ID: 1113778709

View in Genome Browser
Species Human (GRCh38)
Location 13:112963539-112963561
Sequence CTGGAGACACAGGTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113778709_1113778716 14 Left 1113778709 13:112963539-112963561 CCTCCCTGCACCTGTGTCTCCAG 0: 1
1: 0
2: 9
3: 52
4: 520
Right 1113778716 13:112963576-112963598 TGCTGCTCCATAGCCTGTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113778709 Original CRISPR CTGGAGACACAGGTGCAGGG AGG (reversed) Intronic
900081583 1:862574-862596 CTGCAGACCCAGGTCTAGGGAGG - Intergenic
900143112 1:1146755-1146777 CTGGCTGCACTGGTGCAGGGTGG + Intergenic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900704859 1:4074048-4074070 GTGAAGACAGAGGTGCTGGGTGG - Intergenic
900967259 1:5967312-5967334 CTGGAGAAGCGGGTGCAGGAGGG + Exonic
900990865 1:6097640-6097662 CTGCAGACTCAGGTTCAAGGGGG + Intronic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
901681696 1:10916508-10916530 CTGGTGACAGAGGAGCAGGGTGG - Intergenic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903848122 1:26290544-26290566 CTGGAGGCAGAAGTGCAGGTGGG + Intronic
904030492 1:27530553-27530575 CAGGAGACTCAAGTGCAGAGAGG - Intergenic
904373794 1:30066800-30066822 CTGGAGGCCCAAGGGCAGGGAGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905019234 1:34796966-34796988 ATGCTGACACAGGGGCAGGGTGG - Intronic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905624754 1:39481462-39481484 CCTGAGACACATGTCCAGGGTGG + Intronic
905794965 1:40810599-40810621 CTGGAGGGACAGCTGCTGGGAGG - Intronic
905891153 1:41519185-41519207 GTGCAGACACAGGACCAGGGTGG + Intronic
906032922 1:42734878-42734900 GAGGAGACAGAGGTCCAGGGTGG - Exonic
906126924 1:43432531-43432553 CTGGGGACCCAGGTGCTTGGGGG - Exonic
906376275 1:45299358-45299380 CTGGAGGGACAAGTGCTGGGTGG - Intronic
906657361 1:47558433-47558455 GTGGAGACACAGGTGTAGACAGG + Intergenic
907416980 1:54321258-54321280 CTGCAGGCACTGGTGCAGCGTGG + Intronic
909396306 1:75174415-75174437 CTGGAATTACAGGTGTAGGGAGG - Intergenic
910071094 1:83214127-83214149 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911178893 1:94843688-94843710 CCTGAGATGCAGGTGCAGGGAGG + Intronic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
912511939 1:110195540-110195562 TTGGGGGCAAAGGTGCAGGGTGG - Intronic
912755419 1:112321197-112321219 CTGGTTACCCAGGTCCAGGGTGG - Intergenic
913237356 1:116796493-116796515 CTGGAGACACAGGGACATGGAGG - Intergenic
913366799 1:118048012-118048034 CTGCAGAGTCAGGTGCAGGCTGG + Intronic
914897808 1:151692483-151692505 CTGGAGTCACAGGCACAGTGGGG - Exonic
915496175 1:156284283-156284305 TTTGAGACACAGGTAAAGGGAGG + Exonic
915605263 1:156946427-156946449 CAGGACACACAGGTGCTGGTGGG + Intronic
915703837 1:157824373-157824395 ATGAAGCCACAGGTGCAGGCTGG + Intergenic
915933429 1:160075141-160075163 CTGGAGAGAAAGGTGAAGGATGG - Intergenic
916581422 1:166112849-166112871 GTGGAAACCCAGGTGCAGAGAGG + Intronic
916677221 1:167074231-167074253 CTGGAGTCACAGGTGCACCCAGG - Intronic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
917598310 1:176551912-176551934 TTGGAGGCAGAGATGCAGGGAGG + Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920230877 1:204468928-204468950 CGGGAGGCATAGGTGCGGGGGGG + Exonic
920981203 1:210837268-210837290 CTGGGAACACAGGGGAAGGGTGG - Intronic
921319795 1:213927644-213927666 CAGGAGATACAGGCTCAGGGAGG - Intergenic
921800686 1:219399285-219399307 GTGGTGACTCAGGTCCAGGGAGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
923036274 1:230287203-230287225 ATGGTGACACAGGTGGTGGGTGG - Intergenic
923782050 1:237033364-237033386 CTGAAGGCAGATGTGCAGGGTGG - Intergenic
924212549 1:241785844-241785866 CTGTAGACAGAAGTTCAGGGAGG + Intronic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063745694 10:8878020-8878042 CTAGAGAGACTGGTGCAGGATGG + Intergenic
1063749568 10:8927426-8927448 CTGGAGAGACAGGGTCAAGGTGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064056005 10:12097979-12098001 CTGAAGACACATGTTCAGGTGGG + Exonic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1064537647 10:16374209-16374231 CTGCAGGGAGAGGTGCAGGGAGG + Intergenic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1067210682 10:44258318-44258340 CTGCAGCCACAGGTGCCAGGAGG + Intergenic
1067224489 10:44366780-44366802 TTGGAGGTGCAGGTGCAGGGTGG + Intergenic
