ID: 1113784287

View in Genome Browser
Species Human (GRCh38)
Location 13:112994326-112994348
Sequence TGTGCCGGTGTCTCGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113784280_1113784287 -4 Left 1113784280 13:112994307-112994329 CCAAGCTGACGTCACTGTCTGTG 0: 2
1: 0
2: 5
3: 36
4: 213
Right 1113784287 13:112994326-112994348 TGTGCCGGTGTCTCGGGCGGGGG 0: 1
1: 1
2: 2
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113784287 Original CRISPR TGTGCCGGTGTCTCGGGCGG GGG Intronic
900436787 1:2634765-2634787 TGTGCGGGTGTCTGGGGGGATGG - Intergenic
900436895 1:2635167-2635189 TGTGCGGGTGTCTGGGGGGATGG - Intergenic
900577592 1:3391121-3391143 TGTGAGGATGGCTCGGGCGGTGG - Intronic
902635689 1:17733666-17733688 TGTGCTGGTGTCGGGGCCGGGGG - Intergenic
905127475 1:35725685-35725707 GGAGCCGGTGGCTCGTGCGGAGG + Intronic
907461760 1:54609412-54609434 TGTGACGGTGGCCCGGGGGGAGG + Exonic
908234230 1:62134760-62134782 TGTGTCTGTGCCTCGGGCGCAGG + Intronic
909282189 1:73770335-73770357 TGGGCTGGTGTCTGGGGCAGGGG - Intergenic
911664482 1:100538461-100538483 TTAGCCGGTGTCTCAGGGGGAGG - Exonic
920340819 1:205274212-205274234 TGTGCTGGTGCCACGGGGGGTGG + Intergenic
1064520566 10:16196703-16196725 TGAGCCTGTGTCTCGGGCCTTGG - Intergenic
1068669337 10:59708856-59708878 GGTGCCGGTGCCTCCTGCGGCGG + Intronic
1072631534 10:97150179-97150201 TGTGCTGGTGTCTCGGGGCATGG + Intronic
1074828792 10:117233531-117233553 TTTGCCGCTGTCTCTGGCTGGGG + Intergenic
1076818822 10:132928034-132928056 TGTGCAGGGGCCACGGGCGGTGG + Intronic
1077451311 11:2648191-2648213 TGAGACCGTGTCTCGGGGGGTGG + Intronic
1083897079 11:65625340-65625362 TGTGCCCGTGACTGGGGCCGGGG + Intronic
1083922187 11:65786997-65787019 TGTGTTGGTGGCTGGGGCGGGGG - Intergenic
1084891674 11:72239888-72239910 TGGGCCGGTGTGGCGGGCGGTGG - Exonic
1089611947 11:119674082-119674104 TGAGCCAGTGTCTCGGGAGTGGG - Intronic
1091124796 11:133084256-133084278 TGTGCAGGTGTCTGGGGGGTGGG - Intronic
1091820244 12:3470676-3470698 GGTCCCGGTGTCCAGGGCGGGGG + Intronic
1091929875 12:4387109-4387131 TGTGCAGCTGTCTCAGGCAGTGG - Intergenic
1092673039 12:10884612-10884634 TGTGTGGGTGTGTCGGGGGGTGG + Intronic
1096121437 12:49091775-49091797 GGAGCCGGTGCCTGGGGCGGGGG - Intronic
1096493066 12:52023518-52023540 GGTCCCGGTGTGGCGGGCGGCGG - Intronic
1104846873 12:131851339-131851361 TGTGCCGGAGTCCCTGGGGGAGG + Exonic
1107092201 13:36493859-36493881 TGTTCTGGTGTGTCAGGCGGGGG + Intergenic
1113784245 13:112994121-112994143 TGTGCCGGTGTCTCGGGCAGGGG + Intronic
1113784254 13:112994171-112994193 TGTGCCAGTGTCTCGGGCAGGGG + Intronic
