ID: 1113784515

View in Genome Browser
Species Human (GRCh38)
Location 13:112995508-112995530
Sequence CTGCTCTCCTGGGGCAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 368}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113784515_1113784534 25 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784534 13:112995556-112995578 TCGGTGGTGGGGTGAGCCTGCGG 0: 1
1: 0
2: 2
3: 22
4: 391
1113784515_1113784524 -3 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784524 13:112995528-112995550 CAGAGGGGAGCTGGCGGCCGAGG 0: 1
1: 0
2: 2
3: 44
4: 419
1113784515_1113784530 12 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784530 13:112995543-112995565 GGCCGAGGTGGGGTCGGTGGTGG 0: 1
1: 1
2: 5
3: 70
4: 1730
1113784515_1113784526 1 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784526 13:112995532-112995554 GGGGAGCTGGCGGCCGAGGTGGG 0: 1
1: 0
2: 2
3: 48
4: 416
1113784515_1113784525 0 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784525 13:112995531-112995553 AGGGGAGCTGGCGGCCGAGGTGG 0: 1
1: 0
2: 7
3: 44
4: 525
1113784515_1113784523 -9 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784523 13:112995522-112995544 GGAGAGCAGAGGGGAGCTGGCGG 0: 1
1: 0
2: 6
3: 143
4: 1465
1113784515_1113784533 14 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784533 13:112995545-112995567 CCGAGGTGGGGTCGGTGGTGGGG 0: 1
1: 0
2: 4
3: 41
4: 1324
1113784515_1113784531 13 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784531 13:112995544-112995566 GCCGAGGTGGGGTCGGTGGTGGG 0: 1
1: 0
2: 5
3: 23
4: 294
1113784515_1113784528 6 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784528 13:112995537-112995559 GCTGGCGGCCGAGGTGGGGTCGG 0: 1
1: 1
2: 5
3: 45
4: 530
1113784515_1113784527 2 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784527 13:112995533-112995555 GGGAGCTGGCGGCCGAGGTGGGG 0: 1
1: 1
2: 3
3: 51
4: 543
1113784515_1113784529 9 Left 1113784515 13:112995508-112995530 CCACTTCTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 3
3: 50
4: 368
Right 1113784529 13:112995540-112995562 GGCGGCCGAGGTGGGGTCGGTGG 0: 1
1: 1
2: 7
3: 95
4: 1820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113784515 Original CRISPR CTGCTCTCCTGGGGCAGAAG TGG (reversed) Intronic
900159224 1:1215652-1215674 CTGCTCTCCTGGGGCCTAAGTGG + Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900640764 1:3687171-3687193 CTGCTCTCCTCTTGCAGAACGGG - Intronic
900724019 1:4203085-4203107 CAGGCCTCCTGGGACAGAAGAGG + Intergenic
900760421 1:4466815-4466837 CTGTACTCATGGGGCAGTAGAGG - Intergenic
901632187 1:10653369-10653391 CTGCTCACCTGGGTCAAAGGTGG + Exonic
901655519 1:10767226-10767248 CTGATCTCCTGGGCCAGGACTGG - Intronic
901676668 1:10889440-10889462 CTGCTCTCAGGGATCAGAAGAGG - Intergenic
901687063 1:10948839-10948861 CTTCTCTCTTGGTGAAGAAGGGG - Exonic
902376483 1:16032361-16032383 CTGATCTCCTGAGGGAGAGGTGG + Intronic
902394058 1:16122800-16122822 CAGCTCTCCTGCAGCAGCAGGGG + Intergenic
902583324 1:17423040-17423062 CTCCTTCCCTGGGGCAGCAGCGG + Intronic
903027597 1:20440816-20440838 CTTCCCTCCTGGGGCCCAAGGGG + Intergenic
903060659 1:20666400-20666422 CTGGTATCCTGGGGCAGTGGGGG + Intronic
903996170 1:27306685-27306707 CTCCCCACCTGAGGCAGAAGGGG - Exonic
904131991 1:28282025-28282047 CCCCTCTCCTGGGGCTTAAGTGG + Exonic
905276580 1:36822456-36822478 CTTCTCTCCTGTGGCCGAGGAGG - Intronic
906246849 1:44282321-44282343 ATGCTCTGCTGGGGGAGCAGAGG + Intronic
907320583 1:53599715-53599737 ATGGTCTCCTGGGGCAGAGATGG + Intronic
908618535 1:65950026-65950048 CTGCCATCCAGGTGCAGAAGTGG + Intronic
908813999 1:68013002-68013024 CTCCTCTCCTGAGGCAGGAGAGG - Intergenic
911533114 1:99069578-99069600 CAGCTCTCCAGAGGAAGAAGAGG + Intergenic
912413336 1:109492354-109492376 GTGCTCTCCTGGGTTAGATGTGG + Intronic
915490940 1:156249772-156249794 CTGCTGTGCTGGGACAGAATGGG - Exonic
915951174 1:160190709-160190731 TGGCTCTCCTGGTCCAGAAGAGG - Exonic