1067400116 10:45965032-45965054 CCAGACACACAGCTGCAGGGAGG - Intergenic
1067868446 10:49934324-49934346 CCAGACACACAGCTGCAGGGAGG - Intronic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068324110 10:55461278-55461300 TTGTAGACAGTGGTGCAGGGAGG - Intronic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069806161 10:71126389-71126411 ATGGAGGCTGAGGTGCAGGGTGG + Intergenic
1069917553 10:71796851-71796873 GTGGACACAGAGGTGCAGAGAGG + Intronic
1069958960 10:72068450-72068472 CTGCAGACTGAGGTGCACGGTGG + Intronic
1070329501 10:75407600-75407622 CTCCAGACACAGGCGCAGGAGGG - Intergenic
1070801310 10:79245966-79245988 CTTAAGACAGAGGTGCAGTGAGG + Intronic
1072568029 10:96634236-96634258 ATGGGGGCAAAGGTGCAGGGAGG + Intronic
1073514953 10:104068012-104068034 GGGGAGACAAAGGTGCAGGTGGG + Intronic
1073599620 10:104834083-104834105 CTGGGGAGACAGGTGAAGAGGGG - Intronic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076402974 10:130195365-130195387 CCGGAAACCCAGGTGCAGGCAGG + Intergenic
1076462728 10:130657328-130657350 CAGGGGACACAGGGGCTGGGGGG + Intergenic
1076594211 10:131615772-131615794 ATAGAGGCACAGGTGCATGGAGG + Intergenic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1077501464 11:2911464-2911486 CTGGAGAGACAGGCCCTGGGTGG - Intronic
1078128698 11:8594049-8594071 CTGGAGTCACTGGCTCAGGGCGG - Intronic
1078604010 11:12758925-12758947 CTGGAGCTACAGGTGCTGTGTGG + Intronic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1079082141 11:17421077-17421099 GTGCAGACAGAGCTGCAGGGTGG - Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081654549 11:44848855-44848877 CTGAAGAGACAGGGCCAGGGGGG - Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083756769 11:64796224-64796246 CGGGAGGCAGAGGGGCAGGGAGG - Intronic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1083840018 11:65299086-65299108 CTGGTGACACAGCTGAAGTGGGG - Intronic
1083894767 11:65614266-65614288 CGGGAGGCAGAGGTGGAGGGTGG + Intronic
1083940056 11:65890889-65890911 CTGGCGGCACTGGTGCAGCGCGG + Exonic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1085389514 11:76175402-76175424 GAGGAGACAGAGGTGCAGAGGGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085687657 11:78638841-78638863 GTGGAGGGACAGGTGCAGGTGGG + Intergenic
1085725661 11:78952473-78952495 AGGGAGAGACAGGGGCAGGGAGG + Intronic
1085741344 11:79080581-79080603 CAGGAGAAAGGGGTGCAGGGGGG - Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086163471 11:83749574-83749596 CTGGAAATACAGCTGCTGGGTGG - Intronic
1087726086 11:101719000-101719022 CAGGAGTCCCAGGTGCAGAGGGG - Intronic
1089175804 11:116547972-116547994 AGGGAGGCACAGGTGGAGGGAGG - Intergenic
1089212033 11:116810971-116810993 TTGCACACACAGGTGCAGCGTGG - Intergenic
1089654732 11:119938962-119938984 GTGGAGACACAGGCTCAGTGTGG + Intergenic
1090435772 11:126685223-126685245 CTGGGGAGTCAGGGGCAGGGCGG + Intronic
1090653428 11:128825266-128825288 CTGGAGCCACTGGTGGATGGCGG + Intergenic
1091006785 11:131960870-131960892 CTGAAGATTCAGGTGCAGGAGGG + Intronic
1091024674 11:132131572-132131594 CTGTAGACAGAGGGGCAGTGTGG + Intronic
1091079475 11:132653372-132653394 CTGGAGGCACAAGCGCAGGCAGG - Intronic
1091582781 12:1799172-1799194 CTGTGGCCACACGTGCAGGGCGG - Intronic
1091968206 12:4763629-4763651 CTGGAGAAACGGGGGCGGGGCGG - Intronic
1094026081 12:25960379-25960401 CTGCAGGGAGAGGTGCAGGGTGG + Intronic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095745008 12:45648292-45648314 TTGATGGCACAGGTGCAGGGTGG + Intergenic
1096911777 12:54991122-54991144 CTGGAGACCCTGGTGCGCGGTGG + Intergenic
1097688427 12:62712263-62712285 TTGTAGAGACAGGGGCAGGGGGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101870727 12:108563115-108563137 CTGGGGAAACAGGTTCAGAGAGG - Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102297383 12:111747626-111747648 CTGGGGTCACATGTGCAGGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1104271073 12:127282747-127282769 CTGGAGACACACAGCCAGGGAGG + Intergenic
1104517163 12:129438301-129438323 CTGAAGACACATGTGCAGAAAGG + Intronic
1104631334 12:130405431-130405453 GTGGAAACACATGTGCAAGGTGG + Intronic
1104764368 12:131316921-131316943 CAGGAGACAGAGGTGCCTGGAGG - Intergenic
1104815174 12:131641477-131641499 CAGGAGACAGAGGTGCCTGGAGG + Intergenic
