTGGGGAAGGGTGGGCGCACGG - Exonic
1143625776 17:8109579-8109601 GGGGAGCCTGGCTGGGCTCAGGG + Intronic
1143656057 17:8294462-8294484 TGGGGCCATGGCTGGGGTCATGG - Exonic
1143843144 17:9750752-9750774 AGGGGGGATGGGTGGGAAAATGG - Intergenic
1144461295 17:15460663-15460685 AGGGGGCAAGTGTGGGAGCAGGG - Intronic
1144472884 17:15560349-15560371 AGTGGTCATGGCTGGGCGCAGGG - Intronic
1144568688 17:16381226-16381248 GGGGGGAATGGGTGAGGTCAAGG + Intronic
1144754311 17:17669913-17669935 ATGGGGCTTGGGTGGGTGCAAGG - Intergenic
1145244294 17:21258171-21258193 AGGGGGCAGGGGCGTGCTCCTGG + Intergenic
1145254177 17:21313776-21313798 AGGGGCCAAGGGTGGCATCAGGG + Intronic
1145322423 17:21774186-21774208 AGGGGCCAAGGGTGGCATCAGGG - Intergenic
1145933774 17:28703444-28703466 CGGGGCAAGGGGTGGGCTCAGGG - Exonic
1146002901 17:29141870-29141892 AGAGGGAAAGGGTGGGCTCCAGG - Intronic
1146790485 17:35747949-35747971 AGGGGGCAAGGGTGAGGTTAAGG + Intronic
1147652826 17:42071968-42071990 AAGGGGCATGGGGGGGCCCCTGG - Intergenic
1147989145 17:44322767-44322789 AGGGAGCATGGGAGGGTGCAAGG - Intronic
1148201528 17:45753066-45753088 AGAGGGCAGGTGTGGTCTCAAGG - Intergenic
1148647246 17:49226040-49226062 AGGGGACATGTCTGGGCACAAGG + Intronic
1148665462 17:49371421-49371443 AGGGGGAACGGTGGGGCTCAAGG + Intronic
1148889644 17:50798623-50798645 AGGGGTCAGGGGAGGGTTCAGGG + Intergenic
1149448930 17:56734416-56734438 AAGGGACATGGATTGGCTCAAGG + Intergenic
1149516793 17:57287187-57287209 AGGAGGCATTCTTGGGCTCACGG - Intronic
1151821996 17:76501495-76501517 AGGGGGCGTGGCCGGGCTCATGG + Intronic
1152093441 17:78259043-78259065 TGGGGGCCTGGCTGGGCCCATGG + Intergenic
1152124524 17:78438309-78438331 AGGGGTCTTGGATGGGCTCCAGG + Intronic
1152354058 17:79798134-79798156 TCGGGGCCTGGGTGGGCTAAGGG + Intronic
1152383689 17:79956129-79956151 AGGAGGCTTGGGTGGGCGGAGGG - Intronic
1152573552 17:81130721-81130743 ACGGGGCAGGGGTGGGCACTGGG - Intronic
1152624874 17:81383624-81383646 TGGGGGCTGGGGTGGGGTCAAGG - Intergenic
1152632067 17:81414815-81414837 AGTGGGCACGGCTGGGCCCAGGG - Intronic
1152639381 17:81443305-81443327 GGTGGGCCTGGGTGGCCTCAAGG + Exonic
1152704973 17:81838754-81838776 AGGGGGCAGGGGAGGGGACAGGG - Intergenic
1154492936 18:14934978-14935000 AGGGGGCCTGGGAGGGTGCAGGG - Intergenic
1156368862 18:36454688-36454710 AGGTTGCAGGGGTGGGCTCCAGG - Intronic
1158746186 18:60202363-60202385 AGGCAGCATAGGAGGGCTCAGGG - Intergenic
1160722589 19:604057-604079 ATGGTGCATGGGTGGGGCCAAGG + Intronic
1161059540 19:2208081-2208103 AGGGTCCATGGGTGGGGTCTGGG + Intronic
1161912848 19:7207514-7207536 AGGAGGCTGGGGAGGGCTCAAGG + Intronic
1162907357 19:13831635-13831657 AGGGTCCCAGGGTGGGCTCAGGG + Exonic
1163020831 19:14480048-14480070 AGGGCGCTTGGCTGGGCTAATGG + Intronic
1163675472 19:18653561-18653583 AGGGTGGATGGGTGGGTGCATGG - Intronic