916123397 1:161549117-161549139 TTGGGCTCCTGGGGCAGAGGAGG - Intronic
916133289 1:161630475-161630497 TTGGGCTCCTGGGGCAGAGGAGG - Intronic
916977767 1:170099841-170099863 CTCATCTCCTGAGGCAGCAGTGG - Intergenic
917249317 1:173040274-173040296 CTGCTCACCTTGGGCTAAAGGGG + Exonic
919360647 1:196590330-196590352 CTGATCACCTGTGGCAGATGTGG - Intronic
920464984 1:206175631-206175653 CTGCTCTCCTTGGCCTGTAGAGG - Intergenic
921059949 1:211577816-211577838 CTGATTTCCTGGAGCAGCAGCGG + Intronic
921800716 1:219399440-219399462 CTGCACTCCTGCCACAGAAGTGG + Intergenic
922019376 1:221688300-221688322 GTGCTTTCCTGGGGCTGATGTGG - Intergenic
922554117 1:226520135-226520157 CTGCTGTCCTGGGACTGAAGTGG - Intergenic
923326623 1:232885873-232885895 CTGCTGTCATGTGGCATAAGGGG + Intergenic
923809687 1:237299524-237299546 CTGGACTTCTGGGCCAGAAGAGG + Intronic
1063483142 10:6394402-6394424 CTTGTCTCCTGGAGTAGAAGGGG + Intergenic
1063541913 10:6942624-6942646 CTGCTCTCCTGAGAGAGAAGTGG - Intergenic
1064578560 10:16770351-16770373 CTGCCCTTCTGGAGCTGAAGAGG - Intronic
1064740092 10:18424260-18424282 TTGCTCTGCAGGGGCAGTAGAGG - Intronic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1065800190 10:29344801-29344823 CTGCCCTCCTGGGGGAGGTGGGG + Intergenic
1065821945 10:29533704-29533726 ATGCTATCCTGGGGGAGAATGGG + Intronic
1065883934 10:30060262-30060284 ATACTCTCCTGTGGCAGAGGAGG + Intronic
1066443318 10:35459323-35459345 CTGCACTCCTGGGCCACATGCGG - Intronic
1067568188 10:47352984-47353006 CTGCTCCACTGGGGCAGGATTGG - Intronic
1069604212 10:69729604-69729626 CTGCCCTCCTGGTGAAGGAGTGG - Intergenic
1070161122 10:73867357-73867379 CTGCTCTCAAGGGCCAGAAAAGG + Intronic
1070740631 10:78900831-78900853 TCGCTCTTCTGGGGCAGGAGGGG + Intergenic
1071284956 10:84136041-84136063 CTCCTCTCCTGGGCCACAACTGG + Intergenic
1072681981 10:97514285-97514307 CTGAGCCCCTGGGGCAGCAGTGG - Intronic
1072687545 10:97547396-97547418 CACTTTTCCTGGGGCAGAAGAGG - Intronic
1073490351 10:103849179-103849201 CAGCTCTGATGGGGAAGAAGTGG + Intronic
1074074047 10:110104117-110104139 CTGCTCCCCAGTGGCAGGAGAGG + Intronic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074502489 10:114039353-114039375 CAACTCTCCTGGGGCAGAAATGG + Intergenic
1074522754 10:114239929-114239951 CTGCCCTCCTGGCACAGTAGCGG + Intronic
1075396734 10:122133112-122133134 CTGATCTCCTGGGACAGAGCTGG + Intronic
1075667739 10:124243096-124243118 CTGCTCTTCTGGGTCAGTGGGGG - Intergenic
1075689616 10:124386534-124386556 GTGCTCTCCTGGGGTGGGAGGGG - Intergenic
1075986269 10:126788171-126788193 CTCTTTTCCTGGGACAGAAGGGG - Intergenic
1077191290 11:1256890-1256912 ATGCTCTGGTGGGGCAGAACAGG - Intronic
1077233248 11:1468112-1468134 CAGCTCCACTGGGGCTGAAGGGG - Intergenic
1077407458 11:2388996-2389018 CTGTCCTCCTGGAGCAGCAGGGG + Intronic
1078650257 11:13184685-13184707 CTGCTCTCCTTTGGCAGCCGAGG - Intergenic
1079010741 11:16826245-16826267 CTGTTCTCCTGGGCCATATGAGG + Exonic
1079258495 11:18853365-18853387 CTGCCTTCCTGGGGCTGAACAGG + Intergenic
1080628756 11:34053145-34053167 CTTCTCTCCTACGGAAGAAGAGG - Intronic
1081772875 11:45660552-45660574 CTCCTCTCCCAGGGCAGGAGAGG + Intronic
1083651814 11:64208556-64208578 CTGGCCTCCTGGAGCAGCAGCGG + Intronic
1084183695 11:67459095-67459117 CAGCTGTCAGGGGGCAGAAGCGG + Exonic
1084196677 11:67526673-67526695 CTGCTCTCCATGTGCAGAGGTGG - Intergenic
1085201425 11:74704531-74704553 CTGCTCCCTTGGGTCTGAAGTGG + Exonic
1085270666 11:75267919-75267941 CTGTTCTTCTGGGGCTGCAGTGG - Intronic
1085328624 11:75628184-75628206 CTGTTTTCCTGGAGCAGATGGGG + Intronic
1085376491 11:76067234-76067256 CTGCTTTCCTGGAGCTGGAGTGG - Intronic
1085458716 11:76680406-76680428 CTGGTCTCCTGGTGCAGAAATGG - Intergenic
1085524818 11:77158024-77158046 CTGCTCTTCATGGGAAGAAGGGG + Intronic
1086154261 11:83648393-83648415 CTCCTCTTCAGAGGCAGAAGAGG - Intronic
1087293180 11:96341404-96341426 CTGGTCCCCTGGGGTTGAAGCGG + Exonic