1104924702 12:132308162-132308184 CTGGAGCCCCAGGAGCTGGGAGG + Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106182617 13:27381698-27381720 AGGGAGACCCAGGTGCTGGGGGG + Intergenic
1107077215 13:36335618-36335640 CTGAACACACAGGTCCTGGGTGG - Exonic
1107446297 13:40472750-40472772 CTGGAGACACACGGGCTGAGTGG + Intergenic
1112487175 13:99830469-99830491 TTGGAGACACTGGAGCAGTGTGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112733730 13:102394843-102394865 CTGGAGGCAGAGCTGCAGCGTGG + Intronic
1112814976 13:103263252-103263274 CTGGAGACAAGGGTGCTGAGTGG + Intergenic
1113085246 13:106563433-106563455 CTGCAGAAACCGGTGTAGGGTGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1114046923 14:18883402-18883424 TAGTAGACACAGGGGCAGGGCGG + Intergenic
1114117290 14:19636050-19636072 TAGTAGACACAGGGGCAGGGCGG - Intergenic
1114858074 14:26476836-26476858 CTGTAGTCACAGCTGCTGGGAGG - Intronic
1115631680 14:35251920-35251942 GGGGAGGCACAGGTGCAGGCGGG + Intronic
1116331690 14:43604787-43604809 CTGGAGAGACTGGGGCAAGGAGG - Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1117331891 14:54720800-54720822 CTGAAGGCAGGGGTGCAGGGAGG - Intronic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1119424390 14:74526476-74526498 CTGGAGCCACAGGGCCAGAGTGG + Intronic
1120713102 14:87813569-87813591 TTGAAGAAACAGGTGCAGAGAGG - Intergenic
1121485618 14:94312365-94312387 CAGTAAACCCAGGTGCAGGGAGG - Intronic
1121494953 14:94385743-94385765 GTGGAGAGGCTGGTGCAGGGAGG + Intronic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122622642 14:103068564-103068586 CTGAAGACACAGGGCAAGGGTGG + Intergenic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1124632151 15:31344149-31344171 CTGGAGTGACAGGCTCAGGGTGG - Intronic
1124645457 15:31434914-31434936 CTGCAGACACAAGTGCTGGCGGG + Intronic
1125174396 15:36804352-36804374 CTAGAGACAGGGGTGCAGGCAGG - Intronic
1125921219 15:43527029-43527051 CTGGGGAGAGGGGTGCAGGGGGG - Exonic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128752906 15:70161752-70161774 CTGGAGGCAGGGGTGCAGAGGGG - Intergenic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129936115 15:79451503-79451525 CGGGAGACACAGGGGAGGGGAGG + Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130994897 15:88898206-88898228 CTGGAGACTTTGGTCCAGGGCGG - Intergenic
1131540161 15:93269025-93269047 CTCTAGACACTGGTGCAGTGTGG - Intergenic
1132279808 15:100602831-100602853 CTTGGGGCAGAGGTGCAGGGAGG - Exonic
1132294933 15:100727847-100727869 CGGGAGACTGAGGTCCAGGGAGG - Intergenic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132587916 16:714373-714395 GTGGAGACACAGGAGCTGGGAGG - Intronic
1132647131 16:1004297-1004319 TTGGAGACGCATGTGAAGGGTGG - Intergenic
1132652283 16:1026936-1026958 GAGGTGACACAGGTCCAGGGAGG + Intergenic
1132715970 16:1289963-1289985 CTGGGGACACTGGTGCTGGGGGG - Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133036172 16:3035569-3035591 CTGGAGGGCCAGGTGCTGGGCGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135240833 16:20806226-20806248 CTGAAGACCGAGGTCCAGGGAGG + Intronic
1137447084 16:48538554-48538576 CTGGGCACACAGGTCCGGGGAGG - Intergenic
1137519226 16:49177948-49177970 CTGGAGACTCTGGGGCTGGGGGG + Intergenic
1137926822 16:52547662-52547684 CGGGAGACACTCGTGCAGGTTGG - Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138390009 16:56663193-56663215 CTGATGACGAAGGTGCAGGGCGG - Intronic
1139668877 16:68478206-68478228 GTGGAGACAGAGGTGTAGTGGGG - Intergenic
1139956255 16:70694427-70694449 CTGGAGACAGAAGAGCAGGGGGG - Intronic
1141425612 16:83942628-83942650 CTGTAGAGAAAGGTGCAGAGTGG + Intronic
1141527202 16:84618756-84618778 CTGCAGCCTCAGGGGCAGGGGGG - Intergenic
1141608266 16:85167884-85167906 CTGGGGACAAAGGTGCCCGGTGG - Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141947880 16:87322888-87322910 GTGGACTCCCAGGTGCAGGGAGG - Intronic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142227640 16:88885316-88885338 CCGGGGACAGAGGTGCAGGTGGG + Intronic
1143240481 17:5439232-5439254 CTGGAGACTCCGGTGCAGCCCGG + Intronic
1144212248 17:13025561-13025583 CTGGAGAGCAAGGTGCAGAGTGG - Intergenic
1144627112 17:16849627-16849649 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1144879329 17:18423085-18423107 CTGGGGTGACAGGTACAGGGTGG - Intergenic