1165105822 19:33469237-33469259 TGTGGGGATGGGTGGGCACAGGG - Intronic
1165110561 19:33499776-33499798 CGGGGGCAGGGCTGGGCACATGG + Intronic
1165436330 19:35797375-35797397 AGGGGTCATGGGGAGGCTCTAGG + Intergenic
1166309416 19:41954347-41954369 AGTGGGCATCAGTGGGCTCTGGG + Intergenic
1166369226 19:42292138-42292160 AGGGAGTGTGGCTGGGCTCAGGG - Exonic
1166667401 19:44689397-44689419 TGGGCGCATGGGGGGGCTCAAGG - Intergenic
1166784304 19:45358499-45358521 AGGTGACATGGCTGGACTCAGGG - Intronic
1166965395 19:46526837-46526859 TGGGGGTGGGGGTGGGCTCAAGG - Intronic
1167006135 19:46777629-46777651 AGGTGGTGTGGGTGGGCTCTGGG - Intronic
1167249968 19:48394452-48394474 AGGGGGGGTGGGGGGGCTGAGGG + Intergenic
1167269535 19:48499349-48499371 AGGGGGCCTGGGGGGCCTGAGGG + Exonic
1167646149 19:50706167-50706189 GGGGGGGTTGGGGGGGCTCAAGG + Intronic
1167946732 19:52994104-52994126 AGGGGGCGTGGGAGGGCGCGGGG + Intergenic
1202689890 1_KI270712v1_random:79044-79066 TTGGGATATGGGTGGGCTCAGGG + Intergenic
925894036 2:8457436-8457458 AGGGGGCGGGGGTGGGTGCAGGG + Intergenic
926226677 2:10971777-10971799 CTGGGGCATGGGGGAGCTCAGGG + Intergenic
927707570 2:25306294-25306316 AGGGGGCTTTGGAGGGCTCTGGG - Intronic
929427171 2:41855188-41855210 AGGGGGCCTGGCTTGGGTCAGGG - Intergenic
929522135 2:42663272-42663294 AGAGGGCCTGTGTGGGCTCTTGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932466773 2:71929144-71929166 TGGGGGCTTGTGTGGGGTCACGG - Intergenic
933956529 2:87376978-87377000 TTGGGATATGGGTGGGCTCAGGG - Intergenic
934240673 2:90269005-90269027 TTGGGATATGGGTGGGCTCAGGG - Intergenic
934272519 2:91547754-91547776 TTGGGATATGGGTGGGCTCAGGG + Intergenic
934729281 2:96646502-96646524 AGGGGGCAAGGGTGGGGTCCAGG + Intergenic
934856227 2:97732065-97732087 AGGGGGGATGTGTGTACTCAGGG + Intronic
935277333 2:101486234-101486256 AGTGGGTATGGGAGGGCACAGGG - Intergenic
935332288 2:101985908-101985930 CGGGGGGGTGGGTAGGCTCAGGG + Intergenic
936148562 2:109997665-109997687 TTGGGCTATGGGTGGGCTCAGGG + Intergenic
936196116 2:110373703-110373725 TTGGGCTATGGGTGGGCTCAGGG - Intergenic
936501121 2:113067153-113067175 AGGGTGGATGGATGGGCACATGG + Intergenic
937090186 2:119201081-119201103 ATGGAGCCTGGGTGGGCTCAGGG + Intergenic
937257520 2:120565529-120565551 GGGGGGCAGGGGAGGGGTCAGGG + Intergenic
937426262 2:121801574-121801596 ATGGGGCCTGGGTGGGCATAGGG - Intergenic
938383101 2:130847684-130847706 AGGGGACCTGGGTGGACCCAGGG - Intronic
938897505 2:135766992-135767014 AGGGGGCGGGGGTGGGCAGATGG - Intronic
939892836 2:147757919-147757941 AGTGGGGATGGGCGGGATCAAGG - Intergenic
940878467 2:158922162-158922184 AGGGGGCATGGGCCGGAGCAGGG - Intergenic
941309718 2:163913524-163913546 AGAGGGCAACGGTGGGCTGAAGG - Intergenic
942385303 2:175436538-175436560 ATGGTGCATGGGTGGGTCCAAGG - Intergenic
