ID: 1113784508

View in Genome Browser
Species Human (GRCh38)
Location 13:112995465-112995487
Sequence GCCGCTGTGTGAGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113784505_1113784508 27 Left 1113784505 13:112995415-112995437 CCAGTATACAGTTGTGCTTAGTA 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG 0: 1
1: 0
2: 2
3: 35
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113784508 Original CRISPR GCCGCTGTGTGAGCTGCTGC TGG Intronic
900211826 1:1459931-1459953 GCTCCTGGGTCAGCTGCTGCCGG + Intronic
900623328 1:3597102-3597124 GGAGCTGTGTGAGCTGCTGGTGG - Intronic
901680571 1:10910392-10910414 GCTGGTGTCTGAGCTGCTGCTGG - Intergenic
901835496 1:11921466-11921488 GCCTCTGTCTGAACTGCTGGCGG - Intronic
902557674 1:17256547-17256569 GGCTCTGTGTGAGATGCTGGGGG - Intronic
903031992 1:20470374-20470396 GCTGCTGTGTGAGCTGATATGGG - Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904380250 1:30105871-30105893 CCTGCTGTGTGGGCTGCAGCAGG - Intergenic
904468217 1:30720245-30720267 GCCGCTGTGTCACCTGCTGGAGG + Intronic
905145279 1:35883228-35883250 CTCGCAGTGGGAGCTGCTGCAGG + Exonic
905734283 1:40315329-40315351 GCCTCGCTGTGAGCTGCGGCCGG + Intronic
906003732 1:42449920-42449942 GCCGCTGCTGCAGCTGCTGCAGG + Exonic
906598758 1:47105189-47105211 GCTGCTGTGGCTGCTGCTGCTGG - Intronic
907278718 1:53331065-53331087 GTCACTCTGTGAGCTGCTGGAGG + Intergenic
907318876 1:53590259-53590281 GCAGCTGTGTGACCTCGTGCTGG - Intronic
907458610 1:54592160-54592182 GCCGCAGGGTGAGCCTCTGCAGG + Intronic
909042194 1:70668098-70668120 GCCTCTGTGTCAGCTGCTCAGGG - Intergenic
910440458 1:87246592-87246614 GCCCATGTGGCAGCTGCTGCTGG + Intergenic
914050539 1:144126716-144126738 GTCGGGGTGTGAGCTGCTGCTGG - Intergenic
914128643 1:144838729-144838751 GTCGGGGTGTGAGCTGCTGCTGG + Intergenic
918850191 1:189678247-189678269 ACAGCTGTGTAAGCTGCTCCAGG - Intergenic
920979869 1:210823072-210823094 CTCTCTGTGTGAGCTGCTCCTGG + Intronic
921429331 1:215045388-215045410 GTCCCTGTATGAGCTGCTGGAGG + Intronic
922305610 1:224341268-224341290 GCCACTGCGCGAGCTGCAGCAGG - Intergenic
922713600 1:227852836-227852858 GCCCATGTGTAAGCTGCTGCTGG + Intergenic
922950978 1:229558434-229558456 GCCGCTGGAGGAGCGGCTGCCGG - Exonic
1062861033 10:809716-809738 CCCGCGCTGTGAGCTGCTGGCGG + Exonic
1063148620 10:3318305-3318327 GCCTCTGTGTGGGCAGCAGCGGG + Intergenic
1063148656 10:3318442-3318464 GCCTCTGTGTGGGCAGCAGCGGG + Intergenic
1063148674 10:3318510-3318532 GCCTCTGTGTGGGCAGCAGCGGG + Intergenic
1063148692 10:3318578-3318600 GCCTCTGTGTGGGCAGCAGCGGG + Intergenic
1063361526 10:5463175-5463197 GCAGTTGTGTGAGCTGATGATGG - Intergenic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1063956296 10:11270731-11270753 TCTGCTGAGCGAGCTGCTGCTGG - Exonic
1064267035 10:13833490-13833512 GCCACTCTGTGAGCTCCTGAAGG - Intronic