1145152911 17:20521302-20521324 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1145978616 17:28998412-28998434 CTGGGGACCCAGGGGTAGGGAGG + Intronic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1147050363 17:37789889-37789911 CTGGGGTGACAGGTGCAGGCAGG + Intergenic
1147236329 17:39060285-39060307 ATGGGGCCAGAGGTGCAGGGAGG - Intergenic
1147361620 17:39934203-39934225 CTGGGGAACCAAGTGCAGGGAGG + Intergenic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1147581253 17:41628312-41628334 CTGGGGTGACAGGTACAGGGTGG + Intergenic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148743134 17:49904006-49904028 CTGGAAACTCAGCTTCAGGGTGG - Intergenic
1148793760 17:50187602-50187624 CTGGAGAGACAAGGGCAGTGTGG + Intronic
1149462905 17:56847683-56847705 CTGGAAACTGAGGTGCAGGAAGG - Intronic
1150006923 17:61475693-61475715 CAGGTGTCACAGGAGCAGGGTGG + Intronic
1151341203 17:73472080-73472102 ATGGGGACCCAGGGGCAGGGGGG - Intronic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151542316 17:74770872-74770894 GTGGAGGCACAGGCTCAGGGTGG - Exonic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151822329 17:76503027-76503049 CCGGCCACATAGGTGCAGGGAGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152431737 17:80252049-80252071 CGGGAGGGACAGGAGCAGGGTGG + Intronic
1152892223 17:82889021-82889043 CTGGTGACACATGGGAAGGGAGG + Intronic
1152935802 17:83135971-83135993 CTGCAGACAGACATGCAGGGAGG - Intergenic
1153084962 18:1274762-1274784 CTGGAGACACAAGAGAAAGGGGG + Intergenic
1154024635 18:10696018-10696040 CAGGAAACACAGTTGCATGGAGG + Intronic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1154145213 18:11861284-11861306 CTGGAGACAGAGGGGCAGCAGGG - Intronic
1156229093 18:35136672-35136694 CAGGAGACAAGGCTGCAGGGTGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157418803 18:47527591-47527613 CTGGAGACACTTTTGCAGAGAGG + Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1157502680 18:48202428-48202450 CAGGAGGCACAGTCGCAGGGCGG + Intronic
1157566849 18:48684146-48684168 GTGGGGCCACAGGTGCAGGTGGG + Intronic
1157615569 18:48985558-48985580 CAGGAGAAAAAGGTGCAAGGAGG - Intergenic
1157879392 18:51305366-51305388 CTGGAGACTCAGGGGCCAGGGGG + Intergenic
1158789966 18:60767216-60767238 CTGGAGATTCAGGGGCAGAGAGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159865800 18:73703199-73703221 CTGGAAAGACAGGTGCATTGAGG - Intergenic
1160234872 18:77077988-77078010 CTGGAGAGGCCGGGGCAGGGGGG - Intronic
1160428100 18:78792170-78792192 GTGGAGACCCAACTGCAGGGTGG - Intergenic
1161137063 19:2626183-2626205 CTGGAGACACGGGGTCAGGTGGG - Intronic
1161138981 19:2636981-2637003 GTGGGGACAGAGGTGCAGGTGGG - Intronic
1161253281 19:3292948-3292970 CTGGAGACACAGATCCTGGCTGG + Intronic
1161590017 19:5125313-5125335 CAAGAGACTCAGGTTCAGGGAGG + Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162673930 19:12284341-12284363 CTGATGACGCAGGTGCAGCGCGG + Intronic
1162936491 19:13984090-13984112 CTGAGGACAGAGGGGCAGGGAGG - Intronic
1163212034 19:15848036-15848058 TTGCAGACACAGGTTCAGAGAGG - Intergenic
1163241623 19:16067284-16067306 CTGGTGACACAGGTCCCGCGTGG - Intronic
1163488152 19:17601718-17601740 CTGGAGACACAGGTCACAGGCGG - Exonic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1163787342 19:19281668-19281690 CTCAACACACAGGTGCATGGAGG - Intronic
1164399410 19:27892486-27892508 CTGGACACTGAGGGGCAGGGAGG - Intergenic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1165114006 19:33518185-33518207 CAGGAGACAGAGGTGCAAGGTGG - Intronic
1165140793 19:33698844-33698866 GTGGAAACGCAGGTGCAGAGGGG - Intronic
1166777382 19:45321478-45321500 CAGGAGACAGAGGTCCAGAGAGG - Intronic
1166871902 19:45876441-45876463 CCAGAGACCCAGGTGGAGGGAGG - Intergenic
1167168188 19:47813598-47813620 GGGGAGACAGAGGGGCAGGGTGG - Intronic
1167380340 19:49134614-49134636 GTGGAGACAGAGGTGAAGTGAGG - Intronic
1167924921 19:52813583-52813605 CTGGAGGGACAGGAGCAGGCAGG - Intronic
1168527112 19:57098097-57098119 CTGGAGCCGGAGATGCAGGGAGG - Intergenic
1168636203 19:57999340-57999362 CTGGAGCCACACGTGCAGTGTGG - Intronic
1168697050 19:58409378-58409400 CTGGAGACGCATGTGCAGAACGG + Intronic
925085076 2:1101325-1101347 GGGGAGAGGCAGGTGCAGGGAGG - Intronic
925134374 2:1516140-1516162 ATGAAGACACAGGTCCAGGTGGG + Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925192770 2:1898848-1898870 CTGGAGACAGAGGGCCAGGGAGG + Intronic
925205673 2:2003635-2003657 CTGAAGACTCAGGTACAGGAAGG - Intronic
