ID: 1113786291

View in Genome Browser
Species Human (GRCh38)
Location 13:113003616-113003638
Sequence GGACCACCCTGGACAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 532}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113786278_1113786291 17 Left 1113786278 13:113003576-113003598 CCCATCCTGCAGTTCCCTCCTGA 0: 1
1: 0
2: 5
3: 35
4: 261
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786284_1113786291 2 Left 1113786284 13:113003591-113003613 CCTCCTGAAGGACCAGGCAAAGC 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786276_1113786291 21 Left 1113786276 13:113003572-113003594 CCACCCCATCCTGCAGTTCCCTC 0: 1
1: 0
2: 5
3: 77
4: 620
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786285_1113786291 -1 Left 1113786285 13:113003594-113003616 CCTGAAGGACCAGGCAAAGCCAG 0: 1
1: 0
2: 4
3: 15
4: 233
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786279_1113786291 16 Left 1113786279 13:113003577-113003599 CCATCCTGCAGTTCCCTCCTGAA 0: 2
1: 0
2: 6
3: 41
4: 383
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786277_1113786291 18 Left 1113786277 13:113003575-113003597 CCCCATCCTGCAGTTCCCTCCTG 0: 1
1: 0
2: 3
3: 44
4: 437
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786283_1113786291 3 Left 1113786283 13:113003590-113003612 CCCTCCTGAAGGACCAGGCAAAG 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786275_1113786291 26 Left 1113786275 13:113003567-113003589 CCTGGCCACCCCATCCTGCAGTT 0: 1
1: 0
2: 4
3: 34
4: 322
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786281_1113786291 12 Left 1113786281 13:113003581-113003603 CCTGCAGTTCCCTCCTGAAGGAC 0: 1
1: 0
2: 2
3: 14
4: 182
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786287_1113786291 -10 Left 1113786287 13:113003603-113003625 CCAGGCAAAGCCAGGACCACCCT 0: 1
1: 1
2: 1
3: 17
4: 220
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532
1113786274_1113786291 27 Left 1113786274 13:113003566-113003588 CCCTGGCCACCCCATCCTGCAGT 0: 1
1: 1
2: 0
3: 43
4: 457
Right 1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113786291 Original CRISPR GGACCACCCTGGACAAGAGG AGG Intronic
901271487 1:7955228-7955250 AGACCACCCTGGCCAACATGGGG - Intronic
901541977 1:9924084-9924106 AGACCAGCCTGGCCAAGATGGGG - Intronic
901769677 1:11523984-11524006 GGACGTCCCTGGAGAAGAAGAGG + Exonic
901928908 1:12584273-12584295 AGACCACCCTGGAGAGGAAGTGG + Intronic
902072023 1:13748793-13748815 GGACCTCCCTGGACCAGAGCAGG + Intronic
902460635 1:16573665-16573687 GGACTACCCTGGCCAATATGGGG + Intronic
902798563 1:18815271-18815293 GGAGAACCCTGGACAAGATGGGG + Intergenic
902931840 1:19736877-19736899 GGATCACCCTGGATGAGAGTGGG + Intronic
903061880 1:20674461-20674483 AGACCAGCCTGGACAACATGGGG - Intronic
903374042 1:22854643-22854665 GGACCACCCTGTGCAATGGGAGG - Intronic
905288386 1:36902986-36903008 AGACCAGCCTGGCCAAGATGGGG - Intronic
905629500 1:39510871-39510893 GGACCAGCCGGGCCAAGAAGGGG + Intronic
905739653 1:40359299-40359321 AGACCAGCCTGGACAACATGGGG - Intronic
907582140 1:55582132-55582154 GGTCTACCCTGGACAAGGGTGGG + Intergenic
908837302 1:68240792-68240814 AGACCAGCCTGGCCAAGATGGGG + Intergenic
909145430 1:71924087-71924109 AGACCATCCTGGACAACACGGGG - Intronic
912404360 1:109424575-109424597 AGACCAGCCTGGCCAAGATGAGG + Intronic
913285687 1:117224467-117224489 AGACCACCCTGGCCAACAAGGGG + Intergenic
913604782 1:120454911-120454933 GGACTACCCTGGCCAACATGGGG - Intergenic
913641651 1:120817625-120817647 GGACTACCCTGGCCAATATGGGG - Intronic
914083757 1:144434300-144434322 GGACTACCCTGGCCAATATGGGG + Intronic
914189778 1:145399576-145399598 GGACTACCCTGGCCAATATGGGG + Intronic
914211628 1:145585282-145585304 GGACTACCCTGGCCAATATGGGG + Intergenic
914276830 1:146132713-146132735 GGACTACCCTGGCCAATATGGGG + Intronic
914365982 1:146978461-146978483 GGACTACCCTGGCCAATATGGGG - Intronic
914486461 1:148114964-148114986 GGACTACCCTGGCCAATATGGGG + Intronic
914537874 1:148583668-148583690 GGACTACCCTGGCCAATATGGGG + Intronic
914586791 1:149070120-149070142 GGACTACCCTGGCCAATATGGGG + Intronic
914628049 1:149481677-149481699 GGACTACCCTGGCCAATATGGGG - Intergenic
914943921 1:152047236-152047258 AGACCAGCCTGGACAACATGGGG - Intronic
915276627 1:154793296-154793318 GTACCTTCCTGGCCAAGAGGAGG - Intronic
916028899 1:160859706-160859728 AGACCACCCTGGGCAACATGGGG + Intronic
917796479 1:178536588-178536610 AGACCAGCCTGGGCAAGATGGGG + Intronic
919299963 1:195748711-195748733 GGACCAGCCTGGGCAATAGCAGG - Intergenic
919910179 1:202106395-202106417 GGGCCACCAGGGATAAGAGGGGG - Intergenic
920033307 1:203049868-203049890 GTCCCACCCTGAACAGGAGGAGG - Intronic
920164184 1:204024005-204024027 GGACCAGCCTGGACAACATAGGG + Intergenic
920204549 1:204282108-204282130 GGACCACCCAGGCCCAGAGCAGG - Intronic
920220627 1:204397324-204397346 AGACCACCCTGGGCAACATGGGG + Intergenic
920336800 1:205250340-205250362 AGACCACCCTGGCCAACATGAGG + Intronic
920421303 1:205835759-205835781 GGACCACCTTGGGCAAGAATCGG + Intronic
920601558 1:207329808-207329830 AGACCAGCCTGGACAACATGAGG - Intronic
920721310 1:208389554-208389576 AGACCAACCTGGACAACATGGGG - Intergenic