1065378047 10:25062547-25062569 CCCGCTGTGTCACCAGCTGCCGG - Intergenic
1065841004 10:29701002-29701024 GCCTGTGTTTGAGCTGATGCAGG + Intronic
1067701435 10:48575933-48575955 GCCCCTATCTGTGCTGCTGCAGG + Intronic
1069605126 10:69733954-69733976 CCCGCTCTGTGAGGTCCTGCAGG + Intergenic
1069692760 10:70364603-70364625 GTTGCTGGGTGAGCTGTTGCTGG - Intronic
1070537982 10:77393620-77393642 GCTGCTGTGTGTGGTGCGGCTGG - Intronic
1070733182 10:78845761-78845783 GCAGCTGTGTGAACTTCTGCAGG + Intergenic
1070982738 10:80662838-80662860 GCTGCCGTGGGAGATGCTGCGGG - Intergenic
1071516847 10:86303722-86303744 GCAACTGGGTGAGCTGCTGGTGG - Intronic
1072537480 10:96374642-96374664 CCAGCTGTGTGAGCTGGGGCAGG - Intronic
1073076644 10:100828678-100828700 GCTGGCGTCTGAGCTGCTGCGGG + Exonic
1073079642 10:100850927-100850949 GCAGCTGCGTGACATGCTGCAGG - Intergenic
1073584341 10:104694267-104694289 GCCCCTGAGTGAGCTGTTGTTGG + Intronic
1074986903 10:118667050-118667072 GTCCCTGTCTGAGCTGCGGCCGG + Intergenic
1076581922 10:131517575-131517597 GGCACTGTGTCAGCTGCTGGGGG - Intergenic
1076985537 11:233357-233379 GCCACTGGGTGTGCTGATGCCGG + Exonic
1077087925 11:763883-763905 GCTCCTGGGAGAGCTGCTGCAGG + Exonic
1077284174 11:1758548-1758570 CCCGCTGTGGGGGCTGCTGGCGG - Intronic
1077508864 11:2944996-2945018 GCCCAGGTGAGAGCTGCTGCGGG - Exonic
1078697255 11:13646977-13646999 GCAACTGTGTGAGCAGCTGCTGG - Intergenic
1079114749 11:17634111-17634133 GCCGCTGAGGGAGCTGTTCCAGG - Exonic
1079468381 11:20755298-20755320 GCCTATTTGGGAGCTGCTGCTGG + Intronic
1080951686 11:37041077-37041099 GCTGATGAGTGAGATGCTGCAGG + Intergenic
1081757166 11:45552824-45552846 CCGGCTGTGTGAGCAGGTGCAGG + Intergenic
1083678789 11:64341993-64342015 GCGGCTGGCTGAACTGCTGCTGG + Exonic
1083782591 11:64925899-64925921 GCAGCGGTGTGAGCTCTTGCTGG - Exonic
1084004293 11:66315028-66315050 GCTGCTGTGGGAGCTGGTGAGGG + Exonic
1084319745 11:68366700-68366722 TCCGCTGTGCCGGCTGCTGCAGG + Intronic
1084320644 11:68371695-68371717 GCCCCTGGGTGAGCAGCTCCAGG - Intronic
1084439864 11:69166662-69166684 GGGGCTCTGTGAGCTGCTCCCGG - Intergenic
1084631582 11:70355340-70355362 GCGGTTGTGGGAGCTGCTGGAGG + Intronic
1084779188 11:71397484-71397506 GCCGCCGTGTGTGCCTCTGCAGG + Intergenic
1088883486 11:113989565-113989587 GGCGGTGTGTGGGCTGCTGCAGG + Exonic
1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG + Intergenic
1089700244 11:120240215-120240237 GCCGCCGCGGGAGCCGCTGCCGG - Intronic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1091132327 11:133156940-133156962 GCTGCTGTGAGTGCTGCTGAGGG - Intronic
1092015398 12:5154332-5154354 GCTGCTGTGTCTGCAGCTGCTGG + Intergenic
1092523694 12:9296673-9296695 GCCTCTCAGTGAGCTCCTGCTGG + Intergenic
1092543603 12:9435226-9435248 GCCTCTCAGTGAGCTCCTGCTGG - Intergenic
