ID: 1113780099

View in Genome Browser
Species Human (GRCh38)
Location 13:112971791-112971813
Sequence ATCACATAGAAGGGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113780099_1113780109 13 Left 1113780099 13:112971791-112971813 CCCTGGCCCCCCTTCTATGTGAT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1113780109 13:112971827-112971849 GTCTGTTTTGGTTTTCTCTTTGG 0: 1
1: 0
2: 1
3: 66
4: 726
1113780099_1113780110 28 Left 1113780099 13:112971791-112971813 CCCTGGCCCCCCTTCTATGTGAT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1113780110 13:112971842-112971864 CTCTTTGGAATTTTAGTCATTGG 0: 1
1: 0
2: 1
3: 19
4: 185
1113780099_1113780108 1 Left 1113780099 13:112971791-112971813 CCCTGGCCCCCCTTCTATGTGAT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1113780108 13:112971815-112971837 GGGCTCATTTTCGTCTGTTTTGG 0: 1
1: 0
2: 0
3: 9
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113780099 Original CRISPR ATCACATAGAAGGGGGGCCA GGG (reversed) Intronic
901081062 1:6584518-6584540 ATCACCTAGAATGGGAGCCAGGG + Intronic
901436952 1:9252812-9252834 ATGACAAAGCAGGGGGGCCATGG - Intronic
901940451 1:12657800-12657822 ATGACATAGAAGGAGGTCCTAGG + Intronic
903918796 1:26784728-26784750 ATCCCATAGGACTGGGGCCATGG + Intergenic
907584931 1:55608535-55608557 TGCACATAGGAGGGGGGCCCTGG + Intergenic
909777556 1:79501499-79501521 ATAACATAGAGGAGGGGTCAGGG - Intergenic
911901696 1:103513917-103513939 ATCACATGGTAGGAGGGTCAAGG - Intergenic
913325932 1:117628919-117628941 TCCACAAAGAAGGGAGGCCACGG - Intergenic
914756025 1:150562051-150562073 ATCACAGATGTGGGGGGCCAGGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915700806 1:157794247-157794269 ATGACATAGAAGATGGGCAAAGG + Intergenic
918250491 1:182699254-182699276 AACACATTGAAAGGGGGCCATGG + Intergenic
921743598 1:218712991-218713013 ATCACATCCAACTGGGGCCAGGG + Intergenic
924637084 1:245798591-245798613 ATCACAAAGAATGGAGCCCAAGG - Intronic
1063046019 10:2393111-2393133 CCCACACAGAAGGGGAGCCAAGG - Intergenic
1064309175 10:14196886-14196908 ATGACAGAGAAGGGAGGTCAAGG + Intronic
1067201150 10:44172983-44173005 ATTTCACAGATGGGGGGCCAAGG - Intergenic
1067202433 10:44184918-44184940 AGCTCATAGAAGGTGGGCTATGG - Intergenic
1067314106 10:45145161-45145183 ATCAAATAGAGTGGGGGCAAAGG - Intergenic
1068103226 10:52581801-52581823 TTCACACAGAAGGGGGACCCTGG + Intergenic
1069915075 10:71782339-71782361 AGCACACACAAGGTGGGCCAGGG + Intronic
1075396746 10:122133192-122133214 AGCACATGGCAGGGGAGCCAGGG + Intronic
1076195680 10:128516117-128516139 ATCACCTTGAATGGGGCCCAGGG - Intergenic
1076619421 10:131777744-131777766 TTCAAGCAGAAGGGGGGCCAAGG + Intergenic
1077147300 11:1051950-1051972 GCCACATAGAAGGTGGGCCAAGG - Intergenic
1077807564 11:5604836-5604858 ATCACATAGCAGAGGAACCATGG + Intronic
1079608226 11:22396932-22396954 ATCTCCTAGAAGGGAGTCCAAGG + Intergenic
1079744377 11:24106750-24106772 TTCACAGAGCAGGGGGGCCCTGG - Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1085306831 11:75491032-75491054 ATCACATAGAGGCAGAGCCAGGG + Intronic