920981869 1:210844320-210844342 AGACCATCCTGGACAACATGGGG + Intronic
922724873 1:227918130-227918152 GGACAGCCCTGAAGAAGAGGAGG - Intergenic
922724945 1:227918334-227918356 GGAGGACCCTGGAGAGGAGGAGG - Intergenic
922724963 1:227918388-227918410 GGAGGAACCTGGACAGGAGGAGG - Intergenic
922767778 1:228164953-228164975 AGACCAGCCTGGACAACATGGGG + Intergenic
922772691 1:228195962-228195984 AGACCACCCTGGGCAACATGGGG - Intergenic
923351488 1:233111600-233111622 AGACCACCCTGGACAACATAGGG - Intronic
924522178 1:244814978-244815000 AGACCAGCCTGGACAACATGGGG + Intergenic
924585748 1:245359739-245359761 AGACCAGCCTGGACAACATGAGG - Intronic
924867118 1:247995756-247995778 GGACCAGCCTGGGCAACAGAAGG - Intronic
1062845455 10:700013-700035 AGACCACCCTGGAGAACAGACGG + Intergenic
1062985013 10:1760371-1760393 GGACCAGCCTGGCCAACATGGGG - Intergenic
1063284175 10:4664819-4664841 GGACCAGCCTGGCCAACATGGGG - Intergenic
1063435330 10:6025032-6025054 AGACCAGCCTGGACAACATGGGG + Intronic
1064657407 10:17569763-17569785 AGACCAGCCTGGCCAACAGGGGG - Intergenic
1066570876 10:36770383-36770405 AGACCAGCCTGGACAACATGAGG + Intergenic
1067095614 10:43297625-43297647 GGGCCACCCAGGTCAAGGGGTGG - Intergenic
1067703377 10:48589373-48589395 GGACAACCCTGGGCAACAGCAGG - Intronic
1070271130 10:74956118-74956140 GGACCAACCTGGGCAACACGGGG - Intronic
1071615040 10:87067422-87067444 AGACCAGCCTGGACAACATGGGG - Intronic
1072284110 10:93896192-93896214 AGACCACCCTGGGCAACACGGGG - Intronic
1073280280 10:102348948-102348970 AGACCAGCCTGGACAATATGGGG + Intronic
1074522311 10:114236901-114236923 GGGTCCCCTTGGACAAGAGGGGG + Intergenic
1074535968 10:114328884-114328906 GGAACACCCTGGGGTAGAGGTGG + Intronic
1074941309 10:118238331-118238353 AGAACACCCTGGACATGAGTCGG - Intergenic
1075043122 10:119124325-119124347 AGACCACCCTGGCCAACATGGGG + Intronic
1076449252 10:130545008-130545030 TGACCACACTGCACAGGAGGAGG - Intergenic
1076876151 10:133216749-133216771 GGAACACCATAGCCAAGAGGTGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078198228 11:9154949-9154971 AGACCAACCTGGCCAACAGGAGG + Intronic
1078452744 11:11452649-11452671 GGACCACCTTTGACATAAGGGGG + Intronic
1078750777 11:14161515-14161537 AGACCAGCCTGGACAACACGCGG - Intronic
1079855742 11:25601676-25601698 AGACCAGCCTGGACAACACGGGG - Intergenic
1080074799 11:28136233-28136255 GGCCCACCCTCGACACAAGGGGG - Intronic
1080828685 11:35870982-35871004 TGGTCACCCTGGACCAGAGGTGG - Intergenic
1081154797 11:39677036-39677058 GTACCACCCTGGATAAGGAGAGG + Intergenic
1082039000 11:47669445-47669467 GGATCACCTTGGTCAGGAGGTGG + Intronic
1082293583 11:50412038-50412060 GGACCAAACTGGACAAGACCAGG - Intergenic
1082293591 11:50412078-50412100 GGACCAAACTGGACAAGACCAGG - Intergenic
1083138256 11:60700345-60700367 AGACCAGCCTGGCCAACAGGGGG + Intronic
1084174211 11:67415325-67415347 GGCCCACCATGGAGAAGAGATGG - Intronic
1084344012 11:68531488-68531510 AGACCAGCCTGGGCAACAGGTGG - Intronic
1085139412 11:74127203-74127225 AGACCAGCCTGGGCAACAGGGGG - Intronic
1086579961 11:88387860-88387882 AGACCAGCCTGGCCAAGATGGGG + Intergenic
1087677556 11:101180415-101180437 AGACAACCCTGGACATGTGGTGG + Intergenic
1088913840 11:114212074-114212096 GGTCCACACTGTACAAAAGGAGG - Intronic
1089099732 11:115952487-115952509 GGGCCAGCCTGGACCTGAGGAGG + Intergenic
1089293915 11:117456871-117456893 AGACCAGCCTGGACAACATGGGG - Intronic
1089555543 11:119314352-119314374 GGACCACCTTGGACAACATAGGG - Intronic
1090096976 11:123751999-123752021 GGAGTGCCCTGGCCAAGAGGAGG + Intergenic
1090388860 11:126374251-126374273 AGACCAGCCTGGACAACATGGGG + Intronic
1091275618 11:134347403-134347425 GCACCACCCTGGACATCAGGTGG - Exonic
1091649481 12:2299249-2299271 GGCCCTCCCTGGACATCAGGGGG + Intronic
1092146455 12:6218024-6218046 AGACCAGCCTGGACAACATGGGG + Intronic
1092646105 12:10574075-10574097 AGACCAGCCTGGACAACACGTGG - Intergenic
1093020103 12:14195421-14195443 AGACCAGCCTGGACAACAGAGGG + Intergenic
1093055557 12:14552700-14552722 GGACCAGCCTGGGCAACATGGGG + Intronic
1093928082 12:24928438-24928460 AGACCAGCCTGGGCAAAAGGGGG + Intronic
1095098056 12:38158439-38158461 GGACCACCCTGGCCCAGCGAAGG - Intergenic
1096205483 12:49718178-49718200 GGACCAGCCTGGGCAACAGTGGG + Intronic
1096420810 12:51455771-51455793 GTACCTCCCTGAAAAAGAGGGGG - Intronic
1096858239 12:54501702-54501724 AGACCACCCTGGCCAACATGGGG - Intronic
1098267482 12:68737364-68737386 AGACCAGCCTGGACAACATGGGG + Intronic
1098952796 12:76659168-76659190 GGACCAGCCTGGCCAAGATGGGG + Intergenic
1101251957 12:102945702-102945724 GGACTGCCCTGGGCCAGAGGGGG - Intronic
1101438998 12:104688920-104688942 AGACCAGCCTGGGCAAGAAGGGG + Intronic
1102083924 12:110120669-110120691 AGACCACCCTGGCCAATATGCGG - Intergenic
1102109784 12:110356256-110356278 AGACCAGCCTGGCCAAGATGGGG + Intergenic
1102114626 12:110393527-110393549 GGACCAACCTGGGCAAATGGTGG + Intronic
1102264540 12:111472064-111472086 GGACCACCCTGGGCAACATGGGG + Intronic
1103468227 12:121159216-121159238 AGACCAGCCTGGCCAAGATGGGG + Intronic
1103496801 12:121369043-121369065 AGACCACCCTGGCCAACATGGGG + Intronic
1103911052 12:124352565-124352587 AGACCAGCCTGGACAAAAAGAGG - Intronic
1104209191 12:126670972-126670994 AGACCATCCTGGACAACACGGGG + Intergenic