945177018 2:207053143-207053165 AGGGGGCTTGGGTATGGTCAGGG + Intergenic
946293389 2:218763503-218763525 AGGGGGCATGAGGGGGCTCTGGG - Intergenic
946923635 2:224604150-224604172 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
947660419 2:231862329-231862351 AGTGGGCATGGGTAGGGACAGGG - Intergenic
947840156 2:233202534-233202556 GGGGAGCAGGTGTGGGCTCAGGG - Intronic
948223521 2:236291434-236291456 AGGGGGCAGGGGTGGGACCAGGG + Intergenic
948481235 2:238251835-238251857 GGGGGGCATGAGTGGGGTGAGGG + Intronic
948523814 2:238558477-238558499 AGGCGGCAGGTGTGGGCTCAGGG - Intergenic
948584212 2:239008942-239008964 AGTAGGCATGGAAGGGCTCACGG - Intergenic
948613010 2:239181388-239181410 AGGAGGCCTGGGTGGGCCGAGGG + Intronic
948675370 2:239593704-239593726 TGGGGCCATGGATGGGCACACGG + Intergenic
949047492 2:241878556-241878578 AGGGCTCAGGTGTGGGCTCAGGG - Intergenic
1169978075 20:11353183-11353205 AGGGGGCATGGCTGGCCAAAGGG - Intergenic
1170118561 20:12887532-12887554 AGTGATCAAGGGTGGGCTCAGGG + Intergenic
1170419007 20:16173874-16173896 AGGGAGCAGGGGTGTGCTGAGGG + Intergenic
1171123063 20:22582254-22582276 AGGGGGCCTGGGAGAGCTGAAGG - Exonic
1172101655 20:32487395-32487417 TGGGGGCCAGGGTGGGCTCTGGG + Intronic
1173121186 20:40290957-40290979 TGGGGGTAGGGGTGGGATCAGGG - Intergenic
1173453535 20:43186334-43186356 GGGGGGCGAGGGTGGGCGCAGGG - Intronic
1173823867 20:46035167-46035189 AGGAGGGATGGGGAGGCTCAAGG - Intronic
1174308517 20:49632219-49632241 AGGGGGCAGGGGGGCGCACAGGG - Intergenic
1174682432 20:52421702-52421724 AGGGGGCAGGGCTGGATTCAGGG - Intergenic
1175823273 20:61923379-61923401 AGTGGGCATGGGGGGACACATGG - Intronic
1176026101 20:62986389-62986411 AGGGGGCATAGGTGGGCAGAGGG + Intergenic
1180063736 21:45402663-45402685 AGGGACCAGGGGAGGGCTCATGG - Intergenic
1180551528 22:16545519-16545541 TTGGGATATGGGTGGGCTCAGGG - Intergenic
1180872365 22:19153616-19153638 ATGGGGCTTGACTGGGCTCAGGG - Intergenic
1180967407 22:19797834-19797856 AGGGGCCATGAGAGGGGTCAGGG - Intronic
1181352473 22:22268404-22268426 TTGGGATATGGGTGGGCTCAGGG + Intergenic
1181461742 22:23089772-23089794 AGGGTTCCTGAGTGGGCTCAGGG + Intronic
1181557535 22:23680123-23680145 AGGTCACATGGGTGGGCACAGGG + Intergenic
1182941779 22:34283827-34283849 AGGAAGCATTGGTGGGATCAGGG + Intergenic
1183265275 22:36821060-36821082 CGTGGGCATGGCTGAGCTCAGGG + Intergenic
1183352982 22:37344057-37344079 AGGGGGCATGGGTGGGGGCATGG - Intergenic
1183353021 22:37344152-37344174 ACGGGGCATGGGTGGGGGCATGG - Intergenic
1183402022 22:37610078-37610100 TGGGGGGATGGGTGGGCCCCTGG + Intronic
1183530600 22:38351366-38351388 ATGGGACCTGGGTGGGCTGAAGG + Intronic
1183605843 22:38866397-38866419 AGGAGGCACCGGCGGGCTCAGGG + Exonic
1184073392 22:42161102-42161124 AGGGGGGAGGGGTGGGATGATGG - Exonic