1086960747 11:92978141-92978163 AGCACAGAGGAGGGGGGCAAGGG + Intronic
1087903619 11:103670496-103670518 ATCACATAAAAGGGTGGAGATGG + Intergenic
1092389383 12:8062453-8062475 ATCATATAAAAGGGGGGGCATGG - Intronic
1093712125 12:22339557-22339579 CTCACACAGGATGGGGGCCAGGG + Intronic
1099407425 12:82281526-82281548 TACACATAGCAGGGGGGCCCTGG - Intronic
1099832896 12:87867957-87867979 ATCACAGACAAGGGGAGCCCAGG + Intergenic
1100774800 12:97962239-97962261 ATCACATTTAAGGTAGGCCAGGG - Intergenic
1101858304 12:108462685-108462707 ATCACAGAGGAGAAGGGCCAGGG - Intergenic
1101881683 12:108630081-108630103 GTCCCACAGAAGTGGGGCCAGGG + Intronic
1111978069 13:94988283-94988305 ATAACATAGAAGAGTGGCCAGGG + Intergenic
1112378517 13:98865982-98866004 ACCACAGAGGTGGGGGGCCAGGG + Intronic
1112919779 13:104597874-104597896 CTCAGAAAGAAGGAGGGCCAGGG - Intergenic
1113780099 13:112971791-112971813 ATCACATAGAAGGGGGGCCAGGG - Intronic
1114639467 14:24209660-24209682 ATCAAAGAGAAGGGAGCCCAAGG + Exonic
1117049686 14:51847673-51847695 ATCACAGACGAGAGGGGCCATGG + Intronic
1117733402 14:58746155-58746177 ATCACCTCGAAGAGGGGCAATGG + Intergenic
1122414487 14:101542355-101542377 TTGACATTGAAAGGGGGCCATGG + Intergenic
1126731253 15:51685526-51685548 ATCACAGAGAAGACAGGCCAAGG + Intronic
1128401917 15:67292095-67292117 TGCACATGGAAGAGGGGCCAAGG - Intronic
1129036075 15:72648985-72649007 ACCACCTGGAAGGGGAGCCAAGG - Intergenic
1129213811 15:74088231-74088253 ACCACCTGGAAGGGGAGCCAAGG + Intergenic
1129400201 15:75277132-75277154 ACCACCTGGAAGGGGAGCCAAGG - Intronic
1131763100 15:95645763-95645785 ATTGCATAGAAGAGGGGACAGGG - Intergenic
1132612381 16:823824-823846 ATAACATACAAGAGTGGCCACGG - Intergenic
1132854026 16:2036870-2036892 AGCACGTGGAAGGTGGGCCACGG + Exonic
1134660623 16:15981601-15981623 AGCACACAGCAGGGGGGCCCTGG + Intronic
1140190020 16:72807434-72807456 ATCAGTAAGAAGGGGGCCCATGG + Intronic
1141349976 16:83285888-83285910 ATCACAGAGAAGTGGGACAAGGG + Intronic
1143520252 17:7440530-7440552 ACCACCTACAAGGGGGGACAGGG + Intronic
1143893627 17:10120458-10120480 AGCACAGTGAAGGGAGGCCAAGG + Intronic
1144023086 17:11254265-11254287 ATCCCACAGCAGAGGGGCCAAGG - Intronic
1145911956 17:28548168-28548190 ATCAGATAGATGGGGACCCAAGG - Intronic
1146277238 17:31523600-31523622 ATCACAGAGAAGGTGGGCCTTGG + Exonic
1147464125 17:40597735-40597757 GTGACATAGAAGGGGGGACATGG - Intergenic
1147553058 17:41458499-41458521 ATCAGAGAGTAGGGGGGCCTTGG - Intergenic
1148187498 17:45655311-45655333 TTCTCAGAGAAGGTGGGCCAAGG + Intergenic
1149751216 17:59147196-59147218 ATAACCTAGAGGAGGGGCCAAGG - Intronic
1152278640 17:79372476-79372498 ATCACACAGAGGCGGAGCCATGG - Intronic
1155605990 18:27606477-27606499 TTCACATAGCAGAGGGGCAAGGG + Intergenic
1156920218 18:42513450-42513472 ATCTCATAGAATGGAGGGCAGGG - Intergenic
1159606231 18:70478121-70478143 TGCACATAGCAGGGGGGCCCTGG - Intergenic
1159653699 18:71006979-71007001 ATCACAGTCAAGAGGGGCCAAGG - Intergenic