1094509340 12:31086825-31086847 GCCTCTCAGTGAGCTCCTGCTGG + Intronic
1095990260 12:48029635-48029657 GGGGCTGTGGGGGCTGCTGCCGG - Intergenic
1096810738 12:54168116-54168138 GCTGTTGTGAGAGATGCTGCAGG + Intronic
1098028944 12:66234935-66234957 ACAGCTTTTTGAGCTGCTGCAGG + Intronic
1100391729 12:94150054-94150076 GCCGCGGAGAGCGCTGCTGCCGG + Intronic
1100616985 12:96238464-96238486 GCCCTTGTGTGAGCTGCTGCTGG + Intronic
1101605904 12:106247680-106247702 GCTGCTGCGGGTGCTGCTGCGGG + Exonic
1104857991 12:131910751-131910773 GCTGCTGCTGGAGCTGCTGCCGG - Exonic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1112337117 13:98524941-98524963 GCCTCTGTGTCAGCAGCTGTAGG + Intronic
1112384865 13:98930322-98930344 GCAGCTGTGTGCCCTGCAGCTGG + Intronic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1115030136 14:28785185-28785207 GGCGCTTTGTGAGCGGCCGCTGG - Intronic
1117668188 14:58078926-58078948 GCAGATGTGTGAGCAGCTTCTGG + Intronic
1120787465 14:88550532-88550554 GCTGCTGGGTGAGCAGCTGGAGG - Exonic
1121796043 14:96736082-96736104 GCCGCTGTGTCACCTGCTTGGGG + Intergenic
1122656177 14:103260831-103260853 GGCTGTGTGTGAGGTGCTGCAGG + Intergenic
1122783125 14:104152119-104152141 CCTCCCGTGTGAGCTGCTGCAGG - Exonic
1122970616 14:105150676-105150698 GCCGCTGTGGCAGGGGCTGCTGG + Exonic
1122998986 14:105281823-105281845 GGTGCTTTCTGAGCTGCTGCAGG + Intronic
1123420412 15:20126026-20126048 ATCGGGGTGTGAGCTGCTGCTGG - Intergenic
1123445445 15:20327498-20327520 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1123529636 15:21132562-21132584 ATCGGGGTGTGAGCTGCTGCTGG - Intergenic
1123735586 15:23180038-23180060 GCCGCTGGAGGAGCTGCTGCCGG + Intergenic
1124286302 15:28403021-28403043 GCCGCTGGAGGAGCTGCTGCCGG + Intergenic
1124296401 15:28508615-28508637 GCCGCTGGAGGAGCTGCTGCCGG - Intergenic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1125896749 15:43308873-43308895 GCCTCTGTGTCAGGTGCTGAGGG + Intergenic
1126694884 15:51317507-51317529 GCCCCTGTGCAAGATGCTGCAGG + Intronic
1129781414 15:78274353-78274375 ACCGCTGCGAGAGCTGCAGCGGG + Exonic
1130996256 15:88906033-88906055 GCTGCTGTGTGAGCCTCTGCTGG - Intronic
1132762872 16:1519521-1519543 GCCGCTGTGTGACCTGGGGTTGG - Intronic
1132796582 16:1726791-1726813 GCCTCTCTGTGAGCTCCCGCTGG - Intronic
1135401420 16:22168984-22169006 GCCGCTGTGAGGGCTCCTGTGGG - Intronic
1135525965 16:23213753-23213775 GGTGCTGTGTGAGGTGCTGGGGG + Intronic
1136114562 16:28086698-28086720 GCCCCAGCGTGTGCTGCTGCAGG + Intergenic
1136227250 16:28867172-28867194 GGCTCTGTGTTAGCAGCTGCGGG + Intronic
1136721303 16:32321100-32321122 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1136839686 16:33527386-33527408 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1138047008 16:53735651-53735673 GCTGCTTCCTGAGCTGCTGCTGG - Intronic