1184777833 22:46632166-46632188 AGGGGCCCTGGGTGGGCTTGAGG + Intronic
1184778237 22:46633793-46633815 AGGTGGGCTGGGTGGGCTCCGGG + Intronic
950520850 3:13496865-13496887 GGGGGGCATGGCTGGGCTGGGGG + Intronic
953008148 3:38997033-38997055 AGGGGGCAAGGGTGGAAGCAGGG - Intergenic
953559190 3:43971654-43971676 GTGGGGCCTGGCTGGGCTCAGGG + Intergenic
954216021 3:49124974-49124996 TGGGGGCAGGCGTGGGATCAGGG - Intronic
954459562 3:50618467-50618489 AGGTGGCATGGTGGGGGTCAGGG + Intronic
954582047 3:51708202-51708224 AGGTGGAATGGCTGGCCTCAGGG - Intronic
954675011 3:52310914-52310936 AGGGGCGATGGGTGGGAACAGGG + Intergenic
954681096 3:52346370-52346392 AGGGTGCTTGGGGCGGCTCAGGG - Intronic
954692242 3:52401803-52401825 TGGGGGCCTGGGTGGGCCCTGGG - Exonic
954798430 3:53173285-53173307 AGTGGGCAAGGCTGGCCTCAAGG - Intronic
956210400 3:66795933-66795955 GGGGGGCTGGGGTGGGGTCAGGG + Intergenic
956744301 3:72299408-72299430 AGGGGCAGTAGGTGGGCTCAAGG - Intergenic
957477857 3:80750170-80750192 ATGGGGCAGGGGTGGAATCAGGG + Intergenic
958191136 3:90186253-90186275 AAGGTGCATGGTTTGGCTCAAGG + Intergenic
958413333 3:93845370-93845392 AAGGTGCATGGTTTGGCTCAAGG + Intergenic
959908788 3:111739682-111739704 AGGGTGCCTGGGGTGGCTCAGGG - Intronic
962381380 3:134900756-134900778 AGGGGGCATGGGTGTGTACATGG + Intronic
964088175 3:152843577-152843599 AAGTGGCAGAGGTGGGCTCAAGG - Intergenic
967289443 3:187904824-187904846 AGGGGGAATAGATAGGCTCAAGG - Intergenic
967989573 3:195121066-195121088 TGGGAGCATGGGGGTGCTCACGG - Intronic
968569847 4:1333799-1333821 TGGGTGCAGGGGTGGGCACATGG - Intronic
968569898 4:1333940-1333962 TGGGTGCAGGGGTGGGCACATGG - Intronic
968702102 4:2062101-2062123 AGGGGGCTCCGGTGGGCACACGG + Intronic
968799251 4:2731551-2731573 AGGAGGAATGGGTGGGCGGAAGG - Intronic
968899848 4:3425987-3426009 AGGGGGCAGGGGTTGGCATAGGG + Intronic
968985988 4:3874665-3874687 CGGGGCCATGGGTGGGATCCTGG - Intergenic
969712823 4:8853996-8854018 CAGGGCCATGGGTCGGCTCAGGG - Intronic
969869027 4:10093425-10093447 GCGGGGGATGGGTGGGCTGAAGG - Intronic
969926572 4:10591304-10591326 AGAGGGCATTGGTGGCCACATGG - Intronic
972351159 4:38237040-38237062 GTGGGGCATGGGTGGGGCCAGGG + Intergenic
973872054 4:55176406-55176428 AGGGTGGATGGGTGGGTTGATGG + Intergenic
976310551 4:83607527-83607549 AGGGGGCAAGGCTGGGATCTGGG + Intergenic
979899783 4:126201738-126201760 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
982048288 4:151471762-151471784 AGGGGGAATGGGTGGGAAGAGGG - Intronic
982070878 4:151693317-151693339 CGGTGGCTTGGGTGGGTTCACGG + Intronic
983534168 4:168839587-168839609 AGGGGGGATGGGAGGGGTAAGGG + Intronic
983779519 4:171650934-171650956 GGGCGGCATGCTTGGGCTCAGGG - Intergenic
984325203 4:178242085-178242107 GGTGGCCATGGGTGGGCCCAGGG - Intergenic