1087345359 11:96964913-96964935 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
1087899621 11:103626150-103626172 CTGCTTACCTGGGGTAGAAGCGG + Intergenic
1088142284 11:106632032-106632054 CTGTGCTGCTGGGGCAGGAGGGG + Intergenic
1088541568 11:110919044-110919066 CTGGTCTCCAGAGGCAGGAGGGG + Intergenic
1088678907 11:112222358-112222380 CTGCTGTGCTGGGACAGAATGGG - Intronic
1088720166 11:112585154-112585176 TTGCTTTCCAGGGGCAGAAAGGG - Intergenic
1089628772 11:119770447-119770469 CTGATGTGCTAGGGCAGAAGTGG + Intergenic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090280107 11:125448466-125448488 CAGGCCTCCTGGAGCAGAAGGGG - Intronic
1090604401 11:128406544-128406566 CATCTTCCCTGGGGCAGAAGTGG - Intergenic
1090777715 11:129979833-129979855 GTGATCTCCTGGGGCGGAGGAGG - Intronic
1091320642 11:134646895-134646917 CTGGGCTCCAGGTGCAGAAGGGG + Intergenic
1091334817 11:134758496-134758518 CTGCTCTCCAGGTTCAGCAGGGG + Intergenic
1091878777 12:3959879-3959901 CTGCTCTCTGAGGGCAGAGGCGG - Intergenic
1093184243 12:16001779-16001801 CTGCTTCCCTGAGTCAGAAGTGG + Intronic
1095982259 12:47980317-47980339 CTGATCTCCTGGGGAGGAGGGGG - Intronic
1096553833 12:52391202-52391224 CTCCTCTCCTGGGGAGGAAGGGG + Intergenic
1096668332 12:53181499-53181521 CTGGTCTCCTGGGCAAGGAGTGG - Intronic
1096772502 12:53945008-53945030 CTGCTCACCTCGGGCTGCAGGGG - Exonic
1098004062 12:65976407-65976429 CCTCTCCACTGGGGCAGAAGAGG - Intergenic
1098070293 12:66667567-66667589 CTGTTATCCTGGGGAAAAAGTGG - Intronic
1098490002 12:71064516-71064538 CTGCTCTCCTGGAGCACTGGGGG - Intronic
1099668187 12:85658044-85658066 ATGTTCTCATGTGGCAGAAGGGG + Intergenic
1099732780 12:86526313-86526335 CTGCACTCCTGCTGCAGCAGTGG + Intronic
1101331314 12:103760107-103760129 CTTCTCTTCTGGAACAGAAGGGG + Intronic
1102311961 12:111852312-111852334 TTGCTGTCTTGGGGCAGCAGAGG - Intronic
1102801793 12:115741496-115741518 CTTCTCTCCAGAGGCAGAGGAGG + Intergenic
1104035594 12:125095194-125095216 CAGCTCTCCTGGGCCAGGACAGG + Intronic
1105415647 13:20209057-20209079 GTGCCCTCCTGTGGCTGAAGGGG - Intergenic
1105493195 13:20907099-20907121 ACACTCTCCTGGGGCAGAGGTGG + Intergenic
1105599361 13:21872122-21872144 CTTCTCTCCAGGGGAGGAAGAGG + Intergenic
1106127739 13:26914145-26914167 CAGGGCTTCTGGGGCAGAAGAGG - Intergenic
1106232691 13:27833438-27833460 CTGCTCTCCTGGAGCAGGTGAGG - Intergenic
1107966480 13:45602732-45602754 CTGCTCTCCTGGTGGATATGAGG - Intronic
1108847193 13:54692695-54692717 GTGCTCTTCTGGGTCAAAAGAGG + Intergenic
1113584716 13:111457239-111457261 CTGGTTTCATGGGGCAGAAAGGG + Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1115643827 14:35352897-35352919 CTGCAGTCCTGGGGCCGTAGAGG - Intergenic
1117108717 14:52426297-52426319 TTGCTCACCTGAGGCACAAGCGG + Intergenic
1117834761 14:59792006-59792028 CTGCTCTACTGAGGCAGGGGAGG - Intronic
1118459255 14:65973873-65973895 GTGCACTCCTGTGGGAGAAGAGG - Intronic
1118713176 14:68539350-68539372 GGGCTTTTCTGGGGCAGAAGGGG - Intronic
1119415604 14:74467429-74467451 CCCCTCTCCTGGGGCTGAAAAGG - Intergenic
1120277843 14:82399859-82399881 CTGCTCTTCTGGGGAAGTGGAGG + Intergenic
1121492968 14:94372938-94372960 CTGCTGATCTGGGGCAGAGGAGG - Intergenic
1122271382 14:100569821-100569843 CTGCTCTCCAGGGGCTAATGAGG + Intronic
1122988320 14:105223625-105223647 CTGGTGGCCTGGGGCAGGAGGGG + Intronic
1124798498 15:32806340-32806362 CTGTTCTCATGGGACAGATGAGG - Intronic
1125279913 15:38032304-38032326 CTGATCTGGTGGGGCAGATGGGG - Intergenic
1127017941 15:54709355-54709377 CTTTTCTCCTGGGCCTGAAGAGG + Intergenic
1128064293 15:64754925-64754947 CTGCTTTCCTGGGGAGGAAGGGG - Intronic
1129449226 15:75640644-75640666 CGGCTCTCCTGGGGCTGACCTGG + Intronic
1129726121 15:77902692-77902714 CTGCTCTGCTGTGGCACAAGGGG - Intergenic
1129756708 15:78103236-78103258 CTTCTCTCCTTAGCCAGAAGAGG + Intronic
1130990099 15:88871079-88871101 CTGCTCTGCTGGGCCGGCAGAGG - Intronic
1131065122 15:89429716-89429738 CTCCTCACTTGGGGCAGGAGGGG + Intergenic