1105219652 13:18313779-18313801 AGACCTCCAAGGACAAGAGGGGG + Intergenic
1105728311 13:23187068-23187090 GGATCAGCCTTGCCAAGAGGAGG + Intronic
1106544690 13:30720058-30720080 AGACCACCCTGGCCAACAAGGGG - Intronic
1107495936 13:40925754-40925776 AGACCAGCCTGGGCAAGATGGGG + Intergenic
1108247664 13:48533322-48533344 GGAACTCCCTGGAAAAGCGGAGG - Intergenic
1108299022 13:49055363-49055385 GGAGTGCCCTGGCCAAGAGGTGG - Intronic
1112444200 13:99449230-99449252 AGACCAACCTGGACAACATGGGG - Intergenic
1112465679 13:99642614-99642636 AGACCAGCCTGGACAACATGGGG - Intronic
1112529879 13:100190761-100190783 GGACCAGCCTGGACAAAATAAGG + Intronic
1113005908 13:105701819-105701841 AGACCAGCCTGGACAATATGGGG - Intergenic
1113786291 13:113003616-113003638 GGACCACCCTGGACAAGAGGAGG + Intronic
1113928422 13:113953620-113953642 GGACCTCCCTGTCCTAGAGGTGG + Intergenic
1114448077 14:22805165-22805187 AGACCAGCCTGGCCAAGATGGGG + Intronic
1115255033 14:31391335-31391357 AGACCAGCCTGGCCAAGATGGGG - Intronic
1115660545 14:35490102-35490124 AGACCAGCCTGGACAACATGGGG - Intergenic
1115791937 14:36889689-36889711 AGACCAGCCTGGACAACATGTGG - Intronic
1116001664 14:39249339-39249361 GGACCAGCCTGGACAACATAAGG - Intronic
1117270683 14:54140197-54140219 GGACCAGCCTGGACAAAACAAGG + Intergenic
1118230104 14:63939544-63939566 AGACCAGCCTGGACAACATGGGG - Intronic
1118523848 14:66618274-66618296 AGACCAGCCTGGACAACATGTGG - Intronic
1119845992 14:77830351-77830373 AGACCATCCTGGTCAAGATGGGG - Intronic
1120525122 14:85568551-85568573 GGACCAAATTGCACAAGAGGTGG + Intronic
1120800343 14:88681408-88681430 AGACCAGCCTGGCCAAGATGGGG + Intronic
1121072438 14:91036788-91036810 GGGCAACCCTGAACTAGAGGGGG - Intronic
1122906889 14:104805730-104805752 GGCCCACCCTGGCCAGGAGTGGG - Intergenic
1123067174 14:105624572-105624594 GGCTCACCGTGGACAAGAGCAGG - Intergenic
1123414522 15:20085377-20085399 AGACCAGCCTGGACAACATGGGG - Intergenic
1123523864 15:21092488-21092510 AGACCAGCCTGGACAACATGGGG - Intergenic
1124485197 15:30108198-30108220 AGACCAGCCTGGACAACATGGGG - Intergenic
1124518381 15:30389074-30389096 AGACCAGCCTGGACAACATGGGG + Intronic
1124540272 15:30577174-30577196 AGACCAGCCTGGACAACATGGGG - Intergenic
1124758381 15:32430404-32430426 AGACCAGCCTGGACAACATGGGG + Intergenic
1124832642 15:33163814-33163836 AGACCAGCCTGGACAACATGAGG - Intronic
1125017746 15:34954113-34954135 AGACCAACCTGGACAACATGGGG - Intronic
1125664190 15:41417228-41417250 GGACCACCATGGTAAAGAAGCGG + Exonic
1125802802 15:42465097-42465119 AGACCAACCTGGACAATATGGGG - Intronic
1126573059 15:50172340-50172362 AGACCAGCCCGGCCAAGAGGGGG - Intronic
1126768322 15:52031129-52031151 AGACCAGCCTGGCCAACAGGGGG - Intronic
1126940630 15:53761625-53761647 AGACCAGCCTGGACAATAGGAGG + Intronic
1127167764 15:56265369-56265391 AGACCAGCCTGGGCAAGAGGAGG - Intronic
1127305787 15:57704694-57704716 GGAGGACCCTGGACTACAGGAGG - Intronic
1127727686 15:61766352-61766374 GGACCAGCCTGGCCAACATGGGG + Intergenic
1128066435 15:64767622-64767644 GTCCCACCCTGGACATGGGGAGG + Intronic
1128686248 15:69687983-69688005 AGACCAGCCTGGACAACATGAGG - Intergenic
1130551721 15:84893668-84893690 AGCCCACCATGGAGAAGAGGGGG - Intronic
1131076459 15:89498216-89498238 AGACCACCCTGGGCAAGATAGGG - Intergenic
1131237489 15:90709701-90709723 AGACCAACCTGGACAACAGCAGG + Intergenic
1131324202 15:91426796-91426818 AGACCAGCCTGGCCAAGATGGGG + Intergenic
1131523076 15:93131240-93131262 GCCCCACCCTGGACATGTGGAGG + Intergenic
1132537258 16:488605-488627 AGACCAGCCTGGGCAACAGGGGG - Intronic
1132618977 16:855509-855531 GAGCAACCCTGGACATGAGGGGG - Intronic
1132898533 16:2240407-2240429 GGACCAGCCTGGCCAACATGAGG - Intronic
1133130723 16:3674725-3674747 GGACCAGCCGGGACCTGAGGGGG + Intronic
1133219431 16:4313299-4313321 AGTCCAACCTGGACAAGAGAAGG + Intergenic
1133448870 16:5886687-5886709 GGACCAGCCTGGCCAATATGGGG + Intergenic
1133632257 16:7632105-7632127 AGACCAGCCTGGCCAAGATGGGG - Intronic
1133913327 16:10085808-10085830 GGATCCCCCTGGCCAAGAAGGGG + Intronic
1133980019 16:10626352-10626374 AGACCACCCTGGCCAAGGTGGGG - Intergenic
1135179254 16:20258639-20258661 AGACCAGCCTGGGCAACAGGGGG + Intergenic
1135270617 16:21066565-21066587 AGACCAGCCTGGACAAGATGGGG - Intronic
1135490362 16:22904216-22904238 GGACCAACTGGGACAGGAGGTGG - Intronic
1136080530 16:27849731-27849753 GGACCAGCCTGGACAACACAGGG - Intronic
1136099894 16:27986299-27986321 AGACCAGCCTGGACAATATGGGG + Intronic
1136415989 16:30104262-30104284 GGCCCAGCCTGGTCTAGAGGAGG + Intergenic
1136509271 16:30725821-30725843 AGACCAGCCTGGTCAAGAGTGGG - Intronic
1136692159 16:32039879-32039901 GGAGCACTCAGGACATGAGGAGG + Intergenic
1136792702 16:32983317-32983339 GGAGCACTCAGGACATGAGGAGG + Intergenic
1136877154 16:33870737-33870759 GGAGCACTCAGGACATGAGGAGG - Intergenic
1137284428 16:47003330-47003352 AGACCAGCCTGGACAATATGGGG + Intergenic
1137586748 16:49668398-49668420 GGACCTGCCTGGGCAAGAGAAGG - Intronic
1138658538 16:58504230-58504252 GGATGCCCCTGGACAACAGGTGG + Exonic
1138671656 16:58620440-58620462 GGACCAGCCTGGCCAACATGAGG + Intronic
1139928123 16:70503248-70503270 AGACCAGCCTGGACAACATGGGG - Intronic