984783927 4:183551501-183551523 AGGGGGCAGGAGAGAGCTCAGGG + Intergenic
984822118 4:183891057-183891079 GGGGTGCAGTGGTGGGCTCATGG - Intronic
985537228 5:472350-472372 AGGGGGCATGGAGGGGCCCAGGG - Intronic
985691735 5:1316709-1316731 AAGGGGCCTGGGGGGGCACACGG - Intergenic
986161357 5:5232409-5232431 AGTGGCCATGGGTGGGCTTGGGG - Exonic
986604603 5:9509065-9509087 AGAGGGTATGGGTGGGTACAAGG + Intronic
988245970 5:28682131-28682153 AGGGGTCATGTATGGGTTCAAGG - Intergenic
988668349 5:33354481-33354503 AGTGGACATGAGTGGGATCAAGG + Intergenic
988675484 5:33428546-33428568 AGGGGTCATGGGAAGGCTGAGGG + Intergenic
989533818 5:42540666-42540688 AGAGGGGATGGGTGGGGACAGGG - Intronic
990482914 5:56229049-56229071 TGGGGGGATGGGTAGCCTCAGGG - Intronic
990874928 5:60473849-60473871 CGGGGGCTGGGGTGGGGTCAGGG - Intronic
991405074 5:66293655-66293677 GGGGGGCATGGATGGGGGCAGGG - Intergenic
992732771 5:79689666-79689688 CGGGGGCGGGGGAGGGCTCAGGG + Intergenic
993359266 5:86953705-86953727 AGGAGGCATGGGAGGGATCAAGG + Intergenic
997413825 5:133710057-133710079 CGCTGGCATGGATGGGCTCAGGG + Intergenic
997424026 5:133790887-133790909 CTGGGGCAAGGGTGGACTCAGGG - Intergenic
997675420 5:135709174-135709196 AGGGAGCTGGTGTGGGCTCAGGG - Intergenic
998649741 5:144104982-144105004 AGGGGGCCAGGGTGGGCTTTTGG - Intergenic
998848572 5:146334054-146334076 AGGGGGAAGGGGAGGGCTCCTGG + Intronic
1001645511 5:173278813-173278835 AGGGGGCCTGGGTGGACGCTGGG + Intergenic
1001938849 5:175727065-175727087 AGGGGGCCGGGGTTGGCTCCAGG - Intergenic
1002432770 5:179212764-179212786 AGTGGGCAGGTGTGGGCTGAGGG + Intronic
1002508732 5:179698910-179698932 AGGGGCCAGGGGCGGGCACAGGG + Exonic
1002834356 6:853433-853455 AGGGGGCCTGAGTGGGCTCCAGG - Intergenic
1003315914 6:5011606-5011628 GGGGGGCATGGATGTGCACACGG + Intergenic
1003404892 6:5820341-5820363 AGGTGGCCTGGCTGGGCCCAGGG - Intergenic
1003445209 6:6177826-6177848 AAGGGGCATGGGAGGCCTCTCGG + Intronic
1003770224 6:9290883-9290905 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
1004235605 6:13872369-13872391 AGGGTGCAGTGGTGGGCTGAAGG + Intergenic
1005298318 6:24447844-24447866 AGGGGGAATGGGTGAGACCATGG - Intronic
1005811107 6:29517282-29517304 AGGGGGCATTTTTGGGCCCATGG + Intergenic
1006283977 6:33079078-33079100 ATGGGGTAGGGCTGGGCTCAAGG - Intronic
1006780875 6:36631541-36631563 GAGGGGCATGGGTGGGCAGATGG + Intergenic
1007232594 6:40358782-40358804 AGGAGGCCTGGGTGGGGTGATGG + Intergenic
1008130807 6:47718836-47718858 AGGGGGTATGGGTGGGGTTGCGG + Intronic
1011675379 6:89728111-89728133 TGGGGGCATGTTTGGGCTCCTGG - Intronic
1017644099 6:156523070-156523092 AGGGGGCAATGGTGGGGACAAGG + Intergenic
1017712190 6:157180920-157180942 GTGGGGCATGGGTGGGCAGAGGG - Intronic
1018191012 6:161308978-161309000 CTGGGCCATGGGTGGGCACAAGG - Intergenic