925696077 2:6580538-6580560 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925696091 2:6580729-6580751 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925700274 2:6629720-6629742 CTGGAGAGAATGGTGCATGGAGG - Intergenic
926118062 2:10225723-10225745 CTGGCGGCCCAGGTGCAGGGAGG - Intergenic
926341008 2:11904315-11904337 GTGGAGGCCCATGTGCAGGGTGG + Intergenic
926611684 2:14953980-14954002 CTGTGGACTCAGGTTCAGGGAGG - Intergenic
926620329 2:15041426-15041448 CAAGAGAAACAGCTGCAGGGTGG + Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
927708423 2:25311093-25311115 CTGGAGTGAAAGGTGCATGGAGG + Intronic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
928367919 2:30716953-30716975 CTGGGGCCACAGGTGCTGGTAGG - Intergenic
930068363 2:47345132-47345154 CTGGAGACAAAGGAGAGGGGAGG + Intergenic
930192826 2:48478020-48478042 CTGGAGACAGAGATACAAGGGGG + Intronic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
932621176 2:73265632-73265654 CTGGAGGCCCTGGGGCAGGGTGG + Exonic
933977533 2:87523435-87523457 TGGAAGTCACAGGTGCAGGGAGG + Intergenic
934579585 2:95427592-95427614 CTGGAGACCCAGCCGCTGGGAGG + Intergenic
934599859 2:95649133-95649155 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
935951381 2:108332377-108332399 CTGCAGACATAGGTGAAGGCTGG - Intergenic
935979541 2:108613459-108613481 CTGGACACAGAGGGCCAGGGAGG - Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936533204 2:113291137-113291159 CTGGAGACCCAGCCGCTGGGAGG - Intergenic
938592377 2:132751911-132751933 CTGGACACACTGGTTCAAGGGGG + Intronic
940756925 2:157693998-157694020 ATGGAGTCACATTTGCAGGGTGG + Intergenic
942486686 2:176447015-176447037 TTGAAGCCACAGGTGCAGGAGGG + Intergenic
942853621 2:180520431-180520453 CTGGGGAGAAAGGTGCAGAGTGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944298238 2:198092036-198092058 CTGGAGATGCAGGTGCAGTTGGG - Intronic
946373461 2:219294595-219294617 CTGGAGACAGCGGGGCAGGAGGG + Intronic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
948029408 2:234804797-234804819 CAGGAAACAGAGGTGCAGGAGGG + Intergenic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948123847 2:235550527-235550549 CTGGAGTCGCAGGTGTGGGGTGG - Intronic
948258372 2:236584679-236584701 CTGGAGCCCCAGGCACAGGGTGG + Intergenic
948465541 2:238150077-238150099 GCGGTGAGACAGGTGCAGGGTGG + Intronic
948469105 2:238166014-238166036 CTGAAGGGACTGGTGCAGGGAGG + Intronic
948528496 2:238588158-238588180 GTGAAGACAGAGGCGCAGGGTGG - Intergenic
948555294 2:238805994-238806016 CTGGAGTCACAGGTGCTCCGGGG + Intergenic
948567716 2:238897314-238897336 TGGGGGACACAGGGGCAGGGGGG - Intronic
948657615 2:239486483-239486505 CTGGACCCACAGGTGCAGAGTGG - Intergenic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
1168835266 20:873405-873427 CTGGAAAGACAGGTTCAGTGAGG - Intronic
1168845182 20:939781-939803 CTAGAGACGCAGGTGCAGAGAGG - Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1171355923 20:24545297-24545319 CTGGTGACACCTGTGAAGGGAGG + Intronic
1172114990 20:32568464-32568486 CTGGAGTCTGAGGTCCAGGGAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172175788 20:32971073-32971095 AGGGAGACAGAGGTTCAGGGAGG - Intergenic
1172390163 20:34560336-34560358 CTGGAGGCACAGGGCCAGGCAGG - Exonic
1172861122 20:38053005-38053027 CTGGAGACACAGGGACAAGTTGG + Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173176573 20:40769319-40769341 ATAGAGACCCAGGTGCAGTGTGG - Intergenic
1173561073 20:44006182-44006204 ATAGAGACTCAGGTCCAGGGAGG - Intronic
1173872319 20:46349906-46349928 CTGGAGACGTGGGGGCAGGGAGG - Exonic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174452907 20:50630797-50630819 CTGGGGACACAGGGGCCGTGGGG - Exonic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1175794252 20:61761658-61761680 TTGGGGACAGAGGTGCTGGGTGG + Intronic
1175823122 20:61922718-61922740 TGAGACACACAGGTGCAGGGAGG - Intronic
1175949304 20:62574698-62574720 GTGGAGGCAACGGTGCAGGGTGG - Intergenic
1176079407 20:63264506-63264528 CTGGAGACACAGGGACAGCTAGG - Intronic
1176650649 21:9543903-9543925 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1178442719 21:32612031-32612053 ATGGAGAAAGAGGGGCAGGGTGG - Intronic
1178620162 21:34167289-34167311 TTGGAGACACAAGAGCTGGGGGG - Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179403970 21:41110322-41110344 AGGGAGACACACGTGCTGGGAGG - Intergenic