1141241190 16:82266696-82266718 GGAGCACCCTGGCCTAGAGGAGG + Intergenic
1141527343 16:84619800-84619822 AGACCAGCCTGGATAACAGGGGG + Intergenic
1141947407 16:87320104-87320126 GGAGCACCCTGGGCTAGTGGTGG + Intronic
1203094912 16_KI270728v1_random:1244796-1244818 GGAGCACTCAGGACATGAGGAGG + Intergenic
1203139583 16_KI270728v1_random:1752389-1752411 GGACCATCATGGAAAAGAGCAGG - Intergenic
1142603268 17:1067661-1067683 TGACCACTCTTGATAAGAGGTGG - Intronic
1142650035 17:1343043-1343065 AGACCAGCCTGGACAACATGGGG - Intergenic
1142694090 17:1623800-1623822 GGTACACCCTGGAGGAGAGGAGG - Intronic
1142694103 17:1623844-1623866 GGTACACCCTGGAGGAGAGGAGG - Intronic
1142694110 17:1623866-1623888 GGTACACCCTGGAGGAGAGGAGG - Intronic
1142694690 17:1627436-1627458 GGAACACCCTGGACAGCAGGTGG + Intronic
1142748244 17:1971629-1971651 AGACCAGCCTGGACAACAGAAGG + Intronic
1142885675 17:2910895-2910917 AGACCAGCCTGGCCAACAGGGGG - Intronic
1143376499 17:6470530-6470552 GGAGCACCCTGGCCTGGAGGAGG + Intronic
1143387944 17:6543213-6543235 AGACCACCCTGGACCTGAGGTGG - Intronic
1143596916 17:7920253-7920275 AGACCAGCCTGGACAACATGGGG - Intergenic
1143703483 17:8679911-8679933 AGACCAGCCTGGCCAAGAGACGG - Intergenic
1144720083 17:17462993-17463015 AGACCATCCTGGCCAACAGGGGG + Intergenic
1144950582 17:18991558-18991580 GGGCCACACTGGGCAGGAGGCGG + Intronic
1145265674 17:21378555-21378577 CGAGCACCCTGGAGACGAGGAGG + Intronic
1145392252 17:22464666-22464688 GGATCCCCTTGGTCAAGAGGGGG + Intergenic
1145949513 17:28805157-28805179 GGACCAACCTGGACAACATAGGG + Intronic
1146224293 17:31052269-31052291 GGACCACCCTGGAGGAGGGCTGG - Intergenic
1146725211 17:35150549-35150571 AGACCAGCCTGGACAACATGGGG + Intronic
1146802914 17:35841600-35841622 GGACCAGCCTGGGCAACATGGGG - Intronic
1147327035 17:39674576-39674598 GGACCACCCTGTGCAGGAGGGGG + Intronic
1147372016 17:39998882-39998904 GGACCAGCTTGGACAACATGGGG + Intergenic
1147930589 17:43977999-43978021 AGACCAGCCTGGGCAACAGGGGG + Intronic
1149624646 17:58072160-58072182 GGACCAGCCTGGCCAACATGGGG + Intergenic
1149752973 17:59163864-59163886 AGACCAGCCTGGCCAAGATGGGG + Intronic
1150375861 17:64681151-64681173 AGACCACCCTGGCCAAAATGGGG + Intergenic
1150565157 17:66332424-66332446 AGACCACCCTGGCCAACATGGGG - Intronic
1150709987 17:67522866-67522888 TGACCACCCTGGACAACATAGGG - Intronic
1151424242 17:74019893-74019915 AGACCAGCCTGGACAACATGGGG - Intergenic
1151710696 17:75804253-75804275 AGACCAGCCTGGCCAAGATGGGG + Intronic
1151874363 17:76858213-76858235 GGAGTGCCCTGGCCAAGAGGAGG - Intergenic
1153107355 18:1542792-1542814 AGACCAGCCTGGCCAACAGGGGG + Intergenic
1153982000 18:10318095-10318117 GGAATGCCCTGGCCAAGAGGAGG - Intergenic
1154269297 18:12905540-12905562 AGACCAGCCTGGCCAAGATGGGG + Intronic
1154944849 18:21151730-21151752 AGACCACCCTGGCCAACATGGGG + Intergenic
1155247513 18:23924348-23924370 AGACCAGCCTGGACAACATGGGG - Intronic
1155953275 18:31935702-31935724 AGACCAGCCTGGACAACAGAGGG + Intronic
1156042940 18:32843721-32843743 GTACCACTCCGGAAAAGAGGAGG + Intergenic
1160698158 19:494477-494499 GCACCAGCCTGGGCAGGAGGGGG + Intronic
1160750504 19:731858-731880 GGACCAGCCTGGCCAACATGGGG - Intronic
1160912492 19:1481393-1481415 GGCCCACCCTGCTCCAGAGGAGG + Intergenic
1160920425 19:1517169-1517191 AGACCAGCCTGGGCAACAGGGGG - Intergenic
1161557076 19:4949900-4949922 ACTCCACCCTGGACAAGAGAGGG - Intronic
1161873159 19:6886312-6886334 AGACCAGCCTGGCCAAGATGGGG - Intergenic
1162385385 19:10357833-10357855 GCACCGCCATGGACAAGTGGGGG - Exonic
1162761251 19:12889779-12889801 GGACCAGCCTGGCCAACATGGGG - Intergenic
1164149966 19:22542251-22542273 GGACCATCCTGGGCAAAATGGGG - Intergenic
1164161715 19:22630211-22630233 AGACCAGCCTGGCCAACAGGAGG - Intergenic
1164851393 19:31487231-31487253 AGACCAGCCTGGGCAAGATGGGG - Intergenic
1165131286 19:33634016-33634038 AGACCAGCCTGGACAACATGGGG - Intronic
1165202462 19:34156288-34156310 AGACCAGCCTGGACAGGAGAGGG + Intergenic
1165549882 19:36574499-36574521 GGAATGCCCTGGCCAAGAGGAGG + Intronic
1165788982 19:38479609-38479631 AGACCAGCCTGGACAATATGAGG - Intronic
1165867534 19:38948172-38948194 AGACCAGCCTGGCCAACAGGGGG - Intronic
1166195333 19:41202184-41202206 GGACCAGCCTGGCCAACATGGGG - Intronic
1166353692 19:42214561-42214583 AGACCAGCCTGGACAACAAGGGG + Intronic
1166371881 19:42306500-42306522 AGACCACCCTGGACAACATAGGG - Intronic
1166836115 19:45669084-45669106 GGACCGCCTTGGAGAGGAGGGGG - Intronic
1166926181 19:46270045-46270067 GGACCAGCCTGGGCAACAGAGGG + Intergenic
1167122233 19:47524505-47524527 AGACCACCCTGGCCAACATGGGG + Intronic
1167646274 19:50706974-50706996 AGACCAGCCTGGACAACATGGGG - Intronic
1168027952 19:53657269-53657291 GGACCAGCCTGGCCAACATGGGG - Intergenic
1168137734 19:54362682-54362704 AGACCAGCCTGGACAACATGGGG - Intronic
1168189907 19:54730353-54730375 AGACCACCCTGGCCAACATGGGG + Intronic
1168695409 19:58401252-58401274 GGCCCGCCCGGGGCAAGAGGAGG - Intergenic
1202677070 1_KI270711v1_random:17394-17416 GGACTACCCTGGCCAATATGGGG + Intergenic
925124886 2:1447064-1447086 GGAACACCCTTGCCAACAGGAGG - Intronic
926529244 2:14021669-14021691 TGACCAGCAAGGACAAGAGGTGG + Intergenic