1161283941 19:3459373-3459395 ATCACAGAGGGGAGGGGCCAGGG - Intronic
1162094374 19:8302026-8302048 AGCCCATAGAAGGTGGGACATGG - Intronic
1164503187 19:28836419-28836441 TTCACATGGAAGAGGGGCCCAGG - Intergenic
1164875654 19:31684920-31684942 ATTACAGAGAATGAGGGCCAAGG - Intergenic
1165473551 19:36016871-36016893 GTCACATAGGAGAGGGGACAGGG + Intronic
1165577721 19:36836057-36836079 TTAAGATAGAAGGGGGGTCAAGG - Intronic
1167369373 19:49071747-49071769 ATCACAGCTGAGGGGGGCCAAGG - Intronic
1167454938 19:49593035-49593057 AACACACAGAAGAGGGTCCAAGG - Intronic
927471547 2:23381320-23381342 ATCACAGAGCACGGTGGCCATGG + Intergenic
928269623 2:29844462-29844484 ATCACACATAAGGGGTACCAAGG + Intronic
930410707 2:51023177-51023199 AACAGATTGAAAGGGGGCCAGGG - Intronic
932007104 2:67938227-67938249 ACCACATAGTAGGCGTGCCAGGG - Intergenic
932326887 2:70869149-70869171 ATCACATGGTGGAGGGGCCAGGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
939139019 2:138331130-138331152 ATGACTTAGAAGAGGTGCCAGGG + Intergenic
940338258 2:152551374-152551396 CTCACATAGATGGTGGGCAAGGG - Intronic
943804875 2:192111773-192111795 TGCACATAGCAGGGGGGCCATGG - Intronic
946369553 2:219272332-219272354 AGCAAATAGAATGGGGGCCAAGG + Intronic
946844855 2:223850326-223850348 TGCACATAGCAGGGGGGCCCTGG - Intergenic
947011546 2:225571629-225571651 TTCACAGAGCAGGGGGGCCCTGG + Intronic
947236783 2:227949649-227949671 TTCACAGAGTAGGGGGGCCCTGG - Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1176114002 20:63423202-63423224 ATCCCACAGAAGGGGAGTCATGG - Intronic
1179219403 21:39393094-39393116 ACCACACAGAAGGGAGGACAGGG - Intronic
1180353681 22:11822913-11822935 ACCACAGAGAAGGGGAGCCTGGG - Intergenic
1180654138 22:17404671-17404693 ATGACATAGAACAGGGTCCAGGG - Intronic
1182930783 22:34172405-34172427 ATCACATAATTGGGAGGCCAGGG + Intergenic
1184587841 22:45459729-45459751 ATGAAATAGAATGAGGGCCAGGG - Intergenic
951918270 3:27824471-27824493 AACACACAGAAGGGAGACCAGGG - Intergenic
954582806 3:51712181-51712203 GACACATGGCAGGGGGGCCAAGG - Intronic
956801655 3:72765104-72765126 CTGACCTAGAAGGGGGGCTAAGG - Intronic
960060216 3:113312742-113312764 AAAACATAGAGGTGGGGCCATGG + Intronic
960255341 3:115505709-115505731 TGCACATAGCAGGGGGGCCCTGG - Intergenic
968110327 3:196040964-196040986 ATCACATAGAAGAGGAGCCTTGG - Intronic
968844793 4:3034879-3034901 TTCACAAAGGAGGGGGGCGAAGG - Intronic
969351816 4:6602496-6602518 ATCACTTAGGAGTGGGGCCTTGG - Intronic
971651921 4:29287845-29287867 ATGACAGAGGAAGGGGGCCAAGG + Intergenic
971972190 4:33634896-33634918 TGCACAGAGGAGGGGGGCCATGG - Intergenic
973040292 4:45461354-45461376 ATCACATTGAAGGCCGGGCATGG + Intergenic
974748118 4:66102683-66102705 TGCACATAGCAGGGGGGCCCTGG - Intergenic
975361344 4:73475309-73475331 TTCACACAGCAGGGGGGCCCTGG + Intergenic
975871052 4:78778555-78778577 ATTTCCTAGAAGGGAGGCCAAGG + Intronic
985382226 4:189406560-189406582 ATCACATACAAGAGGTGACAGGG - Intergenic