1113784270 13:112994242-112994264 TATGCAGGTGTCTCGGGCAGGGG + Intronic
1113784287 13:112994326-112994348 TGTGCCGGTGTCTCGGGCGGGGG + Intronic
1113784302 13:112994405-112994427 TGTGCCAGTGTCTCGGGCAGGGG + Intronic
1113789050 13:113017715-113017737 TGTGCAGGAGTGGCGGGCGGGGG - Intronic
1122269794 14:100563732-100563754 TGTGCGGGTGTCTGGGGATGTGG - Intronic
1122750199 14:103927761-103927783 TAAACCGGTGTCTCAGGCGGCGG - Intronic
1132591186 16:727134-727156 CGTGCCGGTGAGGCGGGCGGCGG + Intronic
1132724905 16:1334296-1334318 TGGGCCGGGGTCTCCGGGGGAGG + Intronic
1134656149 16:15949732-15949754 CATGCCGGTGGCGCGGGCGGCGG - Exonic
1134683857 16:16145335-16145357 TGTGCCAGTGTCTTGGGGTGGGG + Intergenic
1134858061 16:17537186-17537208 TGTGGAGGGGTCTCGGGAGGGGG + Intergenic
1135208098 16:20499596-20499618 TGGGCTGGTGTCTGGGGCAGGGG - Intergenic
1135210801 16:20524104-20524126 TGGGCTGGTGTCTGGGGCAGGGG + Intergenic
1136033158 16:27518177-27518199 TGTGTGTGTGTCTTGGGCGGGGG - Intronic
1142312199 16:89320629-89320651 TGTGCCAGTGGCTCGTGTGGGGG - Intronic
1142353743 16:89591432-89591454 GGTGCAGGTGTCTCGGGCACAGG + Intronic
1143129917 17:4671737-4671759 TCTGCAGGTGTCTCTGGTGGGGG + Exonic
1143196260 17:5078472-5078494 TGTCCCGGTGTCACTGGCGACGG - Exonic
1146108829 17:30068616-30068638 TGTGCGGGTCGCTAGGGCGGTGG + Intronic
1149362647 17:55911154-55911176 TGGGCTGGTGTCTGGGGCAGGGG + Intergenic
1150284138 17:63946009-63946031 TGTGCCTGTGTCTGGGGCTCTGG - Intronic
1151505532 17:74524742-74524764 TGTTCCGGAGTCTTGGGTGGGGG - Intronic
1151600004 17:75100279-75100301 AGTGCAGGTGTCTCGGGAGGTGG - Exonic
1151812591 17:76453148-76453170 TCTGCGCGAGTCTCGGGCGGCGG + Exonic
1152004771 17:77673306-77673328 TGTGAGGGTGTCTCTGGAGGAGG + Intergenic
1152269673 17:79316627-79316649 TGTGCAGGGGTCTGGGGCCGTGG - Intronic
1152687761 17:81703051-81703073 AGTGCCGCCGTCGCGGGCGGAGG - Intronic
1157579216 18:48763763-48763785 TGAGCCGGGGTCTCGGGCAGGGG + Intronic
1158601387 18:58859023-58859045 TGGGTGGGTGTCTCGGGCTGCGG + Intergenic
1160836773 19:1128289-1128311 TGTGCCGGAGGCAGGGGCGGGGG + Intronic
1162362840 19:10230270-10230292 TGTGGCGGTCTCGGGGGCGGGGG - Intronic
1162421595 19:10568797-10568819 AGGGCCGGGGTCTCGGGCTGGGG - Exonic
1163282413 19:16325645-16325667 AGCGGCGGTGTGTCGGGCGGCGG - Exonic
1163907061 19:20156884-20156906 GGTGTCGGGGTGTCGGGCGGGGG + Intergenic
1164828999 19:31306123-31306145 TGTGCCGTCGTCTCGTGGGGAGG - Intronic
929937227 2:46302147-46302169 TGTGCCCGTGCGTCGGGGGGGGG + Intronic
941859467 2:170263855-170263877 TTTACCGGTATCTCGGGCTGGGG + Intronic
948921945 2:241069944-241069966 GGTGGCAGTGACTCGGGCGGCGG - Exonic