1131734451 15:95317186-95317208 CTGCTCTGTTGGGTAAGAAGAGG + Intergenic
1131961258 15:97792412-97792434 CTTCTCTCCTGGGTCAGAGGGGG - Intergenic
1132021503 15:98366461-98366483 CAGCTCTCATGGGCTAGAAGAGG - Intergenic
1132239727 15:100248500-100248522 GTGCTGTCCTGGGTGAGAAGAGG - Intronic
1133263156 16:4565358-4565380 CTCCTGTCCTGGGGAAGAAGGGG - Intronic
1134416405 16:14047414-14047436 CGTCTCTCCTGGGCCAGATGTGG + Intergenic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1136516556 16:30772074-30772096 ATGTCCTCCTGGGGCAGGAGAGG - Exonic
1138584507 16:57961140-57961162 ATGGCCTCCTGGGGCAGCAGGGG + Intronic
1138614830 16:58157125-58157147 TTGCTGTCCTGAGGCAGGAGAGG - Intergenic
1140725837 16:77811218-77811240 CTACTCTCCTGGTGAAAAAGAGG - Intronic
1141386179 16:83624342-83624364 CTGCTGACCTGGGGCAGGGGTGG - Intronic
1141688178 16:85582073-85582095 CTGGGCTCCTGGGGCGGAATTGG + Intergenic
1141997746 16:87645979-87646001 TTGCTTTCCTGGGCCAGACGAGG + Intronic
1142003618 16:87678753-87678775 GTGCCCTCGTGAGGCAGAAGAGG + Intronic
1142066731 16:88067234-88067256 CTGGTCTCATGGGGCTGAGGGGG + Intronic
1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG + Intronic
1142904398 17:3032740-3032762 CCTCCCTCCTGGGTCAGAAGCGG - Intronic
1143373270 17:6453633-6453655 GTGCCCTCCTGGGGCTGGAGGGG - Exonic
1143871302 17:9958979-9959001 CTTCTCTCCTGGTGAACAAGTGG - Intronic
1146234600 17:31146537-31146559 CTGCCCTCCTGCTGCAGGAGAGG + Intronic
1146286497 17:31577634-31577656 CTGCCCTCATGGGTCAGCAGGGG + Intergenic
1146546878 17:33747782-33747804 CTGCAGACCTGGGGAAGAAGGGG - Intronic
1146938344 17:36826299-36826321 CTGCCATCCTGGGGCAGGAGGGG + Intergenic
1148387641 17:47246068-47246090 TTGGTCTCATTGGGCAGAAGAGG + Intergenic
1148543908 17:48502424-48502446 TTTCTCTCCTGGGGGAAAAGAGG - Intergenic
1149541574 17:57471818-57471840 CTGATGCTCTGGGGCAGAAGTGG - Intronic
1150247765 17:63689141-63689163 CTGCTGCTGTGGGGCAGAAGAGG - Intronic
1150288035 17:63964877-63964899 CTGGTCTCCTGGCTCAGAGGAGG + Intronic
1150940984 17:69694444-69694466 CTGCTTTCCTGGAGCTGATGTGG + Intergenic
1151475248 17:74341512-74341534 CTGCTCCCCTGGGGCTGTACTGG + Intronic
1151684629 17:75639442-75639464 AGGCTCTCCTGGGGCAGGGGTGG + Exonic
1152272776 17:79334746-79334768 CTGCTGTCATGTGGCAGACGAGG - Intronic
1152371641 17:79892042-79892064 CTGCTTTCCTGGAGCAAATGTGG + Intergenic
1152541755 17:80980120-80980142 CTGCTCCCCCTGGGGAGAAGGGG - Intergenic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1156371424 18:36474752-36474774 CTGAGCTCCTGGGGCAGGAGCGG + Intronic
1159271625 18:66160297-66160319 GTGCTATCATGTGGCAGAAGTGG + Intergenic
1159855871 18:73586871-73586893 CTGTTTTTCTGGGCCAGAAGGGG - Intergenic
1160240517 18:77119320-77119342 GTGCTCTCCTGTGGCAGGGGTGG - Intronic
1160498026 18:79386540-79386562 GTGCCCTCCTGGGGAAGATGTGG - Intergenic
1161196456 19:2989221-2989243 GTGTTCACCTGTGGCAGAAGAGG + Exonic
1161287196 19:3474780-3474802 CTGCTTTTAGGGGGCAGAAGAGG + Exonic
1161773119 19:6242042-6242064 CTGACCTGCTGGCGCAGAAGCGG - Intronic
1162013383 19:7830883-7830905 CTGGTCTCCTTGGGGAGAGGTGG - Intronic
1162521726 19:11184761-11184783 CTTCTCTGTTGGGGCAGAATGGG - Intronic
1163421909 19:17218400-17218422 CTGCGGCCCTGGGGCAGTAGTGG + Intronic
1163463782 19:17454911-17454933 CTGCCCACCTGGGGCAGAGGAGG + Intronic
1164429798 19:28177260-28177282 CTGCTGTCCTGAGGCCTAAGGGG - Intergenic
1165422493 19:35729144-35729166 CCCGCCTCCTGGGGCAGAAGAGG - Exonic
1165858054 19:38891895-38891917 CTGCTCGCCTGCCGCAGGAGAGG + Intronic
1167964531 19:53132529-53132551 CTGCGCTCCAGGGGCCGACGAGG + Intronic
1167967348 19:53158363-53158385 CTGCGCTCCAGGGGCCGACGAGG + Intronic
1168092644 19:54095825-54095847 CTGCATTCCTGGGGCGGAGGAGG + Exonic
1168294752 19:55373176-55373198 CTGGACTCCTGGGTCTGAAGGGG - Intergenic
1168501147 19:56894614-56894636 CTGCTCTCCTGGGCCAGACCTGG + Intergenic
925076887 2:1024063-1024085 CTGCTCTCGTGGAGGGGAAGTGG + Intronic