1138112598 16:54336856-54336878 ACTGCTGTGGCAGCTGCTGCTGG - Intergenic
1138593530 16:58016679-58016701 TCCACTGTGTGAGATACTGCTGG + Intronic
1138657900 16:58501281-58501303 GCCGGTGTGGGAGTTGGTGCTGG - Intronic
1141172786 16:81701764-81701786 GCAGCTGTGTGACCGGCAGCGGG + Exonic
1141700586 16:85640323-85640345 GCCGCTGTGTTACCTGCGGCAGG + Intronic
1142283515 16:89161307-89161329 GCCGCTGAGTGACCTGTTGGGGG - Intergenic
1203005129 16_KI270728v1_random:196670-196692 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1203136679 16_KI270728v1_random:1732791-1732813 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
1203149852 16_KI270728v1_random:1827671-1827693 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
1143028241 17:3953403-3953425 GTCCCTGTGGGAGCTGGTGCTGG - Exonic
1144666790 17:17107526-17107548 GCTGCTGCGTGAGATGATGCAGG - Intronic
1144853941 17:18258004-18258026 GCAGTTGTCTGAGCAGCTGCTGG - Intronic
1145264651 17:21373974-21373996 GCAGATGTGTGAGCTGCTTAGGG + Intergenic
1145877961 17:28334182-28334204 GGTGCTGTGTGAAGTGCTGCAGG + Intronic
1146208088 17:30922041-30922063 GCGGCTGCTGGAGCTGCTGCGGG + Exonic
1147526261 17:41226746-41226768 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147527300 17:41238128-41238150 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528424 17:41249812-41249834 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147528944 17:41255462-41255484 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147529850 17:41265469-41265491 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1147530845 17:41275774-41275796 GCAGCAGGGTGTGCTGCTGCAGG - Exonic
1148218309 17:45845866-45845888 GCCGCTGCCTCTGCTGCTGCTGG + Exonic
1151718514 17:75843422-75843444 GCGGCTGTGTGTCCTCCTGCCGG - Intronic
1152134136 17:78494086-78494108 GCAGCTGGAGGAGCTGCTGCAGG - Exonic
1152223582 17:79082417-79082439 GCCGCAGTGAGAGGCGCTGCAGG - Intronic
1152404794 17:80091039-80091061 GCGACTGTGTCAGCCGCTGCAGG + Intronic
1152783656 17:82237262-82237284 CCCGCTGGGGCAGCTGCTGCAGG + Exonic
1153531459 18:6050957-6050979 GCCGATGTGAGAGGTGCTGGTGG + Intronic
1153611161 18:6886704-6886726 GTCGCTGTGTGACCTGGGGCAGG - Intronic
1153805393 18:8705627-8705649 TCTGCTGCCTGAGCTGCTGCCGG + Intergenic
1155821656 18:30385612-30385634 GCTTCTGTGTGAGTTGCGGCTGG - Intergenic
1160659111 19:290245-290267 GCTGCTGTGTGACCTCCGGCAGG + Intronic
1161708264 19:5832489-5832511 GCTGCTGTTTCAGCTGCTGATGG - Exonic
1161714503 19:5867647-5867669 GCTGCTGTTTCAGCTGCTGGTGG - Exonic
1161722113 19:5908926-5908948 GCCCCGGGCTGAGCTGCTGCAGG + Exonic
1163061379 19:14764577-14764599 GGCGCTGGATGAGCTGCTGGAGG - Exonic
1166041274 19:40204494-40204516 GCTGCTGTGGGAGCTGCTGACGG + Exonic