985474088 5:68452-68474 TGCACATAGCAGGGGGGCCTTGG - Intergenic
986286274 5:6361251-6361273 ATAACATAGAGGGAGGGCAAAGG - Intergenic
990077802 5:51872983-51873005 TGCACACAGAAGGGGGGCCCTGG - Intergenic
995390946 5:111639855-111639877 TGCACAGAGAAGGGGGGCCCTGG - Intergenic
998173073 5:139883650-139883672 CTCACCTAGTAGAGGGGCCAGGG - Intronic
1002064634 5:176645987-176646009 ATTACATAGGAGGGGTGCCAAGG - Exonic
1002391482 5:178916077-178916099 ATAACATAGTGAGGGGGCCAAGG + Intronic
1002554082 5:180020634-180020656 ATCACATACAAGTAGGGCCAAGG + Intronic
1005011496 6:21340158-21340180 AGCACATGGAAGAGGGGACATGG - Intergenic
1011195796 6:84778002-84778024 ATGACATAGCAGGGAGGACAAGG + Intergenic
1013139044 6:107312460-107312482 GTGACATAGTAGTGGGGCCAGGG - Intronic
1015756377 6:136610564-136610586 ATCACAGAGAGGTTGGGCCAAGG + Intronic
1015901677 6:138074565-138074587 TGCACATAGCAGGGGGGCCCTGG - Intergenic
1019146698 6:169980089-169980111 ATCACATGGAAAGGGGGAGACGG + Intergenic
1020655197 7:10920731-10920753 AAAACATAGAAGGGGTGGCAGGG - Intergenic
1021175002 7:17440189-17440211 CTCACACAGCAGGGAGGCCATGG + Intergenic
1023804069 7:43858921-43858943 TGCACATAGCAGGGGGGCCCTGG - Intergenic
1024532675 7:50406477-50406499 CTCCCATTGAAGGAGGGCCAGGG - Intergenic
1025020979 7:55479021-55479043 GTCACATAGAGGAAGGGCCATGG - Intronic
1040455597 8:47594394-47594416 ATACCAGAGAAGGTGGGCCAAGG - Intronic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1045343061 8:101271374-101271396 CTCTCATAGAAGAGGTGCCATGG + Intergenic
1045753284 8:105511449-105511471 TTCACCTAGATGGGGGCCCATGG + Intronic
1046059017 8:109114193-109114215 AACACTTAGTAGGGTGGCCAAGG + Intronic
1046170345 8:110497753-110497775 TTCACACAGCAGGGGGGCCCTGG - Intergenic
1047232433 8:123008934-123008956 CTCACATGGATGGGGGACCAGGG - Intergenic
1048134167 8:131729920-131729942 ATCACATAGAAGGAGGGGGACGG + Intergenic
1048870015 8:138789650-138789672 ATCACATTGAAGGAGGGGCAGGG + Intronic
1049025163 8:139983428-139983450 AGCACATAGGAGGGGGGCCTAGG - Intronic
1049741462 8:144242975-144242997 AGCACCTAGGAGAGGGGCCAAGG + Intronic
1052053995 9:23882866-23882888 TGCACATAGCAGGGGGGCCCTGG + Intergenic
1054826476 9:69578647-69578669 ATTATGTAGAAGGGTGGCCAGGG + Intronic
1056951593 9:91044545-91044567 ATCACTCTGAAGGGGAGCCAGGG + Intergenic
1061678868 9:132232756-132232778 ATCAGAGAGATGGAGGGCCAGGG - Intronic
1187820597 X:23283953-23283975 AGAACATAGCAGAGGGGCCAAGG - Intergenic
1188438427 X:30189556-30189578 AGCACACAGAAGATGGGCCATGG + Intergenic
1188755197 X:33953205-33953227 TGCACATAGCAGGGGGGCCCTGG + Intergenic
1189442990 X:41054267-41054289 AAAACATAAATGGGGGGCCAGGG + Intergenic
1189896120 X:45658589-45658611 TGCACACAGCAGGGGGGCCATGG - Intergenic
1191167498 X:57405624-57405646 ATAAAATAGGAGGGGGCCCAAGG + Intronic
1195819742 X:108931043-108931065 TTCACACAGTAGGGGGGCCTTGG - Intergenic
1195980045 X:110567873-110567895 ATCACAAAGTCAGGGGGCCATGG - Intergenic
1199886690 X:152027638-152027660 ATTACATTGAAGGGGGGAAAGGG - Intergenic