925588538 2:5487406-5487428 CTCCTTTCCTCAGGCAGAAGGGG - Intergenic
925928148 2:8685277-8685299 CAGCTCACCTGGGGCGGAACAGG + Intergenic
926131624 2:10306412-10306434 CTGCTCTCCTATGGTAGCAGGGG + Intronic
928195885 2:29216165-29216187 CTGCACTCCAGCGGCAGATGGGG - Intronic
928226683 2:29455356-29455378 CTGCTCTCCCAGGGTAGGAGAGG - Intronic
929382025 2:41364938-41364960 CTGCACTCCTGCTGCAGCAGTGG - Intergenic
929547699 2:42866495-42866517 CTGCTCTCCGGGGCCAGGAGGGG + Intergenic
929821680 2:45279068-45279090 CTGCTCTCCGGCTGAAGAAGTGG - Intergenic
930689359 2:54344266-54344288 CTGCTATCCTGAACCAGAAGTGG - Intronic
931214495 2:60228496-60228518 CTGTCCTCATGGGGCAGAGGAGG - Intergenic
932302742 2:70678594-70678616 CTACTAACCTGGGGCAGGAGAGG + Intronic
932539933 2:72641263-72641285 CGCCTCACCTGGGGCACAAGGGG + Intronic
934895659 2:98117538-98117560 ATGCTCTGGTGGGGCAGCAGGGG + Intronic
935333457 2:101994324-101994346 CTGCTCTCCAGGGGGAGGGGAGG - Intronic
936152346 2:110028701-110028723 TGGTTCCCCTGGGGCAGAAGTGG + Intergenic
936192333 2:110342711-110342733 TGGTTCCCCTGGGGCAGAAGTGG - Intergenic
936271416 2:111052292-111052314 GTGCTCTCATGGTGCTGAAGGGG - Intronic
937335400 2:121059355-121059377 CTGGGCTCCTGGGGCAGAGGTGG + Intergenic
938227264 2:129626753-129626775 ATGCTCTCCTGGAGAAGAAGAGG + Intergenic
938421960 2:131153419-131153441 CAGCTCTCCTGGGGCCCAGGAGG - Intronic
938942228 2:136179387-136179409 TTTCTCTCCTGGGTCAGAACAGG - Intergenic
940905256 2:159163404-159163426 CTGCTCCCCAGTGGCAGAAGAGG + Exonic
941207272 2:162589623-162589645 CTGCTCTGCTGGGGGAGTGGAGG - Intronic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
946052836 2:216878433-216878455 CTTCTCTGCTGGTGCTGAAGGGG - Intergenic
946130206 2:217600777-217600799 CTACTGTCCTGGTGGAGAAGAGG + Intronic
947151490 2:227121028-227121050 CGGCCCTCCTGGAGCAGCAGGGG - Exonic
948495345 2:238345293-238345315 CTGCCTTCCTGGTGCAGATGAGG + Intronic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948836776 2:240629685-240629707 CTGCTGTCATGGGGCAGGAAAGG - Intronic
948859225 2:240744907-240744929 CTGGGCTCCTGGGGCAGCAGGGG - Intronic
948988478 2:241540214-241540236 GTGAGCTCCTGGGGCAGAGGTGG + Intergenic
949020708 2:241739644-241739666 CTGCTCACTTGGGGCAGCAGTGG + Intronic
1168899934 20:1354807-1354829 CTCCTTTCCTTAGGCAGAAGGGG + Intronic
1168902538 20:1377335-1377357 CGGATGTCCTGGGGCAGAATGGG + Intronic
1169112457 20:3043005-3043027 CTTCTCTCCTGGCGAAGAAGCGG - Intergenic
1170593600 20:17789608-17789630 CTTCTCTCCTGGGGTTGATGTGG - Intergenic
1170864108 20:20137798-20137820 CTGCTTTTCTGAAGCAGAAGTGG + Intronic
1171143884 20:22765216-22765238 GTGCTCTCCTGACGCACAAGAGG + Intergenic
1172662955 20:36579951-36579973 CTGCTTTCCTGGAGCAGAGGCGG + Intronic
1173596602 20:44262572-44262594 CTGCCTGCCTGGGGCACAAGGGG - Intronic
1174055633 20:47796284-47796306 CTGCTGTCCTGGTAGAGAAGGGG + Intergenic
1175410142 20:58762386-58762408 CTGCTGGCTCGGGGCAGAAGAGG - Intergenic
1175918426 20:62438424-62438446 CAGCACTTCTGGGGCAGCAGTGG + Intergenic
1175978314 20:62724679-62724701 CTGGTCTCTTGGGGCTGCAGAGG + Intronic
1176240794 20:64074986-64075008 CTGCTCCCCTGGGGGAGATGGGG + Intronic
1176241225 20:64076811-64076833 CTGCTCCCCTGGGGGAGATGGGG - Intronic
1178916137 21:36706430-36706452 CTGCTCTCTTGGAGCACCAGGGG - Intronic
1179308396 21:40175533-40175555 ATGTCCTCCCGGGGCAGAAGGGG + Intronic
1179501726 21:41813396-41813418 CTGCAGTCCAGGGGCAGAGGAGG + Intronic
1179722071 21:43321663-43321685 CTCCTCTTCTGGGGCCCAAGGGG + Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180184246 21:46131643-46131665 CTGCCCTCCTGGGAGGGAAGGGG - Intronic
1180800601 22:18630192-18630214 CTGCACTCCTGGGGCCTAAAAGG + Intergenic
1180851833 22:19025749-19025771 CTGCACTCCTGGGGCCTAAAAGG + Intergenic
1181043865 22:20205475-20205497 CTCCTCTCCTGGGGCTAAGGAGG - Intergenic
1181221118 22:21365070-21365092 CTGCACTCCTGGGGCCTAAAAGG - Intergenic