1166888472 19:45975339-45975361 GCCACTGCGTGATCTGCGGCAGG + Intergenic
1167049713 19:47070952-47070974 GCTGCTGTGGCAGCTGCTGGGGG - Intronic
1167614480 19:50524847-50524869 GCTGCCCTGTGAGATGCTGCGGG + Intronic
1168398267 19:56066890-56066912 GCCGCTGGGTGTGCTGGTGAGGG - Intergenic
1202689946 1_KI270712v1_random:79354-79376 GTCGGGGTGTGAGCTGCTGCTGG - Intergenic
925272450 2:2622028-2622050 GCCGCACAGTGAGCTGCTGCAGG + Intergenic
930724047 2:54665513-54665535 GCAGCTGGAGGAGCTGCTGCTGG + Intronic
930872554 2:56183911-56183933 GCCCATGCGGGAGCTGCTGCGGG + Intergenic
932305958 2:70704488-70704510 GCAGCTGTGTGAGAGGCTGTGGG - Intronic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
933956471 2:87376669-87376691 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
934240618 2:90268695-90268717 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
934272574 2:91548064-91548086 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
936148628 2:109997976-109997998 CTCGGGGTGTGAGCTGCTGCTGG - Intergenic
936196050 2:110373392-110373414 CTCGGGGTGTGAGCTGCTGCTGG + Intergenic
937053885 2:118914806-118914828 GCTGCAGTGTGATCAGCTGCTGG + Intergenic
937357309 2:121206106-121206128 GCTGCTGTGTGGGGTGGTGCAGG - Intergenic
938297640 2:130188352-130188374 CCCAGTGTGGGAGCTGCTGCAGG + Intronic
938344402 2:130556956-130556978 GCCCCTCTGTGTCCTGCTGCTGG + Intergenic
938345431 2:130563766-130563788 GCCCCTCTGTGTCCTGCTGCTGG - Intergenic
938459131 2:131486314-131486336 CCCAGTGTGGGAGCTGCTGCAGG - Intronic
940912043 2:159217528-159217550 GGAGGTCTGTGAGCTGCTGCTGG + Exonic
941012197 2:160313199-160313221 ACAGCTTTTTGAGCTGCTGCAGG + Exonic
941815306 2:169790054-169790076 ACCGCTGTGTGAGCTGGGACTGG + Intergenic
946242412 2:218364745-218364767 TCCGATGGGTGAGCTGCTGATGG + Exonic
946373997 2:219297299-219297321 GCTGCTGTGGGAGCTGGGGCTGG + Exonic
947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG + Intronic
947796693 2:232897513-232897535 GCAGCAGTGAGAGCTCCTGCAGG - Intronic
948231697 2:236353775-236353797 GTCGCTGAGTGAGGTGCTGCGGG + Intronic
948281190 2:236749042-236749064 GCTGCAGCGTGAGCAGCTGCAGG - Intergenic
948920531 2:241064051-241064073 GCCGGTGTGAGAGCGGCGGCGGG + Exonic
948920767 2:241064895-241064917 GCAGCTGTGGGAGCCGTTGCTGG - Exonic
1171225121 20:23436301-23436323 GCTGCAGTGGGAGCTGCTGCTGG + Intergenic
1171457208 20:25278811-25278833 ACAGCTGTGTGCTCTGCTGCGGG - Intronic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1172447931 20:35002835-35002857 AGCTCTGTGTGAGCTCCTGCCGG - Exonic
1174467911 20:50731595-50731617 CCCGCCGTGTGAGCAGCTGGTGG + Exonic
1175468710 20:59210468-59210490 GAGGCTGTGTCAGCTGCAGCAGG + Intronic
1176410210 21:6445702-6445724 GAGGCTGGGTGGGCTGCTGCGGG + Intergenic