1179907742 21:44433019-44433041 CTGAAGACTCAGGTGTGGGGTGG + Intronic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180055468 21:45356810-45356832 TGGGAGAGACAGGAGCAGGGAGG - Intergenic
1180100282 21:45580778-45580800 CTGCGGTCACAGCTGCAGGGCGG - Intergenic
1180421076 22:12815506-12815528 CTAGAGACACAGGAGCGGGTAGG - Intergenic
1180465458 22:15606041-15606063 TAGTAGACACAGGGGCAGGGCGG + Intergenic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181349491 22:22244923-22244945 CTGGTGACACAGATGCATGTGGG - Intronic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1181523251 22:23461064-23461086 ATGGAGGCACAGGGGCTGGGGGG + Intergenic
1181919966 22:26312897-26312919 CAGGAGACCCAGGCTCAGGGTGG - Intronic
1181953342 22:26570681-26570703 CTCAACACCCAGGTGCAGGGAGG - Intronic
1182075763 22:27494529-27494551 CTGAAGAGAAAGGGGCAGGGTGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182318245 22:29462138-29462160 CTGCAGACCCAGGTGCAGAGTGG + Intergenic
1182395027 22:30029069-30029091 CTGGTGAAGCAGGTGCAGTGAGG + Intronic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1182900180 22:33891479-33891501 TAGGAGAGACAGGTGCAGGAAGG + Intronic
1183535471 22:38398427-38398449 CCGGAGCCACAGGTAAAGGGGGG - Intronic
1184372694 22:44092713-44092735 ATGGAGAAATAGGTGCAGAGAGG + Intronic
1184866518 22:47204611-47204633 CAGGGGACAAAGCTGCAGGGCGG - Intergenic
1184947706 22:47815875-47815897 CAGGAGACTCAGGGGCAGAGAGG + Intergenic
1185009569 22:48305608-48305630 CTGGAGAGACAGGGGCCTGGGGG + Intergenic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
949905913 3:8858339-8858361 ATGAAGCCACAGGTGCAGGCTGG - Intronic
950037674 3:9898852-9898874 CTGGAGAGACGGGAGCAGGTGGG + Intergenic
950039241 3:9909194-9909216 CTGGAGAGACGGGAGCAGGTGGG - Intronic
950157642 3:10735679-10735701 CTGGAGACAGAGACCCAGGGAGG + Intergenic
950157674 3:10735867-10735889 CTGGAGACAGAGACCCAGGGAGG - Intergenic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
950716254 3:14849751-14849773 ATGGAGAAACAGGTGCACAGAGG - Intronic
951944020 3:28114054-28114076 CTGAAAACACAGGTTCAGAGAGG - Intergenic
953733290 3:45468489-45468511 TTGTAGACCCAGGGGCAGGGAGG + Intronic
953901236 3:46845425-46845447 CTGCAGACAGACGCGCAGGGAGG - Intergenic
953976244 3:47383751-47383773 CTGGAGGCCCAGGTGCATGGAGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955029568 3:55203316-55203338 GTGGAAACAGAGGGGCAGGGTGG + Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
956479585 3:69660661-69660683 GTGGAGACAGAGGCGCAGGCGGG + Intergenic
960303242 3:116030083-116030105 CTGGTGACACATGTGTAGCGTGG + Intronic
960558822 3:119059397-119059419 CTGGGGACTCAGGGGAAGGGTGG + Intronic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
961625883 3:128263340-128263362 CTGCGGAGCCAGGTGCAGGGGGG - Intronic
962420323 3:135222753-135222775 TTGGAGACATAGGTCCAGGAGGG - Intronic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
965112313 3:164443407-164443429 CTGGAGCAACTGGGGCAGGGGGG + Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
966879494 3:184342000-184342022 CAGGGAGCACAGGTGCAGGGAGG - Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968702997 4:2065454-2065476 GGGGAGACAGAGGTGGAGGGTGG + Exonic
968810770 4:2798806-2798828 CTAGGAACACAGGTGCTGGGTGG + Intronic
968907754 4:3462542-3462564 CTGGAGCCACAGGGTCAAGGAGG + Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
968935625 4:3608677-3608699 CTGGAGGCACTGGGGCAGGGAGG + Intergenic
969109925 4:4838272-4838294 CTGGAGACACAGTTGTGAGGGGG - Intergenic
969246138 4:5934118-5934140 GAGGAGACCGAGGTGCAGGGAGG - Intronic
969571874 4:8013853-8013875 CTGCAGCCTCAGGTGCACGGAGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970692031 4:18630937-18630959 GTGGAGGGACAGGTGCAGGCAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
980694287 4:136336400-136336422 CTGGAGACCCCATTGCAGGGAGG - Intergenic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
982274968 4:153629191-153629213 GTGGTGACAGAGGGGCAGGGCGG - Intronic
982827042 4:160014877-160014899 GTGGAGTCACAGGAGCAGGTGGG + Intergenic
984850932 4:184152031-184152053 CAGCAGACACAGCTTCAGGGGGG - Intronic
985657545 5:1140011-1140033 TGGGAGACAGAGGTGCAGGCCGG - Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
985985785 5:3515198-3515220 CTGGGGACACCGGGGCAGGGGGG - Intergenic