1181476047 22:23168435-23168457 CTCCTCTCCTGAGGGAGAAGCGG + Intergenic
1182361721 22:29750471-29750493 CAGATCTCCTGGGTCAGGAGTGG - Intronic
1183485989 22:38088075-38088097 CTTCTCTCCTGCAGCAGGAGTGG + Intronic
1184426576 22:44412276-44412298 CTCCTCTCCTGGGGAATAGGAGG + Intergenic
1184479738 22:44739304-44739326 CTCCTGCCCTGGGGCAGGAGGGG + Intronic
1185086870 22:48745666-48745688 CTGTTCATCTGGGGCAGCAGCGG + Intronic
1185124498 22:48999999-49000021 CTGCTCTCTTGGGACTGAATTGG + Intergenic
949894867 3:8761488-8761510 CTGCTGGCCTGGGGCGGCAGGGG + Intronic
950484486 3:13265032-13265054 CTGCTTTCCAGGGGGAGAAGGGG - Intergenic
950882740 3:16336294-16336316 GGGATCTCCTGGGGCAGAAGAGG - Intronic
952976895 3:38704283-38704305 CATCTTTCCTGGGGCAGGAGGGG + Intronic
953054256 3:39375175-39375197 CTGCTCTCCTTTGACAGATGAGG + Intergenic
953272879 3:41462813-41462835 ATGCTCTCCTTGGTCAGGAGTGG + Intronic
953333312 3:42072448-42072470 CTGGTTTCCTGTGGCAGGAGAGG + Intronic
953406113 3:42660590-42660612 CCCTTCTCCTGGGCCAGAAGAGG - Intronic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953910425 3:46890006-46890028 CTTATCTCCTGGGGATGAAGGGG - Intronic
953921270 3:46953670-46953692 CAGCTTTGCTGGTGCAGAAGAGG + Intronic
954458148 3:50611183-50611205 TTGCTAGCCTGGGGCAGGAGAGG + Intronic
958901765 3:99895489-99895511 CTGATCTCCTTTTGCAGAAGAGG + Intronic
960171787 3:114470937-114470959 CTGATCTCCTGGAGCAGACCTGG + Intronic
960722915 3:120642220-120642242 GTCCTGTCCTGGGGTAGAAGAGG + Intronic
962308785 3:134311656-134311678 CTGCTCTCCAGGGGAAGTAGGGG - Intergenic
962355933 3:134694256-134694278 CTGCTCTCCTGGTCCAGAATAGG + Intronic
962866431 3:139451459-139451481 CTCCTCTCCTGGGGCAGACAGGG - Intergenic
962898564 3:139737290-139737312 CTGCTCTCCTATGGCCGAAGAGG - Intergenic
964128155 3:153258379-153258401 ATGCTATTTTGGGGCAGAAGGGG + Intergenic
964749729 3:160043113-160043135 CTGATGTCCAAGGGCAGAAGAGG - Intergenic
966885937 3:184378200-184378222 CTTCTCTGATTGGGCAGAAGTGG - Intronic
967854261 3:194104559-194104581 GTGCTCCCCTGGGGCTGCAGTGG - Intergenic
967865161 3:194184045-194184067 CGGCTTTCCTGGGCCAGAAAGGG - Intergenic
968063859 3:195747441-195747463 CTCTTCTGCTGGGGAAGAAGAGG + Intronic
968189955 3:196660439-196660461 TTGCTGTACTGGGGCAGCAGCGG - Exonic
969214611 4:5711694-5711716 CCTCCCTCCTGGAGCAGAAGGGG - Intronic
969581566 4:8068500-8068522 CTCCTCTGCTGGGACAGGAGGGG - Intronic
969928993 4:10611950-10611972 CTGCTCTTTGGGGGCAGAATCGG - Intronic
970224593 4:13844467-13844489 ATGCTCTCCTGGGGCTGAAAAGG + Intergenic
972579197 4:40379919-40379941 CTCCTTTCCTGAAGCAGAAGGGG - Intergenic
972705435 4:41538249-41538271 CTGCTGTGCTGGGGCTGACGAGG + Intronic
977609351 4:99016397-99016419 CTACTCTCCTGGAGGAGGAGGGG + Intronic
978852831 4:113358439-113358461 CTGTTCTTCTGGGGAAGAATCGG - Exonic
981727652 4:147864247-147864269 CTGATCCCCTGGGAGAGAAGGGG - Intronic
982026652 4:151258631-151258653 CTGCTCTCCCAGGACAGCAGGGG + Intronic
982028585 4:151276933-151276955 CTGCTCTCCCAGGACAGCAGGGG + Intronic
983521457 4:168713402-168713424 CTGCTCTCCAGGGAGAGAAAGGG + Intronic
984609969 4:181826930-181826952 CTTCTTTCCTGGGAAAGAAGAGG - Intergenic
984799892 4:183704964-183704986 CTGAGGTCCTGTGGCAGAAGAGG - Exonic
985012069 4:185593065-185593087 CTGCTCACCTGGAGCAGAACAGG - Intronic
986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG + Intergenic
986789298 5:11144509-11144531 CTTGTCTCCTGGGGCACAAAGGG + Intronic
988766104 5:34379790-34379812 CTGCACTCCTGAGGCAACAGTGG + Intergenic
990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG + Intergenic
990976272 5:61564463-61564485 CTGCTTTGCTGGGACAAAAGTGG + Intergenic
992985882 5:82229165-82229187 CCCCTCTCCTGAGGCAGAAATGG + Intronic
993254975 5:85579158-85579180 CTGCTCTTCAGCTGCAGAAGTGG + Intergenic
994095454 5:95843511-95843533 CTCCTCTTCTGTGGCTGAAGTGG - Intergenic
995510092 5:112900582-112900604 CTGCTTTGCTGGGGTAGAAGGGG + Intronic