1174426804 20:50437518-50437540 TGTGCCTGTGTCGGGGGAGGGGG + Intergenic
1181026991 22:20132229-20132251 TGTGCCGGCGTCCCGGGCACCGG + Intronic
1184858365 22:47158782-47158804 TGTGCAGGTGCCTCTGGCTGAGG - Intronic
950886469 3:16366877-16366899 TGACCCGGTGTCTTGGGCTGGGG - Intronic
951614096 3:24522384-24522406 TGTGCGTGTGTGTTGGGCGGAGG + Intergenic
961059220 3:123814162-123814184 TGTTCCTGTGTCTCGGGCTCAGG + Intronic
961809813 3:129515255-129515277 TGTGCAGGTGTCTTGGGCACGGG + Intronic
969532553 4:7737921-7737943 TGTGCAGGTGTCCCGGTCGATGG - Intronic
973230816 4:47837414-47837436 TGCGCCGGCGTCTCGGGCGCCGG - Intronic
985767274 5:1786677-1786699 TGTGGCCGTGTCACGGGCAGGGG + Intergenic
993230240 5:85226345-85226367 TGTGCTGGTCTCACGGGCAGTGG - Intergenic
998761153 5:145433668-145433690 TCTGCTGGTGTCTCGGGAGTTGG - Intergenic
1006589069 6:35141154-35141176 TGGGCCGGCGTTTCGGGCGAGGG - Intronic
1013283568 6:108661228-108661250 TGGGACTCTGTCTCGGGCGGCGG + Intronic
1013760671 6:113513652-113513674 TGTGCGTGTGTGTCGGGGGGTGG - Intergenic
1013794656 6:113873418-113873440 TGTGCCAGTGTCTCGGGCTCAGG - Intergenic
1016896020 6:149053998-149054020 TGTGCTGGTGTCTTGGACAGGGG - Intronic
1019635829 7:2075096-2075118 GGTGCCGGCGTCTCGAGAGGAGG + Intronic
1022943743 7:35262096-35262118 GGTGACGGTGTCGCTGGCGGCGG + Intergenic
1026260906 7:68754604-68754626 CATGCCTGTGTCTTGGGCGGTGG + Intergenic
1026411941 7:70132331-70132353 TGTGCCCGTGTCTAGGGGAGGGG + Intronic
1027201169 7:76064715-76064737 TGTGCAGGTGTCTTGGCTGGCGG + Intronic
1031743906 7:125468900-125468922 TGGGCCGGCATCTGGGGCGGGGG + Intergenic
1034898490 7:154892719-154892741 CGTGCCGGTCTCTCGGGCGCCGG - Exonic
1040284307 8:46092150-46092172 GGTGCCTGTGTCTCTGGTGGAGG + Intergenic
1040285020 8:46095141-46095163 TGTTCCTGTGTCTTTGGCGGAGG + Intergenic
1040291544 8:46128069-46128091 GGTGCCTGTGTCTCTCGCGGAGG - Intergenic
1040340136 8:46436278-46436300 TGTGCCCGTGTTTCTGGCGGAGG - Intergenic
1043577646 8:81676487-81676509 TGTGCCTGTGTGTTGGGGGGAGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1056710892 9:88991329-88991351 AGTGCCGGGTTCGCGGGCGGGGG + Intronic
1056787821 9:89605356-89605378 TGTGCCGGTGGCCGGGGCTGGGG + Intronic
1061681042 9:132242511-132242533 TGTGCCAGGCTCACGGGCGGCGG + Exonic
1062159298 9:135070856-135070878 TGTGTTGGTGTCACGGGCTGTGG + Intergenic
1185761811 X:2694144-2694166 TGTGCCGTTGCCCCGGGGGGTGG - Intronic
1187181464 X:16946994-16947016 TGTGCCGGCGCCGCGGGCGGGGG + Exonic
1200012923 X:153133675-153133697 TGTGACTGTGTCGGGGGCGGGGG - Intergenic
1200026678 X:153266248-153266270 TGTGACTGTGTCGGGGGCGGGGG + Intergenic