1019290328 7:247147-247169 AGGGGGCCTGGGAGGCCCCACGG + Intronic
1019328810 7:452795-452817 ATGGGGCCTGAGTGGCCTCAGGG - Intergenic
1019550155 7:1598184-1598206 AGGGAGCAGGGGCTGGCTCAGGG - Intergenic
1020005737 7:4783076-4783098 AGGGGGCCTGGGTGAGGGCACGG - Intronic
1020034995 7:4959238-4959260 CGGGGGCACGGGGGGGCTCCCGG + Intergenic
1020245256 7:6424443-6424465 GTGGGGCCTGGCTGGGCTCAGGG + Intronic
1021509483 7:21420144-21420166 CAGGGGCATGGGTGGGGTTATGG + Intergenic
1022178477 7:27895251-27895273 GGGGGTGATGGGTGGGGTCACGG + Exonic
1022656847 7:32327388-32327410 AGGCGGCATGAGAGGGCTCCTGG - Intergenic
1026812813 7:73482936-73482958 AGCCGGCATGGCTGGACTCAGGG + Intronic
1028948969 7:96612399-96612421 TGGTGGCAAGGGTGGGATCAAGG - Intronic
1029162650 7:98563553-98563575 AGGGGACATGGGAGGGTACAAGG + Intergenic
1029344198 7:99966778-99966800 ATGGGGTGGGGGTGGGCTCAAGG + Exonic
1029707287 7:102282641-102282663 AGGGGCCATGGGTGGGCTGCAGG + Intronic
1032090991 7:128911483-128911505 AGGGGGCAGGGCTGGGCCCTGGG + Intergenic
1033681902 7:143603193-143603215 AGGGGCCATGGGTGGTCTTCTGG - Intergenic
1033702987 7:143858720-143858742 AGGGGCCATGGGTGGTCTTCTGG + Intronic
1034776471 7:153831831-153831853 AGGGGGCTGAGGTGGGCTCTAGG + Intergenic
1035205077 7:157289809-157289831 AGGGGGCATGGGGGCACCCAGGG + Intergenic
1035264042 7:157679914-157679936 GGGGGGCACTGGTGGCCTCAGGG - Intronic
1035394693 7:158527284-158527306 GGGGGGCATGGCCGGGGTCAGGG - Intronic
1036591748 8:10174594-10174616 TGGGGGCCTGGATGAGCTCAGGG - Intronic
1036688066 8:10924856-10924878 AGAGAGCATGGGTGGGTGCAGGG + Intronic
1037763679 8:21758512-21758534 AGGGACCCAGGGTGGGCTCAGGG - Intronic
1039379024 8:37067570-37067592 TTGGGGCTTGGGAGGGCTCATGG + Intergenic
1039769915 8:40674903-40674925 TGGGGGCTTAAGTGGGCTCAGGG + Exonic
1039984374 8:42435631-42435653 AGGTGGGGTGGGTGGGGTCAAGG + Intronic
1040286546 8:46103433-46103455 AGGTGGCACGGGTGGGCCAAAGG - Intergenic
1040289445 8:46116823-46116845 AGGTGGCATGGGCGGGCCCTTGG - Intergenic
1040307430 8:46219450-46219472 AGGTGGCATGGGAGGGCTGAAGG - Intergenic
1040313919 8:46250992-46251014 GGGTGGCATGGGTGGGCTGCAGG + Intergenic
1040333537 8:46404558-46404580 AAGGGGCATGGGTGGGCCTCAGG + Intergenic
1041526821 8:58815631-58815653 AGTGGGCCTGGCTGGGCCCATGG + Exonic
1043982244 8:86656801-86656823 AGGAGGCAAGGATGGGGTCATGG - Intronic
1044693412 8:94900249-94900271 AGGGGGCAGAGGTGTGCTCTCGG + Intronic
1045391643 8:101721015-101721037 AGGGGGCATGGGTGCTCTCAGGG + Intronic
1046654694 8:116880446-116880468 AGGGGCCAGGAGTGGGCCCAGGG + Intergenic
1047285390 8:123483450-123483472 AGGAACCATGGGAGGGCTCAAGG - Intergenic
1049193490 8:141302405-141302427 TGGGGGCAGGGGTGGGGTCGGGG - Intronic
1049211556 8:141388979-141389001 GGAGGGCATGGGTGGGCTAATGG - Intergenic