996168264 5:120254014-120254036 TTCCTCTTCTGGTGCAGAAGTGG - Intergenic
996594476 5:125185300-125185322 CTGCTTTTCTGAAGCAGAAGAGG - Intergenic
996954228 5:129164199-129164221 CTGCACTCCTGCTGCAGCAGTGG + Intergenic
997184372 5:131866677-131866699 CCTCCCTCCTGGGGCTGAAGAGG - Intronic
997520079 5:134517666-134517688 CTTCTCACCTGGCACAGAAGTGG + Intergenic
997552380 5:134764718-134764740 CAGCTCTCCTGGAGCAGAATTGG - Intronic
998001330 5:138628538-138628560 CTAATCACCTAGGGCAGAAGAGG - Intronic
998026826 5:138824223-138824245 CTGCTCTTCTTTGACAGAAGGGG + Intronic
998064795 5:139149200-139149222 CTGCTCACCTGGGGTTGAAATGG - Intronic
1001547661 5:172580421-172580443 CTGCTCTCCAGGAGCAGCTGGGG - Intergenic
1002712699 5:181204763-181204785 GTGCTCTCCCGGGGCAGCCGCGG + Exonic
1004156292 6:13171181-13171203 CGGCTCTACTTGGGCGGAAGTGG - Intronic
1005807777 6:29491106-29491128 CTGCTCACCTTGGGCAGGTGTGG + Intergenic
1006756876 6:36423746-36423768 CAGGTGTCCTGGGCCAGAAGTGG + Intronic
1006990759 6:38212846-38212868 ATGCGCTGCTGGGGGAGAAGGGG - Intronic
1007034304 6:38658981-38659003 CTGCTGTCCTAGGGTAGAAGTGG + Intergenic
1007101626 6:39251650-39251672 CTGTTGCCCTGGGGGAGAAGGGG + Intergenic
1007190087 6:40007423-40007445 TTGCTCTCATGGGGCATGAGGGG - Intergenic
1007595170 6:43046703-43046725 CTGCTCTGCTGGTGCTGTAGAGG - Intronic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1008495138 6:52125391-52125413 CCTCCCTCCTGGGACAGAAGTGG - Intergenic
1009918358 6:70024959-70024981 CTGCTCTTCTGTGACAGAACTGG - Intronic
1010597110 6:77777434-77777456 CCCCTTTCCTGAGGCAGAAGCGG - Intronic
1012889984 6:104886493-104886515 CTCCTCTCCTCAGGCAGGAGAGG - Intergenic
1012982991 6:105849723-105849745 CTTCTCTCCTCTAGCAGAAGAGG - Intergenic
1013124783 6:107172362-107172384 CTAGTTTCCTTGGGCAGAAGTGG - Intronic
1014389514 6:120843352-120843374 CTGACCTGCAGGGGCAGAAGGGG - Intergenic
1014875184 6:126649856-126649878 CCTCTCTCCTGGGGAAGAATGGG + Intergenic
1015629065 6:135213068-135213090 GTGCTTTCCTGGTGCAGAAAAGG + Intronic
1015860182 6:137668501-137668523 TTACTCTCCTGAGGCAGCAGTGG + Intergenic
1015929907 6:138348869-138348891 CTGCTCTCTTTGGGAACAAGGGG + Intergenic
1016382339 6:143497735-143497757 CTGCTCTCATGGAGCTGAAAAGG + Intronic
1017056511 6:150441462-150441484 TTGCTGTCTTGGGGCAGCAGAGG - Intergenic
1017707906 6:157140798-157140820 TGCCTCTCCCGGGGCAGAAGCGG - Intronic
1018131217 6:160733946-160733968 CAGCTCACGTGGGGCAGGAGAGG - Intronic
1018659655 6:166074112-166074134 GGCCTCTCCTGAGGCAGAAGCGG + Intergenic
1019350876 7:553410-553432 CTGCACTTCTGCGGCAGACGCGG - Intronic
1019434620 7:1015620-1015642 CTGCTCTCCTGGGTCAGTCCTGG - Intronic
1019448994 7:1086733-1086755 CAGCTCTCCTGGGGGGGAGGGGG + Intronic
1019863448 7:3682670-3682692 CTGCTCTCCTCTCTCAGAAGGGG + Intronic
1020650399 7:10868135-10868157 CTGCCCTCCTGGAGCAGCAAAGG - Intergenic
1020999950 7:15316337-15316359 TTCCTCTACTGTGGCAGAAGAGG - Intronic
1023187275 7:37545348-37545370 CTCCAATCCTGGGGCCGAAGTGG + Intergenic
1023592711 7:41796350-41796372 CTGCTCTCCTAGGGCAGAGGTGG - Intergenic
1023774424 7:43590715-43590737 CAGCTCTCTTGGGGCTGATGAGG - Intronic
1026097555 7:67358460-67358482 CTGCTCTCCTTGGCCAGGCGTGG - Intergenic
1026933513 7:74238451-74238473 CCACCCTCCAGGGGCAGAAGTGG + Intronic
1026947798 7:74327551-74327573 CTGCTCTCCTGGGGCTGGGAAGG - Intronic
1027367885 7:77477445-77477467 GTGCTCTCCTGGGGACAAAGAGG + Intergenic
1028106536 7:86885690-86885712 CTACTCTCCTGTGGGAAAAGAGG + Intronic
1028488531 7:91385938-91385960 CTGTTCTCCTTGGGCTCAAGTGG - Intergenic
1031070660 7:117157741-117157763 CTGCTCTCCTGTGCCAAGAGTGG - Intronic
1031648456 7:124256297-124256319 CTGCTCTTCAGAGGCAGATGGGG + Intergenic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032800568 7:135314301-135314323 CTGCTCTACTGGGGAAAAAAAGG - Intergenic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1033994476 7:147328809-147328831 CAGCTCTCTTGGTGCAGCAGTGG + Intronic