926649231 2:15323630-15323652 AGACCAGCCTGGACAACACGAGG + Intronic
926654547 2:15386930-15386952 GTACCTCCCTGGTCCAGAGGGGG - Intronic
927159387 2:20243080-20243102 GGCTCGCCCTGGAGAAGAGGAGG - Intergenic
927194023 2:20535466-20535488 GGACCACCCTGGGCAACACAGGG + Intergenic
927297882 2:21476188-21476210 AGACCAGCCTGGACAACATGAGG + Intergenic
927813574 2:26194442-26194464 GGACCTTCCTAGACAAGAGCAGG + Intronic
928120693 2:28581759-28581781 GGACCAGCCTGGGCAACATGGGG + Intronic
928570217 2:32599439-32599461 AGACCAGCCTGGACAACATGGGG + Intronic
929518650 2:42627274-42627296 AGACCACCCTGGACAACATAGGG - Intronic
929537907 2:42795513-42795535 AGACCAGCCTGGACAACATGGGG - Intergenic
929656405 2:43736633-43736655 AGACCAGCCTGGCCAACAGGGGG + Intronic
931399271 2:61915693-61915715 AGACCACCCTGGACGATATGGGG - Intronic
932635722 2:73386176-73386198 GGACCTCCCTGGAGAAGGTGAGG + Exonic
932765632 2:74467830-74467852 AGACCAGCCTGGACAAGATGAGG + Intergenic
933827081 2:86172166-86172188 AGACCAGCCTGGGCAAGAGAGGG - Intronic
934184396 2:89658740-89658762 AGACCTCCAAGGACAAGAGGGGG - Intergenic
934294681 2:91732878-91732900 AGACCTCCAAGGACAAGAGGGGG - Intergenic
934611765 2:95743582-95743604 AGACCAGCCTGGACAATATGGGG + Intergenic
935160948 2:100528915-100528937 GGACCACCAAGCACAAGAAGGGG - Intergenic
935274800 2:101466893-101466915 CGACCAACCTGGAGGAGAGGAGG + Exonic
935718277 2:105957936-105957958 GCCCCATCCTGGAGAAGAGGTGG - Intergenic
936083444 2:109450895-109450917 GGATCACCCTGGACACTAGATGG + Intronic
936950699 2:117974713-117974735 GGAACTCCCTGGGGAAGAGGAGG + Intronic
937160576 2:119757898-119757920 GGACCACCCTGGAGTAGCAGGGG - Intergenic
937941049 2:127286348-127286370 AGACCAGCCTGGCCAAGATGGGG + Intronic
940866741 2:158825016-158825038 AGACCAGCCTGGACAACATGGGG - Intronic
940884380 2:158976030-158976052 GGACCAGCCTGGGCAACATGGGG - Intronic
940931741 2:159440707-159440729 AGACCAGCCTGGCCAAGATGGGG - Intronic
941016602 2:160364504-160364526 AGATCACCCTGGCTAAGAGGAGG - Intronic
941103403 2:161323462-161323484 GGACCAGCCTGGCCAACATGGGG + Intronic
943014222 2:182491500-182491522 GGACTACGCTGGAAAATAGGAGG + Intronic
944872426 2:203927559-203927581 AGACCAGCCTGGACAACATGGGG - Intergenic
945529514 2:210932949-210932971 GGGTCACCTTGGCCAAGAGGAGG + Intergenic
946074929 2:217065844-217065866 GGTTCAGCCTGGAGAAGAGGAGG - Intergenic
947027376 2:225751792-225751814 GGACCAGCATGGACAACATGGGG - Intergenic
948125603 2:235562856-235562878 AGACCAGCCTGGACAACATGGGG + Intronic
948428718 2:237904822-237904844 GGATCACTCTGGGTAAGAGGTGG + Intronic
948657655 2:239486614-239486636 AGACCACCCTAGACACCAGGAGG - Intergenic
948852679 2:240716036-240716058 GGGCCACCCAGGACAGGACGGGG - Exonic
1169631300 20:7635344-7635366 AGACCAACCTGGACAACATGGGG - Intergenic
1170344513 20:15368659-15368681 GGACCAGCCTGGCCAACATGGGG - Intronic
1170565443 20:17599618-17599640 GGACACCACTGGCCAAGAGGAGG - Intronic
1170685809 20:18568441-18568463 GGACCAGCCTGGGCAACATGGGG + Intronic
1170881686 20:20302461-20302483 GGACCAGCCTGGCCAACATGGGG + Intronic
1171461356 20:25299815-25299837 GGCACACCCTGGCCAGGAGGGGG + Intronic
1172561171 20:35889925-35889947 AGACCAGCCTGGACAACATGAGG - Intronic
1172693681 20:36807382-36807404 AGAGCAGCCTGGACTAGAGGAGG + Intronic
1172705078 20:36877180-36877202 AGACCAGCCTGGCCAACAGGAGG + Intronic
1173735803 20:45360414-45360436 GGACCAGCCTGGACAACATAGGG + Intergenic
1174010546 20:47446247-47446269 AGACCAGCCTGGACAAGATAGGG + Intergenic
1174245279 20:49174958-49174980 AGACCACCCTGGCCAACATGGGG + Intronic
1174836725 20:53862789-53862811 GGACCATCATGGAAAAGAGCAGG - Intergenic
1174911356 20:54611361-54611383 AGACCAGCCTGGACAACATGGGG + Intronic
1175258993 20:57663293-57663315 GGAGCACCCTGGAGAGGAGCAGG + Intronic
1176606006 21:8831657-8831679 GGACCACCCTGGGCAACATAGGG + Intergenic
1177260776 21:18726356-18726378 GGGCCAGCCTGGACAACAGAGGG - Intergenic
1178846513 21:36178290-36178312 AGACCAGCCTGGACAACATGGGG + Intronic
1179675681 21:42980172-42980194 AGACCAGCCTGGCCAAGATGGGG + Intronic
1180603530 22:17037551-17037573 GGAGCGCCCTGGCCCAGAGGCGG + Intergenic
1180610537 22:17094182-17094204 AGACCAGCCTGGCCAAGAGATGG - Intronic
1180817253 22:18798667-18798689 AGACCTCCAAGGACAAGAGGGGG + Intergenic
1181203443 22:21232988-21233010 AGACCTCCAAGGACAAGAGGGGG + Intergenic
1182545587 22:31074187-31074209 AGACCAGCCTGGACAACATGGGG + Intronic
1183412409 22:37662787-37662809 AGACCACCCTGGCCAACATGAGG + Intronic
1183917403 22:41133040-41133062 AGACCAACCTGGACAAGACCTGG - Intronic
1184217652 22:43078295-43078317 AGACCACCCTGGCCAACATGGGG + Intronic
1184601391 22:45545664-45545686 AGACCACACTGGACAGGTGGAGG + Intronic
1184788319 22:46682858-46682880 AGACCAGCCTGGACAACATGGGG + Intergenic
1184869386 22:47225691-47225713 GGGACACCCTGGCCATGAGGAGG - Intergenic
1203223478 22_KI270731v1_random:62426-62448 AGACCTCCAAGGACAAGAGGGGG - Intergenic
1203267352 22_KI270734v1_random:24394-24416 AGACCTCCAAGGACAAGAGGGGG + Intergenic
950225165 3:11227483-11227505 AGACCAGCCTGGACAACATGGGG - Intronic
950405359 3:12800919-12800941 AGACCAGCCTGGCCAACAGGGGG - Intronic
950927947 3:16761332-16761354 TGAACACCCAGGACAGGAGGTGG - Intergenic