1049259208 8:141629718-141629740 AGGGGGCTGAGGTGGGCTGATGG + Intergenic
1049434456 8:142579984-142580006 AGGGGGCCAGGGTGGGCACCAGG - Intergenic
1049564568 8:143331521-143331543 GGGGGGCATGGGCGGGTACACGG - Intronic
1049692618 8:143969299-143969321 AGGGAGAATGGGGGGGCTGAGGG - Intronic
1049693013 8:143970998-143971020 AGGGAGAATGGGGGGGCTGAGGG + Intronic
1051593847 9:18803767-18803789 AGGGGGTATTGGTAGCCTCAAGG - Intronic
1056684208 9:88746328-88746350 AGGGTGGATGGGTGGGTGCATGG - Intergenic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1057251850 9:93509328-93509350 AGGGAGCATGGATGGCCTCGGGG + Intronic
1057834621 9:98434372-98434394 AGGGAACATGGTGGGGCTCAGGG + Intronic
1057961884 9:99464934-99464956 AGGGGGCAAGGCTGGGGGCAGGG + Intergenic
1059641265 9:116219187-116219209 AGACGGCATGGGTGGGTGCAGGG - Intronic
1060252223 9:121995510-121995532 AAGGGTCATGGGTGAGCTCACGG + Intronic
1060258538 9:122053641-122053663 AGGGAGCATGGGTGGGGACTGGG + Intronic
1060529854 9:124341727-124341749 AGGGTGTGTGGGTGGGCTCGGGG + Intronic
1060729343 9:126027378-126027400 TGGGGGCACGAGTGGGGTCAGGG + Intergenic
1061060910 9:128250284-128250306 CGGGGGCATGGGCGTGCTGACGG - Exonic
1061159118 9:128882947-128882969 AAGGGGCATAGCTGGGGTCATGG + Intronic
1061196233 9:129108582-129108604 ATGGGGCAGGGGTGGGGTGAGGG + Intronic
1061410941 9:130421360-130421382 AAGGGGCATGGGTGGGTGAAGGG + Intronic
1061570907 9:131476919-131476941 AGGGGGCATCGCTGGCCTCGTGG + Intronic
1061853504 9:133429282-133429304 AGGACGCAGGGGTGGGCGCAGGG - Intronic
1062000903 9:134215225-134215247 GGAGGGGATGGCTGGGCTCAGGG - Intergenic
1062265549 9:135685156-135685178 TGGGGGGAGGGGAGGGCTCAGGG - Intergenic
1062453847 9:136626649-136626671 CGGGGGCAGGGGTGGGGGCAGGG + Intergenic
1062453860 9:136626672-136626694 CGGGGGCAGGGGTGGGGGCAGGG + Intergenic
1062502601 9:136857812-136857834 AGGGGGCCCCAGTGGGCTCAGGG + Intronic
1062569774 9:137179708-137179730 AGGGGGCAGGGCTGGGGTCCTGG + Intronic
1062708238 9:137957068-137957090 AGAGACCATGGGAGGGCTCATGG + Intronic
1186514968 X:10160151-10160173 AGGGGGCAAGGGAGCCCTCAGGG - Intronic
1186831715 X:13396917-13396939 TGGGGGCATGGGGAGGCCCATGG - Intergenic
1187038074 X:15563717-15563739 AGCAGGTATGGGTGGGCTCAGGG - Intronic
1191207821 X:57853102-57853124 GGGGGGCATTGGTGTGCACAGGG + Intergenic
1194201567 X:90958475-90958497 AGGGGGCATGGGGGCTCCCAGGG - Intergenic
1195864021 X:109410000-109410022 AGGGGGCAGGGCTGGGGTGAGGG - Intronic
1196775433 X:119333508-119333530 ACAGGGCAGTGGTGGGCTCAAGG - Intergenic
1197046758 X:122006849-122006871 AGTGTACATGGGTGGGCTTAAGG - Intergenic
1197334703 X:125198862-125198884 AGTGGGCAGGGGTGGGGGCAGGG + Intergenic
1199983450 X:152933834-152933856 AGGGGCCCTGGGTGTGCTGAGGG - Intronic
1200065614 X:153502942-153502964 AGGGCGCATGGGTGGCTTCTAGG + Intronic