ID: 1113783008

View in Genome Browser
Species Human (GRCh38)
Location 13:112987232-112987254
Sequence CGCTGGAAGGGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113783008_1113783018 14 Left 1113783008 13:112987232-112987254 CCCTCCACCTGCCCCTTCCAGCG 0: 1
1: 0
2: 4
3: 53
4: 562
Right 1113783018 13:112987269-112987291 TGTTGTCTGCAGCCACGCAGAGG 0: 1
1: 1
2: 3
3: 17
4: 145
1113783008_1113783020 18 Left 1113783008 13:112987232-112987254 CCCTCCACCTGCCCCTTCCAGCG 0: 1
1: 0
2: 4
3: 53
4: 562
Right 1113783020 13:112987273-112987295 GTCTGCAGCCACGCAGAGGGTGG 0: 1
1: 0
2: 2
3: 18
4: 229
1113783008_1113783019 15 Left 1113783008 13:112987232-112987254 CCCTCCACCTGCCCCTTCCAGCG 0: 1
1: 0
2: 4
3: 53
4: 562
Right 1113783019 13:112987270-112987292 GTTGTCTGCAGCCACGCAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 165
1113783008_1113783022 29 Left 1113783008 13:112987232-112987254 CCCTCCACCTGCCCCTTCCAGCG 0: 1
1: 0
2: 4
3: 53
4: 562
Right 1113783022 13:112987284-112987306 CGCAGAGGGTGGCGTGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113783008 Original CRISPR CGCTGGAAGGGGCAGGTGGA GGG (reversed) Intronic
900015077 1:142767-142789 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900016680 1:155589-155611 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900045344 1:501376-501398 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900046941 1:514181-514203 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900067541 1:743106-743128 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900069144 1:755899-755921 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900162145 1:1228821-1228843 TGCTGGGAGGGGCAGGGGCAGGG + Exonic
900183309 1:1321900-1321922 GGCTGGCAGGGGGAGGTGGGTGG - Exonic
900435384 1:2628591-2628613 GGCTGGCAGGGGCGGCTGGAAGG + Intronic
900491577 1:2951918-2951940 CCCTGGACGGGACAGGCGGAAGG + Intergenic
900602521 1:3509278-3509300 CGCTGGAGCAGGCAGGTGGGTGG - Intronic
901790357 1:11650606-11650628 CGCTGGAAGGAGCTGGTGGACGG - Exonic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902453794 1:16516791-16516813 CCATGGAAGGGGGTGGTGGATGG + Intergenic
902498688 1:16893471-16893493 CCATGGAAGGGGGTGGTGGATGG - Intronic
902642585 1:17776232-17776254 TGGTGGAAGGGGCAGGGTGAAGG - Intronic
902714024 1:18260238-18260260 CGAGGGAAGGGGCAGGTGGCTGG + Intronic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903369399 1:22825556-22825578 AGTTGGAAGGGGCAGGAAGAGGG + Intronic
904307229 1:29598063-29598085 CGCAGGAAGTGGCAGGTGAAAGG - Intergenic
904683767 1:32246717-32246739 CCCTGGGAGGGGCAGGGAGATGG + Intergenic
905002899 1:34687186-34687208 GAATGGAAGGGGCAGGAGGAAGG - Intergenic
905129314 1:35741399-35741421 CGCTTGAACCGGGAGGTGGAGGG - Intronic
905228108 1:36493025-36493047 CACTGGGGTGGGCAGGTGGAAGG + Intergenic
906382048 1:45339143-45339165 CACTGGAAGGCAGAGGTGGATGG + Intronic
906607880 1:47184096-47184118 TGCAGGAAGGGGCAGGGAGAAGG - Intronic
906722631 1:48020134-48020156 CTCTGGAAGGGGCAAGAGGTGGG + Intergenic
906986313 1:50687070-50687092 CTTTGGAAGGCTCAGGTGGACGG - Intronic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907243489 1:53093254-53093276 GGCTGGAAGGGGCAGGCCCAGGG + Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
910936641 1:92488350-92488372 CGCAGAAAGGAGCAGGTGGGAGG + Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
912542257 1:110425898-110425920 CGCTGGGAGGCGTAGATGGACGG - Intergenic
913049676 1:115106241-115106263 CGTTTGGAGGGGCAGGTGGCTGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913211381 1:116585377-116585399 CGCTGGCCGGGGCAGGTGGCTGG + Intronic
914005916 1:143732132-143732154 CCATGGAAGGGGGTGGTGGATGG + Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915272058 1:154760573-154760595 CGCAGGGAGGGCCAGGTGGGCGG - Intronic
915461951 1:156075689-156075711 GGCTGGTAGGGGCAGGGGCAGGG + Exonic
916482807 1:165230613-165230635 TGCAGCAAGGGGCAGCTGGAGGG - Intronic
917117214 1:171614676-171614698 AGCTGGAAAGGGGATGTGGATGG + Intergenic
917977584 1:180250410-180250432 GGCAGGAAGCGGCAGGTGGCAGG + Intronic
919756588 1:201069826-201069848 TGCAGGAAGGGGCAGGTGGTGGG - Intronic
919775390 1:201190992-201191014 CGCAGGAAGGGGCAGGCAGTGGG + Intronic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920182385 1:204140318-204140340 AGCTGGGAAGGGCAGATGGATGG - Intronic
920683687 1:208092808-208092830 TCCTGGAAGGAGCAGGTGGTGGG + Exonic
921221916 1:212979546-212979568 AGCTGGAGGGAGGAGGTGGATGG - Intronic
921263015 1:213400526-213400548 CTCTGGAAGGGGCAGGGACAGGG - Intergenic
921547051 1:216485508-216485530 GGCTGGAAGGGAAATGTGGAAGG + Intergenic
922102144 1:222485879-222485901 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922104505 1:222501291-222501313 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922263227 1:223960990-223961012 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922264823 1:223973804-223973826 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922344347 1:224683988-224684010 CTCTGGAAAGGACAGGTGGCTGG - Intronic
922612180 1:226938945-226938967 GGCTGGAGGGGGAAGATGGAAGG + Intronic
923077476 1:230623091-230623113 AGCTAGAAGGGGCAGGTTGATGG - Intergenic
923130475 1:231070513-231070535 GGCTGGGAAGGGTAGGTGGAAGG + Intergenic
923586342 1:235275891-235275913 CGCTGGAAGGCCAAGGTGGGAGG + Intronic