951644141 3:24868519-24868541 GGATGCCCCTGGCCAAGAGGAGG - Intergenic
951862123 3:27264691-27264713 AGACCACCCTGGCCAACATGGGG + Intronic
952186754 3:30978002-30978024 AGACCAGCCTGGACAACATGGGG - Intergenic
953321255 3:41973914-41973936 GGACCACCCTGGTCAACATGCGG - Intergenic
954261796 3:49444515-49444537 AGACCAGCCTGGACAACATGGGG - Intergenic
954327455 3:49871218-49871240 GCACCAGCCTGGCCTAGAGGAGG - Intergenic
954528598 3:51296918-51296940 AGACCACCCTGGCCAACATGGGG + Intronic
954721812 3:52570919-52570941 AGACCAGCCTGGACAACAGAAGG - Intronic
955369675 3:58340319-58340341 GGACCAGCCTGGGCAACATGGGG - Intronic
956182561 3:66531101-66531123 GGACCAGCCTGAACAACATGGGG - Intergenic
956759702 3:72429653-72429675 AGACCAGCCTGGACAAAATGGGG + Intronic
956979670 3:74621138-74621160 AGACCAGCCTGGACAACATGGGG + Intergenic
957468012 3:80621093-80621115 AGACCAGCCTGGACAACATGGGG - Intergenic
958267050 3:91450159-91450181 AGACCAGCCTGGCCAACAGGTGG - Intergenic
959145718 3:102542022-102542044 AGACCAGCCTGGACAACATGGGG + Intergenic
959547511 3:107614148-107614170 AGACCATCCTGGCCAAAAGGGGG - Intronic
960117519 3:113911442-113911464 AGACCACCCTGGCCAACATGAGG - Intronic
960193898 3:114741672-114741694 AGACCAGCCTGGCCAAGATGGGG + Intronic
960348022 3:116558972-116558994 AGACCAGCCTGGCCAACAGGGGG + Intronic
960690572 3:120342200-120342222 GGCCCACCCTGGTCCAAAGGTGG - Intronic
961005582 3:123403179-123403201 GGACCAGCCTGGGCAATATGGGG + Intronic
961016353 3:123471224-123471246 AGTCCACCCTGGACTGGAGGGGG - Intergenic
961492236 3:127263946-127263968 GGGCAGCCCTGGACAAGGGGAGG + Intergenic
961857531 3:129887341-129887363 AGACCACCCTGGCCAACATGGGG + Intronic
962224442 3:133593924-133593946 AGACCAGCCTGGACAACATGGGG - Intergenic
962336042 3:134531382-134531404 AGACCAGCCTGGCCAAGATGGGG + Intronic
962652773 3:137513226-137513248 AGACCAGCCTGGCCAACAGGAGG - Intergenic
964750792 3:160052098-160052120 AGACCAGCCTGGACAACATGGGG - Intergenic
965572087 3:170182757-170182779 AGACCACCCTGGGCAACATGGGG + Intergenic
966202188 3:177368755-177368777 GGACCAGCCTGGCCAACATGGGG - Intergenic
966750423 3:183316541-183316563 AGACCAGCCTGGACAACATGGGG - Intronic
967021077 3:185523603-185523625 AGACCACCCTGGGCAACAGAGGG - Intronic
967069340 3:185949158-185949180 AGACCAGCCTGGACAACAGTGGG + Intergenic
967607990 3:191470969-191470991 CTACCTCCCTGGACAAAAGGTGG - Intergenic
967692682 3:192495057-192495079 AGACCAGCCTGGCCAAGATGGGG - Intronic
968163100 3:196443122-196443144 AGACCAGCCTGGCCAAGAGAGGG + Intergenic
968180390 3:196591031-196591053 GAACCATGCTGGACAAGTGGTGG + Intergenic
968307862 3:197661429-197661451 GGAACAGCCTGGAAAGGAGGCGG + Intergenic
968403640 4:319857-319879 GGACCAGCCTGGCCAATATGGGG + Intergenic
968919945 4:3517280-3517302 AGACCATCCTGGAGACGAGGCGG + Intronic
969421154 4:7096831-7096853 GGTTCACACTGGCCAAGAGGTGG + Intergenic
970386856 4:15564873-15564895 AGACCACCCTGGGCAAAATGGGG - Intronic
970786502 4:19803716-19803738 GGCCCAGCCTGAACAACAGGTGG + Intergenic
970831574 4:20346192-20346214 AGACCAGCCTGGACAAGAGAGGG - Intronic
971819220 4:31530332-31530354 GGCCCTCCCTGGTCAAGAGCAGG + Intergenic
972303822 4:37812333-37812355 GGACCAGCCTGGGCAAGACAGGG - Intergenic
972774831 4:42231065-42231087 AGACCAGCCTGGACAACATGGGG - Intergenic
974155037 4:58060495-58060517 GAAACACCCTGGACAAAAGCAGG + Intergenic
974270591 4:59646515-59646537 AGACCACCCTGGACAACATTGGG - Intergenic
975682933 4:76895245-76895267 GGAGAAACCTAGACAAGAGGCGG - Exonic
976752212 4:88460788-88460810 AGACCAGCCTGGACAACATGGGG + Intronic
978423029 4:108554165-108554187 GGAGTGCCCTGGCCAAGAGGAGG - Intergenic
978580495 4:110226977-110226999 AGACCACCCTGGGCAACATGTGG + Intergenic
978823627 4:112993904-112993926 AGACCAGCCTGGCCAAGATGGGG - Intronic
980127011 4:128783981-128784003 AGACCACCCTGGACAACATAGGG - Intergenic
980530264 4:134044127-134044149 AGACCAGCCTGGACAACATGGGG - Intergenic
980914868 4:139024800-139024822 GGACCAGCCTGGCCAACACGGGG - Intronic
981094356 4:140762919-140762941 AGACCAGCCTGGACAACATGGGG - Intergenic
982044993 4:151435584-151435606 GGACCAGCCTGGCCAACATGGGG + Intronic
982918533 4:161245098-161245120 AGACCAGCCTGGCCAAGATGGGG + Intergenic
982946346 4:161629541-161629563 GGACCAGCCTGGCCAACATGGGG - Intronic
983297490 4:165884635-165884657 AGACCACCCTGGCCAACATGGGG + Intronic
983973213 4:173899780-173899802 GGTCCTCCCTGAAAAAGAGGGGG - Intergenic
984477783 4:180259088-180259110 AGACCAGACTGGACAAGATGAGG - Intergenic
985090726 4:186360209-186360231 GAAACACCCAGGACAAGAAGGGG - Intergenic
985209069 4:187572574-187572596 GGATAACCCTGGATAAGAGTGGG + Intergenic
985717713 5:1471951-1471973 GGAGCACCCAGGACAGGGGGAGG + Intronic
986053074 5:4108392-4108414 GGACCACAGTGGAGTAGAGGAGG + Intergenic
986053171 5:4109113-4109135 GGACCACATTGGAATAGAGGTGG - Intergenic
986247961 5:6028353-6028375 AGACCAGCCTGGCCAAGATGGGG + Intergenic
986326300 5:6677578-6677600 GGAACACCGTGGAGAAGAGGTGG + Intergenic
986400930 5:7379160-7379182 AGACCAGCCTGGGCAAGATGGGG - Intergenic
987409738 5:17603131-17603153 AGACCAGCCTGGACAACATGGGG - Intergenic
987690259 5:21257146-21257168 GGACCAGCCTGGCCAACATGGGG + Intergenic