1176424217 21:6538095-6538117 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1177107553 21:16978785-16978807 GCCACTCTCTGAGCTGCTGGGGG - Intergenic
1179297338 21:40075082-40075104 GCTGCTGTTTGTGCTCCTGCTGG - Exonic
1179685703 21:43054024-43054046 GAGGCTGGGTGGGCTGCTGCGGG + Intronic
1179699710 21:43146410-43146432 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1179722714 21:43324666-43324688 GCCGCTGGGGGAGAGGCTGCTGG + Intergenic
1180025736 21:45161140-45161162 GCCGTGGTGTCAGCTGCAGCGGG + Intronic
1180948072 22:19707745-19707767 GCCGCTGTGAGATTTGCGGCTGG + Intergenic
1180988524 22:19919709-19919731 GCCACTGTGTGGGCAGCCGCAGG - Intronic
1181181872 22:21074140-21074162 CCCATTGTGGGAGCTGCTGCAGG - Intergenic
1181811305 22:25405232-25405254 GCCGCCGTGGCCGCTGCTGCTGG - Intronic
1182041021 22:27239224-27239246 GGCTCTGTGTCAGCTGCAGCTGG + Intergenic
1182123097 22:27799466-27799488 GCTGCTGTGGCGGCTGCTGCGGG + Exonic
1184270805 22:43381861-43381883 GCTGCTGCGAGAGCTGCTGGAGG - Intergenic
1184310448 22:43637802-43637824 GCGGCTGTGTGTGCTTCTGCGGG - Intronic
1184409676 22:44319311-44319333 GCAGCTGTGTGATCTTCGGCAGG - Intergenic
1184651990 22:45923678-45923700 GGGGCTGTGGGACCTGCTGCAGG + Intronic
1185224216 22:49643888-49643910 GCAGGTGTGTGGGCTGCAGCAGG - Intronic
950547205 3:13645628-13645650 GCCGCTTTGTGAGCTGCCATAGG - Intergenic
950604243 3:14064343-14064365 GCTGCTGCTGGAGCTGCTGCTGG - Exonic
951708389 3:25566566-25566588 GGCCCTGGGTGAGCTGCAGCTGG - Intronic
952150256 3:30581393-30581415 GCAGCTGTATGGGATGCTGCGGG + Intergenic
953705165 3:45225584-45225606 GCCTCTGCGTGGGCTGCGGCTGG - Exonic
953756025 3:45646498-45646520 GCTGCTGTGTTAGATGGTGCAGG - Intronic
954711356 3:52506572-52506594 GCAGCTCAGTGAGCTGCTGAAGG - Intronic
955757778 3:62243111-62243133 GAGGCTGAGTGAGCTGCTGATGG + Intronic
961548739 3:127654462-127654484 GCGTCTGTGTGGGCAGCTGCAGG - Intronic
962375898 3:134858541-134858563 GCTGCTCTGTGGGCTGCTGATGG - Intronic
962443188 3:135441874-135441896 GCTGCTGTGTGCCCTGCTCCTGG - Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
964624728 3:158748205-158748227 GCAGCTGTGTGACCTGCTTCTGG + Intronic
965727361 3:171732384-171732406 GCCCCAGTGCAAGCTGCTGCTGG + Intronic
966584838 3:181610976-181610998 GCTGCAATGTGAGCTGCTGCTGG + Intergenic
968472727 4:789491-789513 GCCGCTGTGGGAGCTGCGGGGGG + Intronic
968475574 4:805148-805170 GCTGCTGTGGGCGCTGCAGCCGG + Intronic
968661186 4:1799471-1799493 CGCGCTGCGTGAGCCGCTGCCGG - Exonic
968979431 4:3838782-3838804 GCAGCTGTGTGAGAGGCTGGCGG - Intergenic
970422805 4:15920802-15920824 GCAGCTGAGTGAGAAGCTGCTGG - Intergenic
971089976 4:23330910-23330932 CCAGCTGTGTGATCTGCTGCTGG - Intergenic
971388302 4:26161633-26161655 GCCTCTGTGTGACCTACTTCTGG - Intergenic
972158725 4:36197807-36197829 GCAGCTGTGGAAGCTGCTTCTGG - Intronic