923858186 1:237866946-237866968 GGCTGGTAGTGGCAGGGGGAGGG + Intergenic
924345067 1:243065999-243066021 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924346680 1:243078810-243078832 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1062888591 10:1038629-1038651 CCCCCTAAGGGGCAGGTGGAGGG + Intergenic
1063397181 10:5700088-5700110 GGCTGGAAAGGGTAGGAGGAAGG - Intronic
1063592638 10:7408547-7408569 GGCTGGCGGGGGCAGGTGGGAGG - Intronic
1066642840 10:37573657-37573679 TGCTGGAAGTGGGAGGTAGATGG - Intergenic
1066729669 10:38426039-38426061 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066731267 10:38439078-38439100 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1067570978 10:47370565-47370587 GGCTGGAAGAGGCAGGCTGAAGG + Intronic
1069217339 10:65838596-65838618 CGAGGGAAGGATCAGGTGGAAGG - Intergenic
1069746273 10:70716844-70716866 TGCTGTCAGGGGCAGCTGGAGGG + Intronic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1070549861 10:77482591-77482613 GGCTGGAAGGGGCAGGCAAAAGG - Intronic
1070602837 10:77877776-77877798 CCCTGGAAGGTGGGGGTGGAGGG + Intronic
1070672093 10:78385097-78385119 GGCAGGATGGGGTAGGTGGAGGG + Intergenic
1071315527 10:84392186-84392208 TACTGGAAGGGGCAGGAGGGAGG + Intronic
1072341108 10:94451008-94451030 GGCTGGAAAGGGTAGGAGGAAGG + Intronic
1072914852 10:99531430-99531452 ACCTGGAAGGGGCAGGTGAAAGG - Intergenic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073047556 10:100649610-100649632 AGCTGGAAGAGGCAGGAGGCTGG + Intergenic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1074947459 10:118295262-118295284 CGCTGGCAAGGCCAGGTGGCTGG + Intergenic
1075092277 10:119450552-119450574 CCCTGGAAGCAGCATGTGGAAGG + Intronic
1075819906 10:125298030-125298052 AGGTGGGAGGGGCATGTGGAAGG + Intergenic
1076300416 10:129421497-129421519 GGCTGGAGGGGGCAGGCTGAGGG - Intergenic
1076971671 11:137867-137889 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1076973270 11:150658-150680 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1077138065 11:1011444-1011466 GACTGGACGGGGCCGGTGGAAGG - Exonic
1077172885 11:1176282-1176304 AGCAGGCAGGGGCAGATGGAGGG - Intronic
1077192454 11:1261090-1261112 AGCTAGAAGAGGCAGGAGGAAGG + Intronic
1077359447 11:2134228-2134250 AGCTGGAAGGGGAAGGTCGCTGG + Intronic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077640952 11:3881012-3881034 GGCAGGAAGGGGCAGCTGGATGG + Intronic
1078063439 11:8062439-8062461 CGCTGTCAGGGGCCTGTGGAGGG + Intronic
1078091571 11:8267783-8267805 CGCTGGCTGGGGTAGGTGGGTGG - Intronic
1078153464 11:8778421-8778443 AGCTGTCAGGGGCAGGGGGAGGG - Intronic
1078987112 11:16607240-16607262 CGCCGGAGGGGGCAGGGGGCAGG - Intronic
1079026312 11:16950677-16950699 TGAGGGAATGGGCAGGTGGAGGG - Intronic
1079340181 11:19605256-19605278 GGGTTGAAGGGGCAGCTGGATGG - Intronic
1080847417 11:36038139-36038161 CGTTGGAAGGCGGAGGTAGATGG - Intronic
1081862635 11:46342240-46342262 GGCTGGAAGGGACAGGTGCATGG - Intronic
1082849582 11:57753312-57753334 GGCTGCAAGAGGCAGGGGGATGG + Intronic
1083302835 11:61747815-61747837 GGCTGGAAGGCCCAGGTGGTGGG + Intergenic
1083730121 11:64648337-64648359 GCCTGGAAGGGGCAGGAGAAAGG + Exonic
1083904347 11:65660396-65660418 GGCTGGCAGGGGCAGGGGCACGG - Intronic
1084308025 11:68299222-68299244 GGAGGGAAGGGGCACGTGGAAGG + Intergenic
1084322567 11:68381800-68381822 GGTTGGGAGGGGCAGGTGCAGGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085242672 11:75071600-75071622 TGCTGGAATGGGCAGGAGGAGGG + Intergenic
1085244523 11:75089222-75089244 TGCTGGGATGGGCAGGAGGAGGG + Exonic
1085249274 11:75131488-75131510 TGCTGGAATGGGCAGGAGGAGGG + Intronic
1085313473 11:75529707-75529729 AGTGGGAATGGGCAGGTGGAGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1087189840 11:95241960-95241982 AGCTGGGAGGGGTAGGAGGAGGG + Intergenic
1088119149 11:106347630-106347652 GGCTGGAGGAGGCAGGTGGATGG - Intergenic
1089339041 11:117745174-117745196 AGCTGGGAGGGGCACGTGGGAGG + Intronic
1089747875 11:120629739-120629761 CGCTGGAAGGAAAAGGTGGCTGG - Intronic
1090092488 11:123710826-123710848 AGTTGGAATGGGCAGGGGGAAGG - Intergenic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1091387738 12:105319-105341 CGCTGGCAGGGGCAGGGTGGGGG + Intronic
1091587265 12:1823341-1823363 AAATGGAAGGGGCAGGTGCATGG + Intronic
1091703042 12:2676615-2676637 CGGAGGGAGGGGCTGGTGGAAGG - Intronic
1091798104 12:3308773-3308795 GGCTGGAGGGGGCAGGGAGAGGG + Intergenic
1091880838 12:3976767-3976789 CGATAGCAGAGGCAGGTGGAAGG + Intergenic
1092179929 12:6439500-6439522 AGCTGGAAGGGGCAAGGAGATGG - Intergenic
1092289578 12:7151086-7151108 GGCAGGGAGGGGCAGGTGGCAGG + Intronic
1092784909 12:12018023-12018045 CCCTGGTGGGGGCAGGAGGAAGG + Intergenic
1094206503 12:27845739-27845761 GGCAGGAAGGGGCCGGGGGAGGG - Intergenic
1094311178 12:29085679-29085701 CTCTGGAAGGGGCAAGCAGAGGG + Intergenic
1094491237 12:30962222-30962244 AGGTGGAAGAGCCAGGTGGAAGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095739715 12:45593466-45593488 CGCTGCAAGGGGGAGGTAGAAGG + Intergenic
1096749850 12:53751762-53751784 CACTGAAAAAGGCAGGTGGATGG - Intergenic
1097017625 12:55998535-55998557 CCCTGTCAGGGGCAGGGGGAGGG + Intronic
1097113014 12:56676123-56676145 GGCTGGGAGGGGGAGGGGGAGGG + Intronic
1097916061 12:65021562-65021584 CGCTGGCAGTGGGAGGAGGAGGG - Intergenic