987944204 5:24583841-24583863 AGACCAGCCTGGCCAAGATGAGG - Intronic
988990258 5:36663437-36663459 GGACCAGCCTGGCCAACATGGGG - Intronic
989361732 5:40608986-40609008 AGACCAGCCTGGGCAAGATGGGG - Intergenic
989578986 5:43014436-43014458 AGACCACCCTGGGCAACATGGGG - Intergenic
990069997 5:51770421-51770443 AGACCACCCTGGCCAACATGGGG + Intergenic
990168397 5:53019722-53019744 AGACCAGCCTGGCCAAGATGGGG - Intronic
992573865 5:78090983-78091005 CGACCAGCCTGGACAACATGGGG - Intronic
992637306 5:78737174-78737196 AGACCACCCTGGGCAACATGGGG - Intronic
992695295 5:79280040-79280062 GGACCAGCCTGGGCAACAGATGG - Intronic
992722077 5:79570569-79570591 GGGTCCCCTTGGACAAGAGGGGG + Intergenic
992724416 5:79591968-79591990 GGACCAGCCTGGGCAACATGGGG - Intergenic
992912515 5:81410748-81410770 AGACCAGCCTGGACAACATGGGG - Intergenic
993382218 5:87220989-87221011 AGACCAGCCTGGCCAAGATGGGG - Intergenic
994622625 5:102180914-102180936 GCACACACCTGGACAAGAGGGGG + Intergenic
996717149 5:126597045-126597067 GGACCAGCCTGGGCAACATGGGG - Intergenic
996844781 5:127887127-127887149 AGACCAGCCTGGCCAACAGGGGG + Intergenic
997330730 5:133059247-133059269 AGACCAGCCTGGCCAAGATGGGG + Intronic
998169479 5:139864108-139864130 TGTCCTCCCTGGAGAAGAGGAGG + Intronic
999800670 5:155030944-155030966 AGACCAGCCTGGACAACATGGGG - Intergenic
1000338383 5:160258893-160258915 GGACCATCCTGGCCAACATGGGG - Intronic
1000933539 5:167281313-167281335 AGACCAGCCTGGCCAAGATGAGG - Intergenic
1001821247 5:174712153-174712175 AGACCAGCCTGGGCAAGAGAGGG - Intergenic
1002824436 6:760457-760479 GTCCCTCCCTGGACAAGTGGGGG + Intergenic
1002921035 6:1573594-1573616 TGACCACCCTGAATAAGAGAAGG - Intergenic
1003288355 6:4755267-4755289 AGACCAGCCTGGCCAACAGGGGG - Intronic
1004427221 6:15514484-15514506 GGCCCACCATGGACAAGCAGAGG - Intronic
1004479473 6:16005043-16005065 AGACCACTCAGGAAAAGAGGAGG - Intergenic
1005829534 6:29659440-29659462 GAACCACCCTAGAGAAGGGGGGG - Exonic
1005929038 6:30467077-30467099 AGACCAGCCTGGACAACACGGGG - Intergenic
1007674736 6:43583941-43583963 GGACCAGCCTGGGCAACATGGGG + Intronic
1007806667 6:44455437-44455459 AGACCACCCTGGACAACATGAGG - Intergenic
1008040723 6:46795667-46795689 GGACCAGCCCAGACATGAGGTGG - Intronic
1008262135 6:49379775-49379797 GGACCAGCCTGGCCAACAGACGG + Intergenic
1009302552 6:62044275-62044297 GGACCAGCCTGGACAACAAAAGG + Intronic
1009920643 6:70055581-70055603 GGACCAACCTGGCCAACATGGGG + Intronic
1009939074 6:70268411-70268433 AGACCAACCTGGACAACAGAGGG - Intronic
1009960710 6:70517330-70517352 AGACCAGCCTGGGCAAGATGGGG + Intronic
1010213670 6:73383035-73383057 AGACCAACCTGGCCAACAGGGGG - Intronic
1010240266 6:73608815-73608837 AGACCACCCTGGGCAAGATAGGG + Intronic
1011077694 6:83454972-83454994 GGACCAGCCTGGGCAACATGGGG - Intergenic
1011581791 6:88876328-88876350 AGACCAGCCTGGACAACACGGGG + Intronic
1011624294 6:89270793-89270815 GGACCACACTGGACTAGACTTGG + Intronic
1013082336 6:106823627-106823649 GGACCAGCCTGGACAACAGAAGG - Intergenic
1013607330 6:111762371-111762393 GGATCCCCATGGTCAAGAGGAGG - Intronic
1014629425 6:123771057-123771079 GGTCTACCTTGGCCAAGAGGGGG - Intergenic
1016396011 6:143624303-143624325 AGACCAGCCTGGCCAACAGGGGG - Intronic
1016943647 6:149506792-149506814 AGACCACCCTGGGCAACATGGGG - Intronic
1017199465 6:151736575-151736597 AGACCACCCTGGGCAACATGGGG - Intronic
1017354179 6:153482889-153482911 GGATCCCCATGGCCAAGAGGGGG - Intergenic
1017509979 6:155105492-155105514 AGACCACCCTGGACAACATAGGG - Intronic
1017795364 6:157839678-157839700 GCTTCACCCTGGGCAAGAGGCGG - Intronic
1018171090 6:161143533-161143555 TGACCTCCCTGGAAAAAAGGGGG + Intronic
1018729135 6:166635912-166635934 TGACCACCCTGGTCTAGAGTAGG - Intronic
1018781883 6:167075877-167075899 AGACCAGCCTGGCCAAGATGGGG - Intergenic
1018784334 6:167096271-167096293 GGACCACCCTGGAGACTTGGGGG + Intergenic
1019306501 7:337844-337866 GGGCCTCCCTGGACCAGTGGAGG + Intergenic
1019329382 7:455175-455197 GGCCCAGCCTGGGCAAGACGCGG + Intergenic
1019422754 7:958658-958680 GAACCACCCAGGACCAGAGGTGG + Intronic
1019907583 7:4076353-4076375 AGACCAGCCTGGGCAACAGGGGG + Intronic
1020091263 7:5343153-5343175 AGACCAGCCTGGCCAAGATGGGG + Intronic
1021535643 7:21701486-21701508 AGACCAGCCTGGGCAACAGGGGG - Intronic
1023256360 7:38316785-38316807 GTACAACCCTGAAAAAGAGGAGG + Intergenic
1023384162 7:39638643-39638665 AGACCATCCTGGACAACACGGGG - Intronic
1023742172 7:43290596-43290618 GGGTCATCCTGGCCAAGAGGGGG + Intronic
1023810844 7:43910426-43910448 AGACCAGCCTGGACAACATGGGG - Intronic
1023920827 7:44628552-44628574 GGACCAGCCTGGACAAGGCAAGG + Intronic
1025902453 7:65756686-65756708 AGACCACCCTGGCCAACATGGGG + Intergenic
1026041641 7:66873129-66873151 AGACCAGCCTGGACAACATGGGG - Intergenic
1026175717 7:67995094-67995116 AGACCAGCCTGGACAACATGGGG + Intergenic
1026349933 7:69507029-69507051 AGACCAGCCTGGACAACATGGGG - Intergenic
1026811541 7:73470931-73470953 AGACCAGCCTGGACAACATGGGG - Intronic
1027223918 7:76232323-76232345 AGACCAGCCTGGCCACGAGGAGG + Intronic
1027590767 7:80116129-80116151 AGACCACCCTGGCCAACATGGGG - Intergenic
1027761539 7:82285166-82285188 TGACCACCATCGAGAAGAGGAGG - Intronic