986485214 5:8229327-8229349 CTGCAGACTAAGGTGCAGGTGGG - Intergenic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
988712760 5:33794590-33794612 ATGGAGACCGAGGTGCAGGTAGG + Intronic
988870022 5:35378994-35379016 CTGGAGAGGAAGGTGTAGGGTGG + Intergenic
990688976 5:58340801-58340823 CAGGAGATGCAGGTACAGGGAGG + Intergenic
991942513 5:71866136-71866158 CTAGAGACACAGGTCTAGGGAGG + Intergenic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
995591060 5:113699938-113699960 TGGGAGAAGCAGGTGCAGGGAGG - Intergenic
997015641 5:129931161-129931183 ATGGAGACACATGTGTAGGCCGG - Intronic
997431647 5:133845012-133845034 GTGGAGACACAGGGGGACGGCGG - Intergenic
997638012 5:135429040-135429062 CTGGAGGAGCATGTGCAGGGGGG - Intergenic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
999272711 5:150306851-150306873 CTGCAGACACAGGCTCAGTGAGG + Intronic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001746506 5:174096640-174096662 CTGGAGGCCCAGGAGCAGTGAGG + Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001936023 5:175706669-175706691 CTTGAGGCCCAGGTGCAGGTGGG + Intergenic
1002173596 5:177388815-177388837 GTAGAGACACAGGTTCAGAGAGG + Intronic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002917426 6:1540587-1540609 CTGCATACCCAGGGGCAGGGTGG - Intergenic
1004402924 6:15305331-15305353 CAGGAGAAAAGGGTGCAGGGAGG + Intronic
1004469954 6:15920327-15920349 CTGAAGAGACAGGGGCAGAGTGG - Intergenic
1005996097 6:30932332-30932354 CTGGAGACACAAGGGAGGGGTGG - Intergenic
1006164022 6:32054000-32054022 GAGGAGACACCAGTGCAGGGAGG - Intronic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007166464 6:39832013-39832035 CTGGAGGGACAGGTGCACTGGGG + Intronic
1007254637 6:40520323-40520345 CTGTAGAAGGAGGTGCAGGGAGG + Intronic
1008099105 6:47372242-47372264 CTGGGCACACTGGTGCAAGGAGG - Intergenic
1011785283 6:90836739-90836761 GTCGAGGCACAGGTGCAGGGAGG - Intergenic
1012511496 6:100007557-100007579 GTGGAAACCCAGGTGCAGAGCGG + Intergenic
1017689098 6:156945473-156945495 CTGCAGGCACAGGTGCCAGGAGG - Intronic
1018199859 6:161384637-161384659 CTGGAGACACAGGGGAACAGAGG + Intronic
1018633381 6:165839868-165839890 ATGGAGACAGAGGTGCAGATGGG - Intronic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1019417800 7:935292-935314 CTGGAGCCAGAGATGCCGGGCGG - Intronic
1019497822 7:1348631-1348653 CGGGAGACAGAGCTGCACGGAGG - Intergenic
1019540253 7:1548066-1548088 CAGGAGACTGAGGTTCAGGGGGG + Intronic
1019588081 7:1815493-1815515 ATGGAGGCACAGGGGCTGGGGGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019714711 7:2533277-2533299 CAGGACACACAGGAGCAGGTGGG + Intergenic
1019741608 7:2677776-2677798 CAGGACACACAGGAGCAGGTGGG - Intergenic
1021567922 7:22032689-22032711 CTGGAGAGAGAGGTGCCGGCGGG - Intergenic
1022021021 7:26399127-26399149 TTGGAGACGGAGGTGAAGGGAGG - Intergenic
1022550816 7:31237448-31237470 CTGAGGAAACAGTTGCAGGGAGG - Intergenic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1026929780 7:74217468-74217490 CTGAGGACACAGGTGCCTGGTGG - Intronic
1027288808 7:76678986-76679008 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028154828 7:87418127-87418149 CTGGAGACAGTGGTTCAGGGTGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029987643 7:104936524-104936546 CTGGGGCCACAGGTCCTGGGAGG + Intergenic
1031076524 7:117218835-117218857 GTGGGGACAGAGGTGCAGAGGGG - Intronic
1032211389 7:129917461-129917483 CTGGAGTCTGGGGTGCAGGGAGG + Intronic
1032710108 7:134453734-134453756 CTGGAGACATGTGTGCTGGGAGG + Intronic
1034042882 7:147897954-147897976 CAGAAGACACAGCTTCAGGGTGG + Intronic
1034272816 7:149811657-149811679 CCGGAGACACAGGAGCTGTGGGG - Intergenic
1034313274 7:150108891-150108913 CTGGAGAGGCAGCTGCAAGGTGG + Intergenic
1034793587 7:153991777-153991799 CTGGAGAGGCAGCTGCAAGGTGG - Intronic
1035129831 7:156641117-156641139 CAGGGGCCCCAGGTGCAGGGTGG + Intronic
1035206728 7:157298506-157298528 ATTGAGACACAGGGACAGGGAGG + Intergenic
1035369469 7:158370082-158370104 CAGGAGAAACTGGTGCACGGCGG + Intronic
1035523684 8:294976-294998 CTGCAGACCCAGGTCTAGGGAGG + Intergenic
1035642326 8:1193703-1193725 CGGGAGTCTCAGGTGCAGAGAGG - Intergenic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1037768419 8:21785554-21785576 CTAGAGACACAGGGGTAGAGGGG + Intronic
1038726130 8:30083970-30083992 CTGGGGACACAACTTCAGGGAGG + Intergenic