1098255590 12:68611656-68611678 TGCGGGAAGTGGCAGGAGGAAGG + Intronic
1101363701 12:104051726-104051748 CACTGGGAAGGGCAGGAGGAAGG - Intronic
1102223543 12:111211397-111211419 GCCTGGGAGGTGCAGGTGGAGGG + Intronic
1103072878 12:117959441-117959463 GGGTGGATGGGGCAGGTGGCTGG - Intronic
1103316815 12:120062829-120062851 GGCTGGCAGAGGCAGGTGAATGG - Intronic
1104441167 12:128794589-128794611 GGCTGCTAGGGGCAGGTGGGGGG - Intronic
1104686577 12:130788791-130788813 CGCGGGCAGGGGCGGGAGGAGGG + Intergenic
1104754484 12:131260498-131260520 GGCTGGGAGGGGCATGAGGATGG + Intergenic
1104902615 12:132197529-132197551 GGCTGGAAGAGGCAGATGCAGGG + Intronic
1105408369 13:20150267-20150289 GGCTGGAGGGGTCAGGAGGAGGG + Intronic
1106025161 13:25949247-25949269 CGCTGGCATCTGCAGGTGGAAGG - Intronic
1106582427 13:31029632-31029654 TGCAGGAAGGGGCTGGTGGGGGG + Intergenic
1108643572 13:52405905-52405927 AGCCTGAAGGCGCAGGTGGACGG - Intronic
1112185821 13:97126876-97126898 GGCAGGATGGGGCAGGAGGAGGG - Intergenic
1112507388 13:99983058-99983080 CCCGGGAAGGGGCAGGGGAAGGG - Exonic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1115470125 14:33760071-33760093 AGATGGGAAGGGCAGGTGGATGG - Intronic
1115732528 14:36286795-36286817 CGGTGGGAAGAGCAGGTGGATGG - Intergenic
1116856212 14:49954766-49954788 CCCTAGAAGAGGCAGTTGGAAGG + Intergenic
1118405831 14:65422749-65422771 CTCTGGAAGGCCCAGGTGGGAGG - Intronic
1119523248 14:75301846-75301868 GGCAGGAAGGGGCAGCTCGATGG - Intergenic
1120826713 14:88962697-88962719 AGACGGAAGGGGCTGGTGGATGG + Intergenic
1121288149 14:92752552-92752574 GGCAGGAAGGGGGAGGTGGCAGG + Intergenic
1121774745 14:96583220-96583242 ACCTGGCAGGGGCAGATGGAGGG - Intergenic
1122030456 14:98908092-98908114 GGAAGGAAGGGGCAGGTGGGGGG - Intergenic
1122289228 14:100670808-100670830 CGCTGGAAGTGGCAGGCGCGTGG - Intergenic
1122664502 14:103319249-103319271 CCCGGGAGGGGGCAGGTGGGTGG - Intergenic
1122740944 14:103871442-103871464 CCCAGGAAGGTGCAGGTCGATGG + Intergenic
1122819076 14:104332263-104332285 CGCAGGTATGGGCAAGTGGAGGG - Intergenic
1122857981 14:104569042-104569064 CGCTGGGAGGGGCTGGTGCTGGG - Intronic
1122878617 14:104680005-104680027 GGATGGTAGGGCCAGGTGGAGGG - Intergenic
1122885877 14:104710030-104710052 CTCTGGCAGGGACAGGTGGGGGG + Intronic
1122937432 14:104966643-104966665 CCCTGGCAGGGCCACGTGGAGGG - Intronic
1123017543 14:105382567-105382589 GACTGGCAGGGGCAGGTAGAGGG + Exonic
1123033686 14:105463135-105463157 AGCAGGAAGGGGCAGGAGGCAGG - Intronic
1202853844 14_GL000225v1_random:37715-37737 CGATGGAGGGGGCGGGAGGAAGG - Intergenic
1124348537 15:28938589-28938611 CGCTTGAACAGGGAGGTGGAGGG - Intronic
1124348588 15:28939020-28939042 GGCTGGGAGGGGCTGGAGGAAGG - Intronic
1125484218 15:40101133-40101155 CTCTGGACCAGGCAGGTGGAGGG + Intronic
1128308091 15:66613244-66613266 GGCTGGAAGGGGCAGAAGGCTGG + Intronic
1128794092 15:70452166-70452188 CCCTGAAAGAGCCAGGTGGAGGG + Intergenic
1128802913 15:70508364-70508386 CTCTGGAAGGGGCAGGGGAGGGG + Intergenic
1129454385 15:75668932-75668954 TGCTGGAAGGGACAGGAGGAGGG + Intergenic
1129465329 15:75721614-75721636 AGCCTGATGGGGCAGGTGGATGG + Intergenic
1129731564 15:77935403-77935425 TGGTGGAAGGGGCAGGTGGGAGG + Intergenic
1130114486 15:80994809-80994831 CTCTGGCAGGGCGAGGTGGATGG - Intergenic
1130919862 15:88334843-88334865 AGCTGGAAGGGGCAGGAGAGGGG + Intergenic
1131473268 15:92714599-92714621 CGCGGGAAGGGAGAGGAGGAGGG - Intronic
1132399087 15:101494409-101494431 CGGTGGGAGGGGCTGGTGGGAGG - Intronic
1132561605 16:597178-597200 TGGTGGCAGGGGCATGTGGAAGG + Intronic
1133303626 16:4797285-4797307 CACTGGAAGTGCCAGGAGGAAGG - Exonic
1133372083 16:5252829-5252851 TTCTGGAAGGGGGAGGTGGTGGG - Intergenic
1134136387 16:11679239-11679261 CGCTGACATTGGCAGGTGGAGGG + Exonic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134545716 16:15106510-15106532 CTCTGGGAGGGCGAGGTGGATGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1136060268 16:27721576-27721598 GGGTGGAAGGGGCAGGTCCACGG - Exonic
1136365024 16:29806022-29806044 GGCAGGAGGGGGGAGGTGGAGGG - Intergenic
1136452254 16:30359941-30359963 AGCAGGACTGGGCAGGTGGATGG - Intronic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1138734976 16:59240038-59240060 GGCTTGAAGGGGCAAGAGGACGG + Intergenic
1139448879 16:67014821-67014843 CGCTGGAAGAGGGAGTTGTAGGG + Intergenic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141061207 16:80872764-80872786 CTCTGGAAGGTGGAGGTGGGAGG + Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141693917 16:85611314-85611336 GGCTGGGAGGGGGAGGGGGAGGG - Intergenic
1141765105 16:86052967-86052989 GGCTGGGAGGGGCAGAGGGAGGG + Intergenic
1142092274 16:88220921-88220943 CCCTGTACAGGGCAGGTGGATGG - Intergenic
1142446981 16:90146868-90146890 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142448577 16:90159655-90159677 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1142458908 17:75634-75656 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142460511 17:88463-88485 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142600790 17:1052543-1052565 TGCCGGAAGGGGCTGGGGGAGGG + Intronic
1142812855 17:2403627-2403649 AGCAGGAAGGGACAGCTGGATGG - Intergenic
1143020386 17:3914547-3914569 TGCTGGAAGAGGCTGGGGGAAGG - Intronic
1143023398 17:3928073-3928095 ACCTGGCAGAGGCAGGTGGATGG + Intronic
1143258829 17:5583679-5583701 CCCAGGAAGGGGCAGGTGAGTGG - Exonic