973959898 4:56099478-56099500 GCCCCAGTGTGAGCGGCTGAAGG - Intergenic
975346652 4:73299793-73299815 GCCCCTGTTTGAGTAGCTGCAGG + Intergenic
975683382 4:76897480-76897502 GCCGCCGCCTGGGCTGCTGCTGG + Exonic
984763671 4:183383688-183383710 GCCGGGGTCTGAGCTGCTGCTGG - Intergenic
985668922 5:1196462-1196484 CCTGTTGTGGGAGCTGCTGCAGG + Intergenic
986745127 5:10736990-10737012 GCACCTGGGTCAGCTGCTGCTGG + Intronic
989631144 5:43483843-43483865 GCCGCTGCTCGAGCTGCTGCTGG - Intronic
991410092 5:66337084-66337106 CCTTCTGTGTGAGCTGCTTCAGG + Intergenic
992491339 5:77247510-77247532 GACCCTGTGTGACCTGCTGAGGG + Intronic
993190327 5:84672233-84672255 GAAACTGTGTGAGGTGCTGCTGG + Intergenic
996002307 5:118379104-118379126 GGGGCTGAGGGAGCTGCTGCTGG - Intergenic
996336660 5:122390907-122390929 GACGCTGTGTTTGCTGCTTCTGG + Intronic
999650854 5:153766044-153766066 ACCACTGTGGGAGATGCTGCAGG + Intronic
1002279387 5:178121767-178121789 GCTGCGGGCTGAGCTGCTGCAGG + Exonic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1002522312 5:179798602-179798624 GCAGGCCTGTGAGCTGCTGCAGG + Intronic
1003088636 6:3082177-3082199 GCCCCTGTGTCAGCAGCTCCTGG - Intronic
1003121194 6:3320152-3320174 GCCTCTGTGTCTGCTCCTGCTGG + Intronic
1004510332 6:16279310-16279332 GCCTCTCTGTGACCTTCTGCTGG + Intronic
1004556664 6:16705099-16705121 GCTTCTGTGTGAACTGCTGTGGG - Intronic
1006463279 6:34176508-34176530 GCAGCAGTGTGGGCTGCTTCAGG - Intergenic
1007397367 6:41585469-41585491 GCTGCTGGGTGAGGAGCTGCAGG - Exonic
1008522573 6:52376297-52376319 GAAGCTGTGTGGGCTGCTCCAGG + Intronic
1011661793 6:89601153-89601175 GCCGCTGGGTCAGTGGCTGCAGG - Intronic
1013432461 6:110067067-110067089 GTGGCTCTGTGGGCTGCTGCTGG - Intergenic
1016076652 6:139804411-139804433 GCAGCTGTGTGGGCAGCTCCAGG + Intergenic
1016163186 6:140907424-140907446 CCAGGTGTGTGAGCTGCCGCAGG + Intergenic
1016386779 6:143537130-143537152 GTCGCTCTGTGAGCGGCCGCGGG - Intronic
1017233747 6:152098780-152098802 GCCCCTCTATGACCTGCTGCTGG + Exonic
1018707830 6:166475799-166475821 GCCCCCGTGTGAGTTGCTCCAGG - Intronic
1019069660 6:169333244-169333266 CCTCCTGTGTGAGCTGCTGGTGG - Intergenic
1019518695 7:1450976-1450998 CCCGCTGTGTGACCTGGGGCAGG - Intronic
1021804750 7:24343686-24343708 GCAGCTGTGTGATGTGCTACAGG - Intergenic
1023986966 7:45102404-45102426 GGCCCTGTGTGTGCTGCAGCAGG - Exonic
1024563432 7:50663169-50663191 GCTGCAGAGTGAGATGCTGCTGG + Intronic
1025856664 7:65286322-65286344 GCTGCTGTGTGAGCAGCTGAGGG - Intergenic
1026678574 7:72448455-72448477 GCCCCTGCTTGAGCAGCTGCTGG + Intergenic
1026806810 7:73434037-73434059 GCTGCTGTGGCAGCTGCTGGCGG + Exonic
1031994612 7:128221525-128221547 ACTGCTGTGGGGGCTGCTGCAGG + Intergenic
1033174095 7:139109205-139109227 GCAGCTCTGTGAGGTGCTGCAGG - Exonic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1036390187 8:8318456-8318478 GCAGATGTGCCAGCTGCTGCAGG + Exonic
