ID: 1113786463

View in Genome Browser
Species Human (GRCh38)
Location 13:113004443-113004465
Sequence CCCCCATGGCGCAGTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113786448_1113786463 26 Left 1113786448 13:113004394-113004416 CCTCAGTCTGCAGCCGTCACTCC 0: 1
1: 0
2: 6
3: 44
4: 225
Right 1113786463 13:113004443-113004465 CCCCCATGGCGCAGTGCTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 179
1113786453_1113786463 5 Left 1113786453 13:113004415-113004437 CCATGTCTGCAGCTGGGGCCCTG 0: 2
1: 0
2: 4
3: 50
4: 404
Right 1113786463 13:113004443-113004465 CCCCCATGGCGCAGTGCTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 179
1113786449_1113786463 13 Left 1113786449 13:113004407-113004429 CCGTCACTCCATGTCTGCAGCTG 0: 1
1: 0
2: 2
3: 23
4: 288
Right 1113786463 13:113004443-113004465 CCCCCATGGCGCAGTGCTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113786463 Original CRISPR CCCCCATGGCGCAGTGCTGG GGG Intronic
902821430 1:18945690-18945712 CCTCCATGTGGCTGTGCTGGGGG - Intronic
903259961 1:22126282-22126304 CCCACACGGCTCAGGGCTGGGGG - Intronic
904632015 1:31849390-31849412 GTCCCATGGGCCAGTGCTGGAGG + Intergenic
906345379 1:45011251-45011273 CCGCCATGGCGAAGTGGCGGAGG + Exonic
909685755 1:78346587-78346609 CTTCCTTGGCTCAGTGCTGGTGG - Intronic
909800947 1:79806472-79806494 GGACCATGGCCCAGTGCTGGGGG + Intergenic
910330697 1:86069326-86069348 CCCCCATGGACTAGTGGTGGTGG + Intronic
912487157 1:110038259-110038281 CCCTCATGACCCATTGCTGGAGG - Intronic
912899223 1:113630224-113630246 CCCACATGGGCCAGTGTTGGTGG - Intronic
916582826 1:166123789-166123811 CCCTCATGGCGTGTTGCTGGAGG - Intronic
920440969 1:205980112-205980134 CCCCGATGGCACAGAGCTTGTGG + Intronic
922674828 1:227543731-227543753 CCCACATGGCGCTGAGCTTGGGG - Intergenic
1062976277 10:1685828-1685850 GCCCCATGGGGCTGGGCTGGGGG + Intronic
1063365657 10:5488740-5488762 CCACCAGGGCTCAGTGCAGGGGG + Intergenic
1063404058 10:5775873-5775895 GGCCCGTGGAGCAGTGCTGGAGG + Intronic
1063603328 10:7501258-7501280 CCACCGTGGAGCTGTGCTGGTGG + Intergenic
1064678717 10:17787417-17787439 CCCCTATGGCCCAGTCCTGGAGG - Intronic
1070424077 10:76268404-76268426 CCTCCATGGGGCTGTACTGGAGG + Intronic
1073163222 10:101419548-101419570 TCCCCATGGCACAGACCTGGCGG - Intronic
1076219238 10:128719641-128719663 CCCCCATGGAGTCGTGCTGGTGG - Intergenic
1076332449 10:129680443-129680465 CCTGCATGTCTCAGTGCTGGCGG - Intronic
1076919065 10:133441937-133441959 CCCCCATGGCCCAGGGCTGGAGG - Intergenic
1077102643 11:828985-829007 CCCCCACTGCCCAGAGCTGGAGG + Intronic
1083637739 11:64129509-64129531 CCCCCAGGAGGCTGTGCTGGGGG - Intronic
1084371904 11:68750654-68750676 CCTCCATGGCGCAGGGCGGCGGG + Exonic
1086249697 11:84798452-84798474 GCCCCATGGGCCAGTGGTGGTGG - Intronic
1089762162 11:120735810-120735832 TCCCCATGGGCCAGTGGTGGTGG - Intronic
1090550433 11:127813773-127813795 CTCCCATGGGGCAGGGCAGGAGG - Intergenic