1143410663 17:6706571-6706593 GGCTGGAAGGGGGTGGAGGATGG - Intronic
1143621047 17:8080385-8080407 CGCCGGCTGGGGCAGGTGGCGGG + Exonic
1143871315 17:9959030-9959052 AGGTGGGAGGGGCATGTGGATGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144184798 17:12787073-12787095 CGCGGGTAGGGGCAAGGGGAGGG - Intergenic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145809518 17:27756128-27756150 TGCTAGAAGGGGAAGGTGGCGGG + Intergenic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1145901948 17:28495297-28495319 GACTGGAAGGGGCAGGAAGAGGG + Intronic
1146013646 17:29215368-29215390 TGCTGGCAGGGGCAGCTGGAAGG + Intergenic
1147841486 17:43374972-43374994 CCCTGGAAGTGGATGGTGGATGG + Intergenic
1148649394 17:49238829-49238851 AGCTGCCAAGGGCAGGTGGAGGG - Intergenic
1148680308 17:49469984-49470006 GGGTGGACGGGGCAGGTGGGAGG + Intronic
1149087028 17:52730499-52730521 CACTGGACAGGACAGGTGGAGGG - Intergenic
1149087991 17:52742503-52742525 TGTTGCAAGGGGCAGGTGGTGGG + Intergenic
1149206320 17:54252802-54252824 CCATGGAAGGTGCAGGTGGCAGG + Intergenic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150249046 17:63696118-63696140 GGGTGGAAGGGGCAGGAGGGTGG - Exonic
1150251248 17:63705922-63705944 CGGTGGTAGGGGCAGCTGGAGGG - Intronic
1151218069 17:72591542-72591564 CGCCGGAAAGGGGAGGTGGCGGG + Intergenic
1151889986 17:76946222-76946244 GGGTGGAAGGGCCAGGTGGATGG + Intronic
1152044887 17:77929393-77929415 CGCAGGAAGGGGGATGTTGATGG - Intergenic
1152248534 17:79199264-79199286 CACCGGAAGGGGCTGGTGGGTGG - Intronic
1152368377 17:79870387-79870409 CTCCTGAAGAGGCAGGTGGAGGG + Intergenic
1152409678 17:80117158-80117180 GGGTGGAGGGGGCAGGTGGGAGG - Intergenic
1152526424 17:80890534-80890556 GGGTGGGAGGGGCGGGTGGAGGG + Intronic
1152642366 17:81454552-81454574 CGGGGGTAGGGGCAGGTGGGTGG - Intronic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1152814656 17:82400203-82400225 AGCTGGGAGGGGCAGGGGGGAGG - Intronic
1152885390 17:82846298-82846320 CGCTGGACGCAGCACGTGGAGGG - Intronic
1153779156 18:8478933-8478955 AGCTTCCAGGGGCAGGTGGAAGG + Intergenic
1156030663 18:32708590-32708612 CTCTAGAAGGGGCAGCTAGAAGG - Intronic
1156384416 18:36592777-36592799 GGCTGGGAGTGGTAGGTGGAAGG + Intronic
1156460980 18:37321162-37321184 CGCTGGAAGGGTTAGGCAGACGG - Intronic
1157280387 18:46343209-46343231 CGATGGAAGGGGCTGCTGGTGGG - Intronic
1157414118 18:47488079-47488101 CCCTGGCAGGGGCAGGAGAAAGG + Intergenic
1157478229 18:48036777-48036799 AGGTGGAAGGGGCAGGTGTTAGG + Intronic
1157762348 18:50274155-50274177 GGCAGGAAGGGTCAGGTGGACGG - Intronic
1159409698 18:68055226-68055248 TGCTGGAGGGGGAAGGAGGAAGG - Intergenic
1160025483 18:75211952-75211974 CGCCGGGAGGAGCAGGAGGAGGG + Intronic
1160448822 18:78947948-78947970 CGCGTGAAAGGGCAGATGGATGG + Intergenic
1160625948 18:80205106-80205128 CCCTGGAAGGGGCAGAGGAAAGG + Intronic
1160648627 19:208147-208169 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160650226 19:220963-220985 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160788923 19:913764-913786 GGCTGGGAGGGGCAGGTGGAAGG - Intergenic
1161848858 19:6728414-6728436 GGCTGGAGGGGGCAGGAGGAGGG - Intronic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162065171 19:8121141-8121163 GGATGGAGGGGGCAGGAGGAGGG - Intronic
1162333675 19:10046709-10046731 CGCTGGAGGGAGCAGGTGTGAGG - Intergenic
1162552272 19:11364470-11364492 CGCTGGCAGGGGTAGGGGCAGGG - Exonic
1163428157 19:17250413-17250435 CGCTGGAAGGGGTGGGTGGCTGG + Exonic
1164645841 19:29858347-29858369 CCCAGGCAGGGGCAGCTGGATGG - Intergenic
1165396343 19:35565806-35565828 CTCTGGAAGGCTGAGGTGGACGG + Intergenic
1165573024 19:36791477-36791499 CGGAGGAGGGGGCAGGTGCAGGG - Intergenic
1165752400 19:38268212-38268234 GGTGGGAAGGGACAGGTGGACGG + Intronic
1166731002 19:45059024-45059046 GGCTTGAAGGGGCAGATGAACGG - Intronic
1167121534 19:47520258-47520280 CCCTGGCAGGGGCAGGGGCAGGG - Intergenic
1167371463 19:49085217-49085239 CGCGGAAAGCGGGAGGTGGAGGG + Intergenic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1167512081 19:49900701-49900723 GGAGGGGAGGGGCAGGTGGAGGG + Intronic
1167517406 19:49931024-49931046 GGCAGGTAAGGGCAGGTGGAAGG + Exonic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925082097 2:1078491-1078513 AGCTGGGCAGGGCAGGTGGATGG + Intronic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
927184134 2:20470029-20470051 TCCTGGAAAAGGCAGGTGGAGGG - Intergenic
927420279 2:22923883-22923905 CACTGGAAGGGCCAAGAGGAGGG - Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928666520 2:33555355-33555377 AGCTGGAAGGGGCCGGGAGAGGG + Intronic
929583846 2:43101378-43101400 GGGTGGGAGGGGCCGGTGGACGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
930012479 2:46948048-46948070 CTCTGGTCCGGGCAGGTGGATGG + Intronic
930842165 2:55859555-55859577 CCTTGGAAGGGGCTGGTGCAAGG + Intergenic
931524284 2:63135573-63135595 CGCTGGGAGGCTGAGGTGGATGG - Intronic
931928791 2:67105673-67105695 AGATGGAAGGGGCAGTTAGAAGG + Intergenic
933513481 2:83270950-83270972 AGCTGGAAGGGGAAGAGGGAGGG - Intergenic
934857414 2:97737903-97737925 CGCGGGCAGAGGCAGGTGGGCGG + Intronic
934950179 2:98570694-98570716 CCCTGGAGTGGGCAGGCGGAGGG + Intronic
935191185 2:100780011-100780033 CACTGGAAGGTCCAGGTGGGAGG + Intergenic