1036635226 8:10546001-10546023 GATGCTGCGTGAGCAGCTGCTGG + Intronic
1037584818 8:20269142-20269164 GCTGCTGTTTGTGCTGCGGCTGG + Intronic
1038404427 8:27311089-27311111 GCGGGTGCGTGAGCCGCTGCTGG - Exonic
1039971129 8:42322592-42322614 GCAGCTGAGTGGGCTGCTGGTGG - Intronic
1040101663 8:43511802-43511824 GCCGCTGTGTGACCTCAGGCAGG + Intergenic
1040952191 8:52948615-52948637 GCCGCTGTGTGTGCTGGGCCTGG - Intergenic
1041696459 8:60741912-60741934 GCGGCTGTGGCTGCTGCTGCTGG - Exonic
1045711596 8:104990844-104990866 GCAGCTGTGTCAGCTGCTTCAGG + Intronic
1045877212 8:106996246-106996268 TGTGCTGTGGGAGCTGCTGCTGG - Intergenic
1047230148 8:122990908-122990930 TCTGCTGTGTGTGCTGCTGAAGG - Intergenic
1048299186 8:133238962-133238984 GCTGGTGTGCGAGCGGCTGCGGG + Exonic
1048299202 8:133239022-133239044 GCTGGTGTGGGAGCGGCTGCGGG + Exonic
1048317963 8:133375787-133375809 GCTGCAGGCTGAGCTGCTGCAGG - Intergenic
1049753382 8:144296424-144296446 GCAGCTGTGAGAAGTGCTGCAGG + Intronic
1049763178 8:144340000-144340022 GCCATAGTGAGAGCTGCTGCTGG + Intergenic
1049799180 8:144509891-144509913 GCTGCTGTGGGAGCCGCCGCAGG - Exonic
1049799459 8:144511023-144511045 GCTGCTGGGGAAGCTGCTGCTGG + Exonic
1053073902 9:35116538-35116560 GCACCGGTGTGAGCTGCCGCCGG + Intergenic
1055371883 9:75608439-75608461 GCTGGTGTGTGAGCTGCTCTAGG - Intergenic
1056301160 9:85243333-85243355 GCTGCTGTGTGAGCTTCTTGAGG - Intergenic
1056553477 9:87670652-87670674 GGCGCTGTGTGAGCTGAGCCAGG - Intronic
1056586677 9:87931990-87932012 GCCGCTGTGTGACCTTAGGCAGG - Intergenic
1056610200 9:88120951-88120973 GCCGCTGTGTGACCTTAGGCAGG + Intergenic
1057797965 9:98171807-98171829 GCCGCTGGGAGAGGTGCTGGGGG + Intronic
1058923609 9:109640828-109640850 GCGGCCGGGTGCGCTGCTGCGGG - Intronic
1059167786 9:112095576-112095598 GCTGATCTGTGAGCTGCTGTTGG - Intronic
1059396566 9:114037922-114037944 GGTGCTGTGTGACCTCCTGCAGG + Intronic
1059453171 9:114383476-114383498 GCCTTTGTGTGAGCTGCTCTGGG - Intronic
1060216252 9:121740199-121740221 TCCACTGGGTCAGCTGCTGCTGG - Intronic
1061814683 9:133187638-133187660 GCTGGTGCGGGAGCTGCTGCTGG + Intergenic
1062033913 9:134374354-134374376 TCCGCAGTGTGGGCTGCTCCCGG + Intronic
1062400507 9:136370572-136370594 GCTGCTGTGGGAGCTGCAGCAGG - Exonic
1185644592 X:1608222-1608244 GCCGCTGTTGGAGATGCTGGAGG - Intergenic
1186197971 X:7129008-7129030 GCTGGTTTGTGAGCTCCTGCAGG + Intronic
1190220379 X:48508984-48509006 GCCGCTCTGGGAGCCGCTGCTGG + Intronic
1190681590 X:52831005-52831027 GCTGCTGTTTGGGCAGCTGCAGG - Intergenic
1190794074 X:53725145-53725167 GGGGCTGTTTGAGCTGCAGCTGG - Intergenic
1192744291 X:73923419-73923441 TCCTCTGTGTGAGGAGCTGCCGG + Intergenic
1196044813 X:111246109-111246131 GCTGCTGGGTGAAATGCTGCTGG + Exonic