1028418182 7:90602003-90602025 AGACCAGCCTGGGCAACAGGGGG - Intronic
1028432428 7:90762785-90762807 AGACCAGCCTGGGCAACAGGGGG + Intronic
1028559153 7:92154440-92154462 GGACCAGCCTGGGCAACATGGGG - Intronic
1029530408 7:101121675-101121697 AGACCAGCCTGGACAACATGGGG + Intergenic
1029613902 7:101644363-101644385 AGACCAGCCTGGCCAACAGGGGG + Intergenic
1029696382 7:102216103-102216125 AGACCAGCCTGGACAACATGGGG + Intronic
1030514075 7:110519446-110519468 GGACCTCCCTGGACTGAAGGTGG + Intergenic
1032393096 7:131569294-131569316 GGACCAGCCTGGAGCAGAGGCGG + Intergenic
1032958013 7:136995562-136995584 GGACCAGCCTGGACAATATAGGG + Intronic
1033367195 7:140680804-140680826 AGACCAGCCTGGACAACATGAGG - Intronic
1035131781 7:156661273-156661295 GGGCCCCCTTGGCCAAGAGGGGG + Intronic
1035408438 7:158617528-158617550 AGACCAGCCTGGCCAAGAGACGG + Intergenic
1035434569 7:158849940-158849962 GGCCCTCCCTGGCCTAGAGGTGG + Intergenic
1035958989 8:4116190-4116212 GGACCAGCCTGGCCAACATGGGG - Intronic
1036503196 8:9332260-9332282 AGACCAGCCTGGACAACATGGGG - Intergenic
1036593956 8:10195437-10195459 AGACCACCCTGGGCAACATGGGG - Intronic
1037581071 8:20246395-20246417 AGGCCACCTTGCACAAGAGGTGG + Exonic
1038021386 8:23554401-23554423 GGACTACCCTGGACTGGAGAGGG - Intronic
1038140378 8:24838878-24838900 AGACCAGCCTGGACAACATGGGG + Intergenic
1038466363 8:27768001-27768023 GGACCATCCTGGGCAATATGAGG + Intronic
1039278100 8:35954542-35954564 GGACCAGCCTGGCTAAGCGGTGG + Intergenic
1039300889 8:36207462-36207484 AGACCAGCCTGGCCAAGATGGGG - Intergenic
1039321767 8:36439682-36439704 AGACCAGCCTGGACAACACGGGG + Intergenic
1041264664 8:56052687-56052709 AGACCAGCCTGGACAACATGGGG - Intergenic
1041720345 8:60969593-60969615 GGATCCCCTTGGCCAAGAGGGGG + Intergenic
1041977966 8:63821020-63821042 GGAACTCCCTGGACCAGAGTTGG - Intergenic
1044032527 8:87256219-87256241 AGACCACCCTGGCCAACATGAGG - Intronic
1045172290 8:99684999-99685021 AGACCAGCCTGGCCAAGATGGGG - Intronic
1045842477 8:106596245-106596267 GGACCAGCCTGGCCAACATGGGG + Intronic
1048017090 8:130507154-130507176 AGACCAGCCTGGCCAAGATGGGG + Intergenic
1048268009 8:133004674-133004696 GGACCACCCTGTAAAAGTGGAGG + Intronic
1048704885 8:137142634-137142656 GGTCCCCCTTGGCCAAGAGGGGG - Intergenic
1049499112 8:142952069-142952091 GGCCCAGCCTGGAAAAGGGGAGG - Intergenic
1049724029 8:144137319-144137341 GTGCCAGCCTGGACAAGAGCAGG + Intergenic
1051119478 9:13736443-13736465 AGACCAGCCTGGACAAGATAGGG - Intergenic
1051412069 9:16800024-16800046 AGACCAGCCTGGACAACATGGGG + Intronic
1052789017 9:32856747-32856769 AGACCAGCCTGGGCAACAGGGGG + Intergenic
1052945494 9:34165103-34165125 GGACCAGCCTGGCCAACATGGGG - Intergenic
1053034295 9:34810723-34810745 TGACCACCGTGGCCCAGAGGTGG + Intergenic
1055035093 9:71810101-71810123 AGACCAGCCTGGACAACACGGGG + Intronic
1055279474 9:74657804-74657826 GGACCAGCCTGGCCAAGGTGAGG + Intronic
1056884961 9:90433049-90433071 AGACCACGCTGGTCAGGAGGCGG + Intergenic
1057359431 9:94359817-94359839 GCATCACCCTGGAGAAGAGGTGG + Intergenic
1057626960 9:96686564-96686586 AGACCACCCTGGGCAACATGTGG - Intergenic
1057648334 9:96897775-96897797 GCATCACCCTGGAGAAGAGGTGG - Intergenic
1059027264 9:110648500-110648522 GCACCAGCCTGGGCAAGAGAGGG + Intergenic
1060830749 9:126713987-126714009 AGACCAGCCTGGGCAAGAGAGGG + Intergenic
1061083034 9:128383533-128383555 GGGCCATCCTGGGGAAGAGGGGG + Intronic
1061408233 9:130404387-130404409 GGAGCACGCTGGACAAGAAGCGG - Intronic
1061824697 9:133250920-133250942 GGAGTGCCCTGGCCAAGAGGAGG + Intronic
1185992788 X:4910944-4910966 AGACCACCCTGGCCAACATGGGG + Intergenic
1186338577 X:8618871-8618893 AGACCAGCCTGGACAAGAGGGGG + Intronic
1186423747 X:9447078-9447100 AGACCAGCCTGGACAACATGGGG + Intergenic
1187770948 X:22695263-22695285 AGACCAGCCTGGACAACATGGGG + Intergenic
1188026622 X:25216797-25216819 GGACCAGCCTGGCCAACAAGGGG - Intergenic
1189337497 X:40179046-40179068 GGACCAGACTGTAAAAGAGGTGG - Intergenic
1189469033 X:41299843-41299865 AGACCAGCCTGGCCAAGATGGGG + Intergenic
1191030157 X:55961192-55961214 GGGCCACGCTGGACAGTAGGAGG - Intergenic
1192120833 X:68454013-68454035 AGACCACCCTGGGCAACATGGGG + Intergenic
1192319513 X:70078293-70078315 AGACCAGCCTGGCCAACAGGGGG - Intergenic
1192549628 X:72043671-72043693 GGACCACATCGGCCAAGAGGAGG - Intergenic
1194201575 X:90958492-90958514 GGACCTACCTGGTGAAGAGGGGG - Intergenic
1195264823 X:103170068-103170090 GGACCAGCCTGGCCAACATGGGG - Intergenic
1195267409 X:103196274-103196296 AGACCAGCCTGGACAACAGAGGG + Intergenic
1195493051 X:105495840-105495862 GGAACGCCCTGGCCGAGAGGAGG - Intronic
1195578450 X:106475830-106475852 GGTTCCCCCTGGCCAAGAGGGGG - Intergenic
1196433394 X:115652090-115652112 AGACCAGCCTGGACAACACGGGG + Intergenic
1196744223 X:119055033-119055055 AGACCAGCCTGGACAACATGGGG - Intergenic
1197645896 X:129016220-129016242 GGACCAGCCTGGGCAACATGAGG + Intergenic
1198244111 X:134812742-134812764 GATACACCCTGGAAAAGAGGGGG + Intronic
1198497786 X:137210647-137210669 TGTGCATCCTGGACAAGAGGAGG - Intergenic
1200075939 X:153550793-153550815 AGACCACCCTGGGCAACATGAGG - Intronic
1200547415 Y:4533947-4533969 GGACCTACCTGGTGAAGAGGGGG - Intergenic