935595898 2:104877322-104877344 CCCTGGCAGGGTCAGTTGGAGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936263368 2:110980734-110980756 GGCAGGAAGGGGCAGGGGCAGGG - Intronic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
937921576 2:127135288-127135310 GGATGGAACGGGAAGGTGGAGGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938301084 2:130213611-130213633 CGCTGGATGGGGCCGGTCGGGGG - Intergenic
938455632 2:131460856-131460878 CGCTGGATGGGGCCGGTCGGGGG + Intergenic
939871311 2:147529065-147529087 AGCTGGACTGGGCTGGTGGAAGG - Intergenic
941059335 2:160827712-160827734 GACTAGAAGGGGTAGGTGGAGGG + Intergenic
944781273 2:203020425-203020447 CACTGGAAGGCTGAGGTGGATGG + Intronic
945065788 2:205946601-205946623 AGCTGGAAGGGGCAGATGCTGGG + Intergenic
945315773 2:208369447-208369469 CGCTTGAACCGGAAGGTGGAGGG - Intronic
945894395 2:215465989-215466011 ACCTGGAGGGGGCAGATGGATGG - Intergenic
946152346 2:217785109-217785131 TGAGGGAAGGGGCAGATGGAAGG + Intergenic
946171789 2:217899975-217899997 GGCTGGCAGGGGCCGGGGGAAGG - Intronic
946197762 2:218046352-218046374 GGCTGGGAAGGGCAGGTGGCAGG - Intronic
947985856 2:234446867-234446889 CGGTGGAAGGAGGAGGTGGGAGG - Intergenic
948406875 2:237728442-237728464 GGCAGGAAGGAGCTGGTGGAAGG + Intronic
948414328 2:237791369-237791391 TGCTGGTGGGGGCAGGTGGGAGG - Intronic
948637902 2:239351891-239351913 CGCTGGAAGTGGCAGGAAGCTGG + Intronic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948795553 2:240400493-240400515 CTCTGGGACGGGCAGGTGCAGGG + Intergenic
948907456 2:240986622-240986644 GGCTGGATGGCGCAGGGGGAGGG + Intronic
1169071998 20:2738525-2738547 GGCAGGAAGGGGCTGGTGCATGG - Intronic
1170134823 20:13061383-13061405 TGGTGGAGGGGGCAGGTGGATGG - Intronic
1170440701 20:16376297-16376319 AGCTGGAATGAGCAGGTGGTAGG + Intronic
1170450588 20:16479359-16479381 CGGCGGATGGGGCAGGGGGAGGG + Intronic
1170759302 20:19235680-19235702 CGCTGGAACAGTCAGGAGGAAGG - Intronic
1170894731 20:20402991-20403013 GGCAGGAAAGAGCAGGTGGAAGG - Intronic
1171969971 20:31558292-31558314 GGCTGGAGGGGGGAGGAGGAGGG - Intronic
1172280361 20:33703606-33703628 CACTGGTAGGGGCATGAGGAAGG + Exonic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175975677 20:62709247-62709269 CGCTGGAAGGGGTCGGCGGCCGG - Exonic
1176120427 20:63452044-63452066 TGCTGGAATGGGCAGTTGGTGGG - Intronic
1176178004 20:63737707-63737729 CGCGGGAAGGGGCTGGAGGCAGG + Intronic
1176182551 20:63757820-63757842 CCCTGGACGGGGCGGGTGGAGGG - Intronic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182656 20:63758185-63758207 CTCTGGACGGGGCGGGTGGGGGG - Intronic
1176217517 20:63955438-63955460 CGCTGGATGCCGCAGGGGGAAGG - Intronic
1177670232 21:24215019-24215041 TGCTGGAAGGGACGGGAGGAGGG + Intergenic
1177775614 21:25562490-25562512 CGCGGGCAGAGGCAGGGGGAAGG + Intergenic
1178943347 21:36925698-36925720 CACTGGGAGGGGCAGCTGGCGGG - Intronic
1179218642 21:39387859-39387881 AGCTGGAAGGGGGAGGGGGGGGG + Intronic
1179572524 21:42286367-42286389 GGCTGGAAGGCGAAGGAGGAGGG - Intronic
1179603031 21:42493606-42493628 CGATGGAAGGGACAGGTTGGAGG + Intronic
1179982171 21:44901312-44901334 TGCAGGAAAGGGCAGGAGGAAGG - Intronic
1180205051 21:46254598-46254620 AGCAGGAAGGGGCAGGTTGGAGG + Intronic
1180223093 21:46371721-46371743 GCCTGGATGGGGCAGGTGCACGG - Intronic
1180831636 22:18909890-18909912 AGCTGGAGGGGGCAGGCGGGAGG - Intronic
1180951195 22:19721355-19721377 GGAGGGAAGGGGCAGCTGGAGGG + Intronic
1181395344 22:22617550-22617572 GGCTGTAAGGGTCAGGTGGTTGG - Intergenic
1181639887 22:24190871-24190893 TGCTGGAAAGGGGAGGTGGGGGG - Intergenic
1181675200 22:24446791-24446813 GGCTGGAAGGAGCAAGTGGTGGG - Intergenic
1181804057 22:25364577-25364599 GGTTGGGAGGGGCAGGTGCAGGG + Intronic
1181852761 22:25761755-25761777 GGCTGGGAGGGGCAGGGGCAGGG - Intronic
1183469574 22:37998349-37998371 CCCTTCAAGGGGCAGGTGGAAGG - Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183669625 22:39264782-39264804 CGCTGCTGGGGGCAGGTGGGTGG - Intergenic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1184047371 22:41979781-41979803 CGGTGGAAGGACCAGGTGGAGGG + Intronic
1184176618 22:42792753-42792775 CGGTGGAAGGTGCAGCAGGACGG + Intergenic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184493452 22:44823833-44823855 CTCTGGAATGTGCAGGTGGCTGG + Intronic
1184568913 22:45310060-45310082 CGCTGGGCGGGGCAAGGGGATGG - Exonic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1185104461 22:48859338-48859360 GGGTGGGAGGGACAGGTGGATGG - Intergenic
1185327936 22:50236650-50236672 GGCTGGAGGGGGCAGGAGGAAGG + Intronic
1185399058 22:50606680-50606702 GGCAGGAGGGCGCAGGTGGACGG - Exonic
950024558 3:9811202-9811224 GGCTGGAAGGGGCACGGAGAGGG - Intronic
950426926 3:12929362-12929384 AGCTGGAAGGGGCAGAAGGACGG + Intronic
950520493 3:13495116-13495138 GGCTGGAAGGAGCAGGTGGAGGG - Intronic
950685932 3:14618662-14618684 GGCAGGAAGAGGCAGGTAGATGG + Intergenic
950772523 3:15323684-15323706 CGTGGGGAAGGGCAGGTGGAGGG - Intronic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
953544533 3:43854657-43854679 TGCTTGAAAGGGAAGGTGGAAGG + Intergenic
953920741 3:46949547-46949569 CCCTGGACTGGGCAGGTGGTGGG + Intronic
953931009 3:47005638-47005660 CACTGGAGCGGGCAGGTGTAGGG + Intronic
954326669 3:49867846-49867868 GGCAGGAAAGGGGAGGTGGACGG + Intronic
954481287 3:50803808-50803830 TCCTGGAAGGGGCAGCTGGCCGG + Intronic
954701899 3:52454950-52454972 CGAAGGAAGGTGTAGGTGGATGG - Intergenic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
