ID: 1113787263

View in Genome Browser
Species Human (GRCh38)
Location 13:113009021-113009043
Sequence AGACGACCCCCAGAGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113787263 Original CRISPR AGACGACCCCCAGAGGAGAT TGG Intronic
900241813 1:1620855-1620877 AGACAGCCCCCAGTGGGGATGGG + Intronic
903760637 1:25695833-25695855 AGACGAGGCCCAGAGGAGGCCGG - Intronic
905715437 1:40145519-40145541 AGAGAACCCCCAAAGGAGATGGG - Intergenic
908251067 1:62266261-62266283 AGAGAACACCCAGAGGAAATGGG + Intronic
913047646 1:115088287-115088309 CAACGTCCCCCAGAGCAGATAGG + Intronic
915527215 1:156483288-156483310 TGAGGACCCCCGGAGAAGATGGG - Exonic
919944694 1:202310540-202310562 AGACTACACCCAGAGGTGCTTGG + Intronic
921034601 1:211364722-211364744 AGATAACCCTCAAAGGAGATAGG + Intronic
1067981171 10:51086786-51086808 AGACGAACCTCAGATGAGAAAGG - Intronic
1069574214 10:69515455-69515477 AAATGAGCCTCAGAGGAGATGGG - Intergenic
1072741768 10:97914160-97914182 AGATGGACCCCAGAGGGGATGGG + Intronic
1072950952 10:99846332-99846354 AAACTACCCCCAGAGGAACTGGG - Intronic
1074678296 10:115877994-115878016 AGACGACTCCCAGATCAGAGGGG + Intronic
1077652823 11:3989399-3989421 GGAAGAGCCCAAGAGGAGATCGG - Intronic
1079311211 11:19367597-19367619 AGATGACTCCAAGAGCAGATGGG - Intronic
1083366207 11:62142910-62142932 AAGGGAGCCCCAGAGGAGATCGG - Intronic
1086986888 11:93260918-93260940 AGACCCTCCCCAGAGGAGAATGG - Intergenic
1087419866 11:97908468-97908490 GGAACAACCCCAGAGGAGATCGG - Intergenic
1089607058 11:119647560-119647582 AGAGGGCACCCAGAGGAGGTGGG - Intronic
1093019694 12:14192026-14192048 GGAAGATCCCAAGAGGAGATGGG + Intergenic
1093271806 12:17072023-17072045 AGAAGACCACCATAAGAGATAGG - Intergenic
1095732472 12:45521103-45521125 AGGCGATTTCCAGAGGAGATTGG - Intergenic
1095951360 12:47783628-47783650 AGAGGACCCTGAGAGGAGACGGG - Exonic
1098527030 12:71498425-71498447 AGCTGACCCCCAGAGGACACTGG - Intronic
1098854587 12:75637826-75637848 AGACGATTCCCAGATGACATTGG - Intergenic
1100122371 12:91383602-91383624 AGTCTTCCCCCAGAGGAGAGAGG + Intergenic
1101419324 12:104536782-104536804 ATACAACCACCAGGGGAGATGGG - Intronic
1113787263 13:113009021-113009043 AGACGACCCCCAGAGGAGATTGG + Intronic
1113913767 13:113857952-113857974 AGACGGCCCTCAGAGGAGGCCGG + Intronic
1116598621 14:46888301-46888323 AGAAAACCCTCAGAGAAGATGGG + Intronic
1117405185 14:55395170-55395192 GGAAGAGCCCAAGAGGAGATCGG - Intronic
1118592419 14:67411529-67411551 AAACGAAGCCCAGAGGAGTTAGG - Intronic
1122276206 14:100592029-100592051 AAAGGACCCCCAGGGGACATTGG + Intergenic
1127868033 15:63047846-63047868 AGATGACGCCCAGAGAAGACAGG + Intronic
1130460895 15:84157729-84157751 AGAGGAGCCCCAGAGGACCTGGG - Intergenic
1131763995 15:95655424-95655446 AAAAGATCCCCAGAGGAGTTTGG - Intergenic
1132228400 15:100161949-100161971 AGGCGAACCCCAGAGTAGACTGG + Intronic
1133321290 16:4915182-4915204 CGAAGCCCCCCAGAGGACATGGG + Intronic
1133510980 16:6457164-6457186 AGACGTTTCCCAGAGGAGAAAGG + Intronic
1138510805 16:57507592-57507614 AGACCACCCCCAGTGCAGCTGGG + Intergenic
1149994435 17:61399448-61399470 ACACGACCCCGAGCGGAGAGGGG - Intergenic
1152252321 17:79218551-79218573 GGAAGACCCCCAGAGGAGCCCGG + Intronic
1155086701 18:22466007-22466029 AAACTACCCCCAGAGAAGCTGGG - Intergenic
1160871939 19:1281673-1281695 AGGCCCCCCACAGAGGAGATGGG - Intergenic
1162793776 19:13076341-13076363 AGAAGATCCCTAGAGGAGACTGG - Intronic
1163364773 19:16869772-16869794 AGTAGCCCCCCAGAGGAGAAGGG + Exonic
1163630644 19:18416578-18416600 AGACCACGCCCAGAGGGGAGGGG - Intergenic
1165595611 19:37009497-37009519 TGGCGTCCCCCAGAGCAGATGGG - Intronic