1091996481 12:4997842-4997864 CCCCCATGGTGAGGTGCTTGGGG + Intergenic
1096343905 12:50828541-50828563 CACCCATGGGCCAGTGGTGGTGG - Intergenic
1097714772 12:62954714-62954736 CCCCCATGGGCCAGTGGTGGTGG - Intergenic
1103559053 12:121782723-121782745 CCCCCATGGAACAGTGCTTAAGG + Intronic
1106254749 13:28012078-28012100 CCCCCATGGCCCATTGCAGTGGG - Intronic
1106412915 13:29523605-29523627 CCCACAGGGCTGAGTGCTGGAGG - Intronic
1106871984 13:34031451-34031473 CAACCAAGGCGCAGTCCTGGGGG + Intergenic
1107287739 13:38814843-38814865 CCCCCATGGATCAGTGGTGGTGG - Intronic
1112114860 13:96340643-96340665 CACCCAGGGAGAAGTGCTGGTGG - Intronic
1112402424 13:99087510-99087532 CCACCGTGACGCAGAGCTGGCGG + Intergenic
1112595772 13:100805730-100805752 CCACCCTGGCCCAGAGCTGGGGG + Intergenic
1113175488 13:107558936-107558958 CACCCTTGGCTCAGTGCTGTGGG + Intronic
1113786463 13:113004443-113004465 CCCCCATGGCGCAGTGCTGGGGG + Intronic
1114062069 14:19026975-19026997 CCCGCACTGCGGAGTGCTGGAGG + Intergenic
1114100189 14:19373022-19373044 CCCGCACTGCGGAGTGCTGGAGG - Intergenic
1115651360 14:35404602-35404624 CCTCCATGGCCCACTCCTGGGGG + Exonic
1117083588 14:52176960-52176982 CCTCCATGGAGCAGTCCTGTAGG + Intergenic
1117638773 14:57775006-57775028 CCACTATGGTGGAGTGCTGGTGG - Intronic
1118983516 14:70734278-70734300 CCTCCATGAAGCAGTGCTAGGGG + Intronic
1119543013 14:75452977-75452999 CCCCCATGGGGCTGAGCTGTTGG - Intronic
1121440569 14:93946386-93946408 TCCCCATGTAGCAGTGCTGCTGG + Intronic
1121530778 14:94651705-94651727 CCCCCATGGCCCTGTGCCTGGGG + Intergenic
1121584358 14:95052581-95052603 CCCCCAGGGGGCTGTGCTGGTGG - Intergenic
1122919883 14:104875678-104875700 CCCCAGTGGGGCAGTGATGGGGG + Intronic
1126025381 15:44441374-44441396 CCTCTGTGGTGCAGTGCTGGAGG - Intronic
1128884938 15:71278038-71278060 CTCACAAGGCGGAGTGCTGGCGG - Intronic
1131144044 15:90000460-90000482 GCCCCGGGGCGCACTGCTGGGGG - Intergenic
1131144379 15:90001816-90001838 CCCTCATGCCGGAGAGCTGGAGG + Intronic
1131259966 15:90883096-90883118 CCACCAGGGCACAGTGTTGGGGG - Exonic
1132382884 15:101378943-101378965 CCCGCATTGTGCTGTGCTGGTGG + Intronic
1132415074 15:101613766-101613788 CCCCCAACACGCAGTGCTGCAGG - Intergenic
1134688584 16:16175759-16175781 CCCCCATGGTGCCCTGCTGAGGG - Intronic
1136679267 16:31946054-31946076 CCTCCATGGAGCAGTGGTGGTGG + Intergenic
1138335067 16:56246459-56246481 CCACCATCGCCCAGTCCTGGAGG + Intronic
1138443309 16:57047736-57047758 CTCTCATGGGGCAGGGCTGGTGG - Intronic
1139436007 16:66936775-66936797 GCCCCATGGTGCACTGCTGCAGG + Intronic
1142034658 16:87855699-87855721 CCCCCAGGGTCCAGTGTTGGAGG + Intronic
1143781601 17:9232222-9232244 CCCCCAGGCTGCTGTGCTGGAGG + Intronic
1145050320 17:19654568-19654590 CCCTCATTGCCCAGGGCTGGCGG + Intronic
1145974698 17:28977405-28977427 CCCCCATGGCACCGAGGTGGAGG + Intronic
1146543519 17:33718554-33718576 CCCACATGGTGCAGAGATGGAGG + Intronic
1148052093 17:44774485-44774507 CCCCCATGTTGCCGTACTGGGGG - Exonic