954861633 3:53695440-53695462 GGCTGGGCGGGGCAGGAGGAGGG - Intronic
955407679 3:58635811-58635833 TGCTGGAGGGGGCAGGTGCAGGG - Intronic
956960925 3:74399822-74399844 GGCTGGGAAGGGCAGGAGGAAGG - Intronic
957107255 3:75906695-75906717 CGCTGGAGGAGGGAGGCGGAAGG + Exonic
957320116 3:78619598-78619620 ACCTGGCAGAGGCAGGTGGAGGG + Intronic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
959102051 3:102021975-102021997 AGCTGGAAGGGCTAGTTGGAGGG - Intergenic
960577213 3:119241044-119241066 CGCTGGAAGGAGCACCGGGAGGG + Intronic
960630732 3:119727942-119727964 GGCAGGAAGGGGCAGGCAGATGG - Intronic
960823392 3:121757908-121757930 AGACGGAAGGGGCAGGTGGCGGG + Intergenic
960900655 3:122551111-122551133 ACCTGGAAGGGGCAGGTGAATGG - Intronic
961014200 3:123454856-123454878 GGCTGGAAGAGGCCTGTGGAGGG + Intergenic
961658659 3:128456992-128457014 CCCTGGAGGGGGCTGGGGGAGGG - Intergenic
962325826 3:134431331-134431353 ATCTGGAAGGTGCAGGTGCAAGG + Intergenic
962425129 3:135262777-135262799 TGCTGGAAGGGGCAGGGAGAGGG - Intergenic
966600279 3:181768165-181768187 CGCAGGAAGTCGCAGGTGGTGGG + Intergenic
966926050 3:184645317-184645339 GGCAGGTTGGGGCAGGTGGAAGG - Intronic
968367620 3:198199166-198199188 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968369222 3:198211968-198211990 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968747254 4:2366522-2366544 AGCTCGGAGGGGCAGGTGAAGGG + Intronic
968809773 4:2794575-2794597 CCCTGGAGGGGGCAGGCAGAAGG + Intronic
968978477 4:3834183-3834205 CCCTGGATGGGGCATGAGGAAGG + Intergenic
969306148 4:6327335-6327357 CGCAGGAAGTGGCGGGTGGGAGG + Intronic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969390247 4:6887377-6887399 GGCTGGAGGGGGAAGGGGGAGGG + Intergenic
969441993 4:7222734-7222756 ATCTGGAAAGGGCAGGTGTAGGG + Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969462825 4:7337819-7337841 AGCTGGGAGTGGCAGGGGGAAGG - Intronic
969589048 4:8110864-8110886 GGCAGGAAGGGCCAGCTGGAGGG - Intronic
969693947 4:8724528-8724550 GGATGGCAGGGGCAGGTGGGTGG + Intergenic
969984147 4:11189625-11189647 CACAGGAAGGGGCAGATGTAGGG + Intergenic
970471872 4:16387095-16387117 TGGTGGATGGGGCAGCTGGATGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971195880 4:24471612-24471634 CGCCGGAAGGGGGGCGTGGAAGG - Intergenic
972164965 4:36272331-36272353 CGCTGAAAGGGGTAGATGGATGG + Intergenic
972561486 4:40232706-40232728 AGCAGGAAGTGGCCGGTGGAGGG - Intronic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
973751701 4:54026274-54026296 CACTGGGAGGTGGAGGTGGATGG + Intronic
975858923 4:78655406-78655428 CTCTGGAAGGCTGAGGTGGATGG + Intergenic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
977852672 4:101848895-101848917 CGCTGAAAGGGAGAGGTGGGAGG - Intronic
978583321 4:110253636-110253658 AGATGGAAGGGGCAGGTTGTGGG + Intergenic
979256035 4:118608878-118608900 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979257647 4:118621696-118621718 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979330700 4:119418866-119418888 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979332309 4:119431659-119431681 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979973087 4:127161805-127161827 CTCTGGAAAGTGCAGGTTGAAGG + Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981829963 4:148988062-148988084 AGTTGGAAGGGGTGGGTGGAAGG + Intergenic
982526151 4:156482008-156482030 CGGTGGGTGGGGCCGGTGGATGG + Intergenic
984612562 4:181857335-181857357 GGCTGGAGGGGGCAGGTGAGGGG + Intergenic
984649686 4:182257106-182257128 CACTGGAAGGGGCTGGTTAAGGG + Intronic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
986752122 5:10796664-10796686 GGATGGAAGAGGTAGGTGGAGGG - Intergenic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992734196 5:79702590-79702612 AGCTGGAAGGGAGATGTGGAAGG + Intronic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
996472250 5:123874565-123874587 CACTGGAAATGGCAAGTGGATGG + Intergenic
998131307 5:139652448-139652470 GGCTTTAGGGGGCAGGTGGAGGG - Intronic
998584739 5:143415338-143415360 GGCTGGGAAGGGCAGGGGGAAGG + Intronic
998601992 5:143593928-143593950 AGGTTGTAGGGGCAGGTGGATGG + Intergenic
999181948 5:149676064-149676086 GGCTGGGAGGGGCAGGGGCAGGG + Intergenic
999737120 5:154521230-154521252 CTCTGGAGGGAGCAGGGGGATGG - Intergenic
999744882 5:154584418-154584440 TGCTGGCAGGGGCATGGGGATGG + Intergenic
999967949 5:156830035-156830057 CGTTGCAAGGACCAGGTGGATGG - Intergenic
999972996 5:156883589-156883611 TGGTGTAAGGGGCAGGTGAAGGG - Intergenic
1000103403 5:158037149-158037171 TGCTGGACGGGGCAGCTGGTGGG + Intergenic
1000268189 5:159657979-159658001 GGCTGGGAGGGGAAGGTGGGTGG + Intergenic
1001415528 5:171542678-171542700 CCCTGGCATGGGCTGGTGGAAGG + Intergenic
1001675279 5:173507227-173507249 AGCTTGAAGGGGCAAGTGGAGGG + Intergenic
1002080957 5:176737135-176737157 CCCAGGAAGGGGTAGGGGGAGGG + Intergenic
1002430615 5:179201921-179201943 TGCTGGAGTGGGCAGGTGGGTGG + Intronic
1002445841 5:179289206-179289228 CGATGGAGGAGGCAGCTGGAAGG + Intronic
1002726843 5:181304395-181304417 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002728500 5:181317553-181317575 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004261804 6:14114935-14114957 CTTTGGAAGGCCCAGGTGGACGG - Intergenic
1004599430 6:17133187-17133209 CCCTGGAGGGGGCAGGGGCAGGG - Intergenic