1039843226 8:41308400-41308422 CTCGCGACCCAGGTGCACGGCGG - Intronic
1039954306 8:42195419-42195441 CTGATGGGACAGGTGCAGGGAGG - Intronic
1040765284 8:50902398-50902420 CTGGGGATACAGGTGCAGTATGG - Intergenic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1041740987 8:61156261-61156283 GTGGAGACCCAGGTGATGGGAGG - Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044817856 8:96131324-96131346 TTGGAGACAGAGATGCAGGGAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1044934210 8:97277678-97277700 CAGGCGGCACAGGTGCAGGCTGG - Exonic
1045354290 8:101371636-101371658 TTGGAGACCCTGGTGCAGAGAGG - Intergenic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1047220831 8:122917008-122917030 CTGGGGACAGAGGTGCTGGAGGG - Intronic
1047350828 8:124071972-124071994 TTGGAGACACAGCTTTAGGGAGG - Intronic
1048421012 8:134278300-134278322 ATGGAAACAGAAGTGCAGGGTGG + Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1049671948 8:143873825-143873847 CTGGAGTGACAGGTCCAGGTGGG - Intronic
1051535420 9:18152182-18152204 CTGGAGTCACAGGACCTGGGTGG - Intergenic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1052999216 9:34568302-34568324 CTGGAGAAATAGGTAAAGGGAGG + Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053201019 9:36151643-36151665 CCGGTGACTCAAGTGCAGGGAGG + Intronic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1053826563 9:42030700-42030722 CAGGAGAGACAGCTGCAGGTGGG - Intronic
1054144802 9:61554395-61554417 CTGGACACGCAGGTGCAGAGAGG + Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054454559 9:65423194-65423216 CTGGAGGCACTGGGGCAGGGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054603997 9:67156697-67156719 CAGGAGAGACAGCTGCAGGTGGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1056790487 9:89622302-89622324 CTGCAGGCACAGTTGCATGGTGG - Intergenic
1056999301 9:91492854-91492876 CTGGAGCCACAGGTGCTGGAGGG + Intergenic
1057187438 9:93064809-93064831 GTGGAGACACAGGCCCAGGGTGG + Intronic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057518119 9:95738532-95738554 CTGCAGACCCAGCTGCAGCGAGG - Intergenic
1057580953 9:96287287-96287309 CTGGACCCACAGGGGCAGGCAGG + Intronic
1057865808 9:98679796-98679818 CTGAAGACACAGGAGCACAGAGG + Intronic
1057871625 9:98722469-98722491 GTGGGGAAACAGGTGCAGAGAGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059466664 9:114473075-114473097 CTGGAGACACATGAGCTTGGCGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060375774 9:123114484-123114506 CAGGAGTCACAGGTACCGGGTGG - Intronic
1061032141 9:128091776-128091798 CTGGCTACACAGCTGCTGGGAGG - Intronic
1062085081 9:134644184-134644206 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085106 9:134644262-134644284 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085131 9:134644340-134644362 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085144 9:134644379-134644401 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085157 9:134644418-134644440 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085182 9:134644496-134644518 CTGGAGATGCAGGCGCTGGGGGG + Intronic
1062085209 9:134644574-134644596 CTGGAGAGGCAGGCGCGGGGGGG + Intronic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1062392973 9:136341283-136341305 CTGGAGCCCTCGGTGCAGGGAGG + Intronic
1062449428 9:136609321-136609343 CTGGAGGGGCAGCTGCAGGGAGG - Intergenic
1062565975 9:137164149-137164171 CTGGAGACAGAGGGGCCAGGCGG - Intronic
1062568292 9:137172925-137172947 CTGGAATAGCAGGTGCAGGGAGG - Intergenic
1062722645 9:138052461-138052483 CTGCCGGGACAGGTGCAGGGTGG + Intronic
1203628388 Un_KI270750v1:47456-47478 CTGGAGTGAAAGGTGGAGGGAGG + Intergenic
1186305135 X:8248413-8248435 CTGGTGACACGCGTGCAGAGAGG + Intergenic
1186328032 X:8501096-8501118 AAGAAGACACAGGTGCTGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1189147297 X:38668163-38668185 TTGGAGACAAAGGTCCAAGGAGG - Intronic
1189472803 X:41327377-41327399 GTGGAAGCACAGGTGCCGGGAGG + Intergenic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1199723791 X:150562889-150562911 CTGCAGGCACATGTGCAGTGGGG - Intergenic
1200100141 X:153686097-153686119 CTGGAGACAGAAGTGAAGGGTGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200268567 X:154660153-154660175 CTGGAGACACAGCTACGGGAAGG - Intergenic
1201433989 Y:13936951-13936973 AAGAAGACACAGGTGCTGGGAGG - Intergenic