1148084722 17:44987305-44987327 TCTCCATGGGGCAGAGCTGGTGG + Intergenic
1148108731 17:45132725-45132747 CCCCCATGCTGCGGGGCTGGGGG + Intronic
1148211312 17:45810527-45810549 GCCGCATAACGCAGTGCTGGTGG - Intronic
1148538403 17:48459944-48459966 CCCCCATGGCACAGCTCTGGTGG + Intergenic
1151567010 17:74904373-74904395 GCCCCATGGGGCAGTGATGTTGG + Intergenic
1152342537 17:79733331-79733353 CTCCCACGGGGCAGTGCAGGAGG + Intronic
1154172957 18:12063897-12063919 ACCCCATGGCCTGGTGCTGGGGG + Intergenic
1155282180 18:24250975-24250997 CCCCCATGGGCCAGTGGTAGTGG + Intronic
1156373826 18:36494708-36494730 ACCCCTTGGGGCTGTGCTGGGGG + Intronic
1157289326 18:46398777-46398799 CCCTCATGGCTCAGTGCTCCTGG + Intronic
1157559888 18:48638588-48638610 GGCCCATGGAGCAGGGCTGGGGG + Intronic
1158668889 18:59456907-59456929 CTCCCATGGTGCAGGGATGGTGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1161001417 19:1912956-1912978 CGCACATGGCGCAGGGCTCGCGG - Exonic
1161384362 19:3983125-3983147 CACCGATGGCGCATTGGTGGTGG - Exonic
1161446740 19:4322966-4322988 CCCCTGTGGCGCAGGGCAGGAGG - Exonic
1161999092 19:7731800-7731822 CCTCCAGGGCTCAGTTCTGGGGG - Intronic
1163057498 19:14731525-14731547 CCCCCACGGTGGAGAGCTGGAGG + Intronic
1165120484 19:33555609-33555631 CCTCCGTGGGGCTGTGCTGGAGG - Intergenic
1166288754 19:41848486-41848508 CCCCCATGGGGCAGTCCTGCTGG + Exonic
1167291614 19:48628089-48628111 CCCCCAGGGCCCAGGGCTAGGGG - Intronic
928101451 2:28439866-28439888 CCCTGATGGAGCAGGGCTGGGGG - Intergenic
933877222 2:86631481-86631503 CCCCCAGGGCGAACTGCTGAAGG - Intronic
941453989 2:165694033-165694055 GCCACATGGCTCACTGCTGGAGG - Intergenic
942814255 2:180033647-180033669 CTCCCATGGACCAGTGGTGGTGG - Intergenic
944500724 2:200356982-200357004 CCCCAATGCAGCAGTGCTGGGGG - Intronic
946922564 2:224594988-224595010 CCCCAATGTGGCAGTGTTGGAGG + Intergenic
1168906140 20:1405260-1405282 ACCACATGGCTCAGTGGTGGTGG + Intergenic
1169593924 20:7176742-7176764 CCCCACTGGGGCACTGCTGGTGG - Intergenic
1170607782 20:17886712-17886734 GCCCCAGGGCCCAGTGGTGGAGG + Intergenic
1171195512 20:23194521-23194543 CAGCCATGGCCCAGTGCTGGTGG - Intergenic
1173248099 20:41349945-41349967 CCCCCATGGGTCAGGGTTGGAGG + Intronic
1173469638 20:43313062-43313084 CACACATGGTGCAGTGGTGGTGG - Intergenic
1175118900 20:56703309-56703331 CGACCCTGGAGCAGTGCTGGGGG + Intergenic
1176374865 21:6082022-6082044 CCCCCACGGGGCTGGGCTGGGGG + Intergenic
1179748610 21:43456223-43456245 CCCCCACGGGGCTGGGCTGGGGG - Intergenic
1179914122 21:44465200-44465222 TCCCCAGGGCTCAGTTCTGGGGG + Intergenic
1180480558 22:15749589-15749611 CCCGCACTGCGGAGTGCTGGAGG + Intergenic
1181005539 22:20011703-20011725 TCCTCGGGGCGCAGTGCTGGTGG - Intronic
1181694536 22:24586284-24586306 CAGCCATGGTGCTGTGCTGGCGG - Exonic
1183931317 22:41237685-41237707 CCGCGATGCCGCAGTGCTGCAGG + Exonic
1184248149 22:43245985-43246007 CCCCCATGCCACAGTCCTGCAGG - Intronic
1184331869 22:43832699-43832721 CCCCTATGGCGCTGGGGTGGGGG - Intronic