1005736385 6:28751575-28751597 CGCTTGAACCGGGAGGTGGAGGG + Intergenic
1006173227 6:32107427-32107449 AGCTGGAATGGGGAGCTGGAGGG - Intronic
1006245369 6:32730074-32730096 AGCTTGAAGGGGCCTGTGGAAGG + Intergenic
1006338103 6:33431552-33431574 CCAAGGAAGGGGCAGGTGGGGGG - Intronic
1006378768 6:33685840-33685862 CGGGGGAAGGGGCAGGTGTGTGG - Intronic
1006410929 6:33872816-33872838 ACCTGGAAGAAGCAGGTGGAGGG + Intergenic
1007170232 6:39857512-39857534 CTCTGGATGGGGCAAGTGGTGGG + Intronic
1007181890 6:39934498-39934520 GGCGGGGAGGGGCAGGGGGAGGG + Intronic
1007255278 6:40523985-40524007 GGCTGGGAAGGGCAGGGGGAGGG + Intronic
1007375021 6:41450722-41450744 CGCAGGAAGGGCCTGGTGGGAGG + Intergenic
1007387507 6:41529600-41529622 CTCTGGAATGGAGAGGTGGATGG - Intergenic
1007630373 6:43269967-43269989 TCCTGGAGGGGGCAGGTGGGGGG + Intronic
1007734198 6:43970549-43970571 GGCTGGAAGTAGCAGGAGGAGGG - Intergenic
1008937645 6:57009122-57009144 GGCTGGAAAGGGCAGGGGGAAGG + Intronic
1010641460 6:78333406-78333428 GGATAGAAGCGGCAGGTGGAGGG + Intergenic
1010765895 6:79777224-79777246 GGCTGGAGGGGGCATGAGGAGGG - Intergenic
1012219659 6:96633402-96633424 CTCTGGGAGGGACAAGTGGAGGG + Intergenic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1012660595 6:101885641-101885663 CCCTGGACTGGGAAGGTGGAAGG - Intronic
1012867813 6:104639040-104639062 GGCAGGAAGGGGCAGATGTAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015731008 6:136348321-136348343 AGGTAGAATGGGCAGGTGGAGGG - Intronic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1018430118 6:163715637-163715659 TGCTTGAAGGGACAGGTGGGGGG - Intergenic
1018627164 6:165791213-165791235 CGTTGGAAGGGCAAGGTGGGAGG + Intronic
1019360447 7:601921-601943 CGCAGGGACGGGCAGGGGGATGG + Intronic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1020030066 7:4926443-4926465 CTCTGCAAGGGGCAGCTTGAAGG + Intronic
1022434693 7:30371704-30371726 CTCTGGAGGCGGCAGGTGCACGG + Intronic
1023984397 7:45086479-45086501 CGGTGGGAGGGGCTGGTGGTGGG + Intronic
1024062367 7:45708614-45708636 CCCTGGAAGCTGCTGGTGGAAGG + Intronic
1024071736 7:45792008-45792030 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024072567 7:45798759-45798781 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024282743 7:47732930-47732952 CGCTGGGAGGTGGAGGTGGGTGG + Intronic
1024637270 7:51301135-51301157 CGCCGGAGGGAGCCGGTGGAGGG - Intronic
1024650765 7:51401423-51401445 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025017247 7:55449403-55449425 CGATGGCAGACGCAGGTGGACGG - Intronic
1025054886 7:55757003-55757025 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025132959 7:56387229-56387251 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025184595 7:56847652-56847674 GGTGGGAAGGGGGAGGTGGAGGG - Intergenic
1025687334 7:63729316-63729338 GGTGGGAAGGGGGAGGTGGAGGG + Intergenic
1025909519 7:65817114-65817136 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025911032 7:65828837-65828859 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1026877612 7:73888381-73888403 GGCTGGACTGGGCAGGGGGAGGG + Intergenic
1026897468 7:74018534-74018556 CTCTGGGAGGGGCAGGGGGCAGG + Intergenic
1029435702 7:100562907-100562929 GGCTGGAACGGGTTGGTGGAAGG - Exonic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1030413277 7:109209661-109209683 TGTTGGCAGGGGCAGGAGGAGGG - Intergenic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1030675673 7:112383378-112383400 CCCTGGGAGAGGCAGGTGGGTGG - Intergenic
1031010858 7:116524938-116524960 CGCTGGAGGGGGGCGGTGGCTGG - Exonic
1032048353 7:128629614-128629636 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032049954 7:128642437-128642459 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032277481 7:130472080-130472102 GGCTGGGAAGGGCAGGTGGAAGG + Intergenic
1032531313 7:132623010-132623032 GGCTGGAAGGGTCACCTGGAGGG - Intronic
1032563403 7:132915364-132915386 TTCTGGAAGTGGCATGTGGAGGG + Intronic
1032589210 7:133176936-133176958 CGTGGGAAGGGGGAGGGGGAGGG - Intergenic
1032657480 7:133947288-133947310 AGCCTGAAGGGGCAGGAGGAAGG - Intronic
1034567413 7:151926475-151926497 CCCTGGCAGGGACAGGTGGAAGG - Intergenic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035545057 8:474118-474140 GGCTGCCAGGGGCTGGTGGATGG - Intergenic
1035602072 8:902764-902786 CGGTGGAAAGTGCAGGTGGGCGG + Intergenic
1036640700 8:10581700-10581722 CGCTGGGAAGGGCAGGTGAAGGG + Intergenic
1037787901 8:21913196-21913218 GAATGGAAGGGGCAGCTGGAGGG - Intronic
1037946607 8:22993506-22993528 TGCTGGAAGGGACAGGAAGAAGG + Intronic
1038245452 8:25850615-25850637 CGCTGGAGCAGGCAGGTGAAGGG + Exonic
1038265994 8:26040477-26040499 TGCTGGGAGGGGGACGTGGAGGG + Intronic
1039411575 8:37359588-37359610 CTCTGGAAGGGTGTGGTGGATGG - Intergenic
1042019631 8:64357667-64357689 AACTGGAAGGGGTAGGTGGTAGG + Intergenic
1042228439 8:66533596-66533618 CGCTAGAGGGGGCAGGGGGTAGG - Intergenic
1047336025 8:123937148-123937170 CTCTGGGAGGGCGAGGTGGACGG - Intronic
1047750206 8:127874856-127874878 CGAGGGAAGGGCCAGGTGGCAGG - Intergenic
1048237622 8:132707295-132707317 TGTTGGAAGGGGCAGCTGGAGGG + Intronic
1048720836 8:137322502-137322524 AGCTGGATGGGGAAGGTTGAAGG + Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049014226 8:139908247-139908269 TGGAGGAAGGGGCAGGTGCATGG - Intronic