1168602106 19:57726489-57726511 AGACTCCCCCCAGAAGAGAAGGG - Intronic
925647597 2:6052770-6052792 AGACAAGCCTCAGAGGATATAGG - Intergenic
926502920 2:13677631-13677653 AGACCACTGCCAGAGGAGAACGG - Intergenic
931653855 2:64492188-64492210 AGTCAACCCCCAAAGGAGGTAGG + Intergenic
932407971 2:71526556-71526578 AGACCAGGCCCAGAGGACATTGG - Intronic
933687985 2:85158309-85158331 AGAGGACTCCCAGAGGGGACTGG - Intronic
934866686 2:97820531-97820553 AAATGAGCCCCAGAGTAGATGGG - Intronic
934867641 2:97827289-97827311 GGAAGAGCCCAAGAGGAGATCGG + Intronic
936634577 2:114241011-114241033 GGAAGGCCTCCAGAGGAGATGGG - Intergenic
940292401 2:152090129-152090151 AGACCACACCCAGAAAAGATGGG + Intronic
941744593 2:169073536-169073558 AGGGTACCCCCAGAGGAGCTGGG + Intronic
948768312 2:240234500-240234522 AGCTGAACCCCAGAGGAGTTTGG + Intergenic
1169465154 20:5831293-5831315 AGTTGACCCCCAAAGGAGGTGGG - Intronic
1170492784 20:16895949-16895971 AGACAACCCCCAGGGCAGAGAGG + Intergenic
1172182255 20:33010693-33010715 GGAAGGCTCCCAGAGGAGATGGG + Intronic
1173665036 20:44757232-44757254 TGAGGACCACCAGAGGAGGTGGG - Intronic
1174883681 20:54308038-54308060 AGACGACCCCATGAGGAGAGGGG - Intergenic
1176921070 21:14688045-14688067 ATACAACCCCTAGAGGAGAATGG + Intergenic
1181466379 22:23112788-23112810 AGAAGACCCTCAGTGGGGATAGG + Intronic
949153027 3:793420-793442 AGCCGACCCAAAGAGAAGATGGG - Intergenic
960441995 3:117700248-117700270 ATACCTCCCCCAGAGGAAATGGG + Intergenic
960464777 3:117984087-117984109 AGGAGATCCCCAGAGCAGATAGG - Intergenic
962257315 3:133881239-133881261 AGATGAGCCACAGAGGAGACTGG + Intronic
964403671 3:156326105-156326127 AGCAGACCCCCAGAGTAGCTGGG - Intronic
968660205 4:1795690-1795712 ATACGGCCCCCTGGGGAGATGGG - Intronic
969074822 4:4569613-4569635 AGACAATACCCAGAGGAAATAGG - Intergenic
970851656 4:20610937-20610959 AGAGGACCCGCAAAGGAGAGAGG + Intronic
974486331 4:62510510-62510532 GGAAGAGCCCAAGAGGAGATCGG + Intergenic
979988017 4:127339389-127339411 TCACGACCCCCAGAAGAGAACGG + Intergenic
982341350 4:154302508-154302530 AGAGGAGCCACACAGGAGATAGG - Intronic
990499535 5:56381824-56381846 GGAAGAGCCCAAGAGGAGATTGG + Intergenic
1002422385 5:179155375-179155397 AAACGCCCCCCAGAGGAGGTGGG - Intronic
1003096609 6:3147344-3147366 ATAGGGCCCCCAGAGGACATTGG + Intronic
1003633662 6:7811338-7811360 CCAAGACCCCCAGAGGAGCTTGG - Intronic
1006075369 6:31529142-31529164 AGACCAGCTCCAGAGGAAATGGG + Exonic
1007615230 6:43175913-43175935 ATAAGGCCCCCAGAGGAGACAGG - Exonic
1015377565 6:132527905-132527927 AGATGACTCCCATGGGAGATCGG + Intergenic
1017501088 6:155023632-155023654 AGAAGACCTCCAGAGGATAATGG - Intronic
1019377376 7:700058-700080 AGAGAAACCCCAGAGGAGAAAGG + Intronic
1031378013 7:121050943-121050965 GGAAGAGCCCAAGAGGAGATTGG + Intronic
1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG + Intergenic
1036654914 8:10671799-10671821 AGACAACCCCCTGGGGAAATGGG + Intronic
1037373147 8:18201617-18201639 ATAAGACTCCCAGAGGGGATGGG + Intronic
1038857521 8:31349660-31349682 AGATGACCCCCTTAGAAGATGGG + Intergenic
1039905476 8:41783163-41783185 AGACAACTCTCAGAGGAAATAGG - Intronic
1049230606 8:141479421-141479443 ACAGGACCCCCAGAGGGGGTTGG + Intergenic
1187239065 X:17496089-17496111 AGGAGGCACCCAGAGGAGATTGG - Intronic
1187321735 X:18245481-18245503 AGACAATCTCCAGAGGGGATGGG + Intronic
1187814558 X:23216976-23216998 AGACTGCCCCCATAGGAGGTTGG - Intergenic
1195689217 X:107610184-107610206 AAGGGACCCCAAGAGGAGATGGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200285376 X:154817338-154817360 GGAAGAGCCCAAGAGGAGATCGG - Intronic