1184661386 22:45967145-45967167 CGTCCCTGGCGCAGGGCTGGGGG - Intronic
1185042424 22:48511990-48512012 GCCCCATGGCACAGAGCTGCAGG + Intronic
1185410498 22:50679075-50679097 CCCCCAGGGCGCTGTGGTAGAGG - Intergenic
950429211 3:12941249-12941271 CCCGCATGGCCCAGATCTGGGGG - Intronic
950445455 3:13034932-13034954 CCGACAGGGCACAGTGCTGGTGG + Intronic
950585217 3:13887448-13887470 CCCCCATGGGGCAGCGATGTGGG - Intergenic
950806077 3:15604085-15604107 CCCTCCTGGGGCACTGCTGGTGG - Intronic
950940358 3:16885035-16885057 CGCCCATGGCGGAGTGCGGCCGG + Intronic
951068338 3:18295163-18295185 CCTCCCTGGCACAGTGCTTGTGG - Intronic
951259872 3:20495180-20495202 CTCCCATGGGCCAGTGGTGGTGG - Intergenic
951458643 3:22923274-22923296 CCCGATTGGCGCAGTGATGGAGG + Intergenic
953362362 3:42309273-42309295 CCCCCATGGACCAGTGGTGGTGG - Intergenic
954397967 3:50303028-50303050 CCCCCACTGCTCAGGGCTGGGGG + Exonic
954467281 3:50663407-50663429 CCCACTTGCCACAGTGCTGGTGG + Intergenic
956772618 3:72539261-72539283 ACCCCATGGAGCAGGGATGGAGG + Intergenic
960973803 3:123156966-123156988 CCCCCATGTAGCAGTGCAGGGGG - Intronic
961369676 3:126421859-126421881 CCACCATGACGCCCTGCTGGTGG + Intronic
961742336 3:129040583-129040605 ACCCCATGACGCAGTTCAGGAGG - Exonic
961964387 3:130887607-130887629 CACCCATGGCCCAGTGATAGTGG - Intronic
964179450 3:153865691-153865713 GCCCCATGGGCCAGTGGTGGTGG + Intergenic
964339028 3:155688762-155688784 CCCCCATGGACCAGTGGTAGCGG + Intronic
964514151 3:157489054-157489076 CCATCATGGAGCAGTGGTGGTGG - Intronic
965349925 3:167599362-167599384 TCCCCATGGGACAGTGGTGGTGG - Intronic
966320384 3:178695231-178695253 TCCCCATGGCACAGAGCAGGGGG + Intronic
967867002 3:194198477-194198499 GCCCCATGGCTGAGTGCTGCTGG + Intergenic
968462626 4:732936-732958 CCCCGAAGGCGCAGGTCTGGTGG + Intronic
968484151 4:850655-850677 CCCAGATGGCTCAGCGCTGGTGG - Intronic
969608343 4:8213267-8213289 TCCCCATGGCTGAGGGCTGGGGG + Intronic
970118194 4:12722716-12722738 CCCCCATGGAGCGGGGCTGGAGG - Intergenic
976871316 4:89797075-89797097 CCCCCATGGGGCTGGGGTGGAGG - Intronic
985495063 5:199607-199629 TCCCCATGGGCCAGGGCTGGTGG - Exonic
985857503 5:2441729-2441751 CACCCTTGGCGCAGTGTTGGAGG - Intergenic
986062302 5:4203022-4203044 CCCTCAGGGCACAGTGCAGGGGG - Intergenic
993951071 5:94176078-94176100 CCCCAATGTGGCAGTGTTGGGGG + Intronic
994226226 5:97254321-97254343 TCCCCATGGGCCAGTGGTGGTGG + Intergenic
994274667 5:97821822-97821844 ACCCCATGGACCAGTGGTGGTGG - Intergenic
995045601 5:107643216-107643238 CCCCCATTGTGCAGGGGTGGGGG + Intronic
997442568 5:133919084-133919106 CCCCCATAGGGCAGGGCTGTAGG - Intergenic
999770698 5:154773532-154773554 CCCCCACAGCACTGTGCTGGGGG + Intronic
1001702892 5:173720572-173720594 GCCTCAGGGTGCAGTGCTGGAGG + Intergenic
1001879893 5:175234280-175234302 CCCCCATTGCACAGGGCTGTGGG + Intergenic
1002356963 5:178637827-178637849 GCTCCATGGTGCAGTGTTGGTGG - Intergenic