1049221180 8:141429622-141429644 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221193 8:141429672-141429694 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221208 8:141429723-141429745 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221223 8:141429774-141429796 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221238 8:141429825-141429847 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221253 8:141429876-141429898 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221282 8:141429978-141430000 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221296 8:141430029-141430051 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221311 8:141430080-141430102 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221324 8:141430131-141430153 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221339 8:141430182-141430204 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221354 8:141430233-141430255 CGCTGTAAGGACCAGGTGGTGGG + Intronic
1049221403 8:141430395-141430417 CGCTGTAAGGACCAGGTGGCGGG + Intronic
1049221418 8:141430446-141430468 CGCTGTAAGGACCAGGTGGTGGG + Intronic
1049594447 8:143476968-143476990 GGCTGGATGGGGCAGGTACAGGG + Intronic
1049697146 8:143989995-143990017 GGGTGGGAGGGGCAGGTGGGCGG - Intronic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1049745212 8:144260378-144260400 GGCTGGTTGGGGCAGGGGGAGGG + Intronic
1049747965 8:144270993-144271015 CGCTGGGCGGGGCGGGTGGTGGG - Intronic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051356460 9:16243831-16243853 GGCTGGAAGTTGCAGGTGGGAGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052536595 9:29755698-29755720 AGGTGCAAGGGGCAGGTGGGTGG + Intergenic
1053021090 9:34694764-34694786 GGCTTGAAGGGGCAAGAGGAGGG - Intergenic
1053028647 9:34755052-34755074 GGCTGGGAGGGGTAGTTGGAGGG + Intergenic
1053605325 9:39652531-39652553 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1053863240 9:42409158-42409180 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1053878684 9:42568985-42569007 CGGTGGAAGGCGCCGGTGGGAGG + Intergenic
1054233004 9:62532710-62532732 CGGTGGAAGGCGCCGGTGGGAGG - Intergenic
1054248218 9:62689885-62689907 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054451677 9:65406677-65406699 AGCTGGAAGGGGCACAGGGAAGG + Intergenic
1054562333 9:66724410-66724432 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1055426826 9:76205226-76205248 AGCTGGAAGCGGGAGGTGGAGGG - Intronic
1055788639 9:79898211-79898233 TGGTGGGAGGTGCAGGTGGATGG - Intergenic
1055960814 9:81818454-81818476 GGTTGTAGGGGGCAGGTGGATGG + Intergenic
1057305328 9:93909035-93909057 GGCTGGAAGAGGCAGGAGGCAGG - Intergenic
1058681179 9:107441574-107441596 GGCTGCCAGGGGCTGGTGGAAGG + Intergenic
1059339792 9:113591226-113591248 GGATGGAAGGGGCTGGTGGCAGG + Intronic
1059340015 9:113592371-113592393 TGCTGGAAGTGGGAGGTGTAGGG + Intronic
1059429342 9:114240649-114240671 CCCTGGAAGGGGCACGGGGCAGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1061035178 9:128109525-128109547 GGCTGGGAGGGGCAGCTGGGGGG - Intergenic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061918104 9:133767752-133767774 AGCTGCACAGGGCAGGTGGATGG - Intronic
1062234730 9:135502367-135502389 GGATGGGAGGGGCAGGTGGGAGG + Intronic
1062262706 9:135670867-135670889 GGCTGGCAGAGGCAGGTGGGTGG - Intergenic
1062309971 9:135930270-135930292 CGCTGGAACAGGCGGGTGGGAGG - Intergenic
1062359076 9:136178911-136178933 CCCTGGAAGTGGCAGTTTGAGGG - Intergenic
1062751961 9:138261871-138261893 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1062753563 9:138274652-138274674 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203576075 Un_KI270745v1:9431-9453 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1185551160 X:983373-983395 GGCAGGAAGGGGCAGGTGCCTGG + Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1187340166 X:18413993-18414015 GGCTGGAGGGGGGAGCTGGAGGG - Intergenic
1187679548 X:21753292-21753314 CGCTGGTGGAGGTAGGTGGAGGG - Intronic
1189448562 X:41105080-41105102 TGATGGAAGGGGCAGGTATAAGG + Intronic
1190062088 X:47218229-47218251 CGGTGGAGGGGGCAGTTGGGCGG + Intronic
1190212648 X:48460353-48460375 GGCAGGAAGGGTCAGTTGGAGGG - Intronic
1190437306 X:50438213-50438235 GGGTGGAAGGGGCAAGAGGAGGG - Intronic
1191996439 X:67100733-67100755 TGCTGTAAGGTGCAGGAGGAAGG + Intergenic
1192193756 X:69015295-69015317 GGCAGGATGGGGCAGGTTGAAGG - Intergenic
1194000654 X:88424719-88424741 CCCTGGCAGGGGCAGGGGGCAGG + Intergenic
1194188665 X:90807792-90807814 CACTGGCAGGGACAGCTGGAGGG + Intergenic
1195282329 X:103348318-103348340 CGCTGGAAGGGGAAGGGGCCGGG - Intergenic
1196703549 X:118697185-118697207 CTCTGGAAGGCTGAGGTGGAAGG + Intergenic
1197641039 X:128968301-128968323 AGCTGAAGGGGACAGGTGGAGGG + Intergenic
1199601992 X:149546532-149546554 CGCTGGGAGAGGCAGGGGGAGGG - Intronic
1199648396 X:149932952-149932974 CGCTGGGAGAGGCAGGGGGAGGG + Intronic
1199754033 X:150847930-150847952 ACCTGGAAGGAGCAGGAGGATGG - Intronic
1200203051 X:154295706-154295728 CGGAGGGAGCGGCAGGTGGAGGG + Exonic
1200535249 Y:4389687-4389709 CACTGGCAGGGACAGCTGGAGGG + Intergenic
1200746974 Y:6911360-6911382 GGGCGGAAGGGGCAGGTGGCGGG + Intronic
1200795547 Y:7338113-7338135 CGCTGGGAGGGGCAGGGGAGAGG + Intergenic
1200807913 Y:7451451-7451473 CGTTGGAAGGTTGAGGTGGAAGG + Intergenic