1034078854 7:148258212-148258234 CCACGCTCCTGGGGCAGGAGTGG + Intronic
1034207081 7:149326916-149326938 ATGCTCTCCTGGGGCTCAACTGG - Intergenic
1034401054 7:150861738-150861760 CTGTAGTCCTGGGGCAGAGGGGG + Intergenic
1034521184 7:151621335-151621357 ATGCTCTTCTGTAGCAGAAGAGG + Intronic
1034962706 7:155372599-155372621 CTTCTCTCCCTGGGGAGAAGCGG - Intergenic
1035216225 7:157369454-157369476 CTTCTCTTCTGGGGCACACGAGG + Intronic
1035777797 8:2203116-2203138 CTGGTCTCCTGGTGCAGCATCGG + Intergenic
1036501586 8:9319386-9319408 CTGCTGCCCTGGAGCTGAAGAGG - Intergenic
1036664454 8:10729937-10729959 CTCCTCTGCTGGGACAGGAGCGG - Intronic
1037772558 8:21811074-21811096 CTTCTCTCCTGGGGCCCAGGAGG - Intronic
1038391554 8:27206818-27206840 CTGTTCTCCTAGGGCAGTGGAGG + Intergenic
1039468958 8:37802024-37802046 CTGCCCACCTAGGGGAGAAGAGG + Intronic
1039885365 8:41651205-41651227 CTGCTCCCCTAGGGAAGAGGAGG + Intergenic
1039895523 8:41714116-41714138 CTGCTCTCCAGGGGCAGCTGGGG + Intronic
1040566461 8:48571997-48572019 CAGCTCTCTGGGGGCAGAAAGGG + Intergenic
1042958920 8:74281847-74281869 CAGCTCTCCTGGGAAGGAAGAGG - Intronic
1045547722 8:103142961-103142983 GTGCTGTCCTGGGGCTGAAGTGG - Intronic
1045649525 8:104329015-104329037 ATGCTGTCTTGGGGCAGAACTGG - Intergenic
1045660827 8:104435968-104435990 CTTTCCTCCTGGGGCAGAAAGGG + Intronic
1046368068 8:113262445-113262467 CTGCACTCATGGGGAAGGAGTGG - Intronic
1048603118 8:135940087-135940109 CTGCTTACCTAGAGCAGAAGTGG - Intergenic
1048875394 8:138833243-138833265 CTGTTCTCCTGGGGCAGGATGGG - Intronic
1048984628 8:139728663-139728685 CTTCTCTACTGGGACAGAAAGGG + Intergenic
1049468567 8:142764856-142764878 GGGCCCTCCTGGGGCAGACGTGG + Intronic
1049660580 8:143818068-143818090 CTGCCCACCTGGGGAAGAGGCGG + Exonic
1049662267 8:143824750-143824772 ATGCCCTCCTGAGGCAGCAGCGG + Intronic
1049738436 8:144222335-144222357 ATGCTCTCCTCTGGCAGCAGGGG + Intronic
1050008623 9:1161571-1161593 TTGCTCTGCTGGGGCAGATTTGG + Intergenic
1050151915 9:2625212-2625234 TACCTCTCCTGGAGCAGAAGGGG - Intronic
1050613883 9:7381804-7381826 CTGCTCACCAGGGCCAGCAGGGG - Intergenic
1051365294 9:16317422-16317444 CTGCTCCTCTGGGGCAGTTGGGG + Intergenic
1051662095 9:19435153-19435175 TTGCTGTCCTGTAGCAGAAGAGG + Intronic
1055277816 9:74639775-74639797 CTACTTTCCTGGGGGAGAAGGGG + Intronic
1055607191 9:77983101-77983123 CTGCTGTACTGGGGTAGAAAGGG + Intronic
1055833012 9:80405435-80405457 CTGCTTACCTGAAGCAGAAGTGG + Intergenic
1057263227 9:93597895-93597917 ATGCTCTCCTGGGGAGGAGGAGG - Intronic
1060229331 9:121815110-121815132 CTGCTCCCCAAGGGTAGAAGGGG + Intergenic
1060674163 9:125497097-125497119 CTCCTCTCCTGGGGCCTCAGGGG + Intronic
1060897182 9:127225340-127225362 CTGCGCTCCTGCGGCAGAAGAGG + Intronic
1061216622 9:129225412-129225434 CTGCCCTCATAGGGCAGCAGGGG + Intergenic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062482735 9:136759947-136759969 CCTCTCGCCTGGGGCAGCAGTGG - Intronic
1062629339 9:137456805-137456827 CTGTTTCCCTTGGGCAGAAGAGG + Intronic
1186196288 X:7113074-7113096 CTGCTCAGCTGGGGCAGCAGTGG + Intronic
1186427800 X:9477990-9478012 TTCCTCTCCTGGGGATGAAGGGG - Intronic
1186809332 X:13172218-13172240 TAGTTCTCCTGGGGCAGGAGTGG - Intergenic
1187096286 X:16151869-16151891 ATGCTCTCCTGAGGAAAAAGGGG + Intronic
1187528388 X:20074268-20074290 CTGCTCTCCTGGGAGAGAGGAGG + Intronic
1189075062 X:37906014-37906036 CTGCTCCCCTGGGTTAGGAGCGG + Intronic
1189578863 X:42384501-42384523 TTGCTCTACAGGGGCATAAGGGG + Intergenic
1189952367 X:46245774-46245796 TTGTTTACCTGGGGCAGAAGGGG - Intergenic
1190827769 X:54033137-54033159 CTGCGCTCCGGTGGCAGAAAGGG - Intronic
1194218941 X:91167757-91167779 CTTTTCTTCTGGGACAGAAGTGG + Intergenic
1198315389 X:135460932-135460954 TTGCTGGTCTGGGGCAGAAGGGG - Intergenic
1200326000 X:155240019-155240041 GTGCCCTCATGTGGCAGAAGGGG + Intergenic
1200555453 Y:4631513-4631535 CTTTTCTTCTGGGACAGAAGTGG + Intergenic