1007356886 6:41326561-41326583 ACCACATGGGGCTGTGCTGGAGG + Intergenic
1007368150 6:41408889-41408911 GACCCATGGCGCATTGCTGCTGG - Intergenic
1012578225 6:100829440-100829462 CCCTCATTGCCCAGGGCTGGCGG + Intronic
1014542378 6:122692464-122692486 TCCCCATGGGGCTGTGGTGGTGG - Intronic
1016457327 6:144244860-144244882 CCCCCATGGGACTGTGGTGGTGG - Intergenic
1017738109 6:157381602-157381624 CCCTCGGGGCGCAGTGCTCGGGG + Exonic
1019089483 6:169516453-169516475 CCCCCCTGGAGGAGTTCTGGAGG - Intronic
1020020763 7:4866793-4866815 CCCCAAAGGGGAAGTGCTGGAGG + Intronic
1020263952 7:6547938-6547960 ACCCCATGGCCAAGTGCTGCTGG + Intronic
1022112617 7:27240631-27240653 CCTCAAAGGCCCAGTGCTGGAGG + Intergenic
1023937434 7:44749433-44749455 CCCCCACATCGCCGTGCTGGTGG - Intronic
1024480039 7:49853300-49853322 CCCCCATGGGCAAGTGCTGGGGG - Intronic
1024931987 7:54673638-54673660 CCCCCAGGAAGCAGTGCTTGGGG - Intergenic
1024956557 7:54926955-54926977 CCCACATGGATCAGTGGTGGTGG + Intergenic
1025147190 7:56514932-56514954 CCCCAATGTGGCAGTGTTGGGGG - Intergenic
1027386865 7:77667424-77667446 CCCCCATGGCTGAGTCCTAGAGG - Intergenic
1034499327 7:151439900-151439922 GCACCATGGCGCAGCGCTCGGGG - Exonic
1039592038 8:38757317-38757339 CTCCCATGGCGCAGAACTTGGGG - Intronic
1040481510 8:47831627-47831649 CCCTCATGGCGCTCTGGTGGGGG - Intronic
1041389958 8:57339330-57339352 CACCAATGGGGCAGTGCTGCTGG + Intergenic
1047297432 8:123583576-123583598 CCCCCTTGGCTCAGTTCTTGAGG - Intergenic
1049269159 8:141685008-141685030 CAGCCATGGCCCAGAGCTGGTGG - Intergenic
1049328124 8:142034637-142034659 CCGCCATGACCCAGGGCTGGGGG + Intergenic
1049386825 8:142347096-142347118 CCACCAGGGCCCAGAGCTGGAGG - Intronic
1049423474 8:142526935-142526957 CCCCCAAGGCTGGGTGCTGGGGG + Intronic
1051665600 9:19464844-19464866 CCACCAGGGGGCAGTGCTGCCGG + Intergenic
1052204873 9:25827469-25827491 CCACCATGGACCAGTGGTGGTGG - Intergenic
1052732933 9:32310894-32310916 TCCCCATGGCCCCGTGGTGGTGG + Intergenic
1053412241 9:37923291-37923313 CGCCCATGGTGCAGGGCTGACGG + Intronic
1059260668 9:112972887-112972909 CCAGCATGGCTCAGTGGTGGGGG + Intergenic
1061478661 9:130885443-130885465 CAGCCACAGCGCAGTGCTGGAGG + Exonic
1062009079 9:134257438-134257460 CCCCCGGTGCACAGTGCTGGGGG - Intergenic
1062568556 9:137173997-137174019 CCCCGATGGCGCCGTCCTCGCGG - Intergenic
1185484359 X:470994-471016 CCCCCTTAGCCCAGAGCTGGAGG + Intergenic
1185754038 X:2638496-2638518 CCCCCATGGTGCTGTTGTGGCGG + Intergenic
1187129819 X:16491643-16491665 CCCCCATGGCTCACTCCTGCTGG - Intergenic
1190053959 X:47171267-47171289 CCCCCATGGCCCCGGGCAGGAGG + Intronic
1190588105 X:51967563-51967585 CCCCTATAGGGCAGTGTTGGTGG - Intergenic
1192135101 X:68589535-68589557 CCCCCATGGAGCAGTGGTGGTGG + Intergenic
1193194810 X:78619466-78619488 CCCCCATGGGTCTGTGGTGGTGG - Intergenic
1196385133 X:115140708-115140730 CTCCCATGGGCCAGTGGTGGTGG + Intronic
1198430766 X:136564498-136564520 TCCCCATGGGCCTGTGCTGGTGG - Intergenic