ID: 1113789146

View in Genome Browser
Species Human (GRCh38)
Location 13:113018202-113018224
Sequence TCCGCAGCTCGTCCTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113789146 Original CRISPR TCCGCAGCTCGTCCTGACTT TGG (reversed) Intronic
900188140 1:1342469-1342491 TCCACAGCTGGTCCTGGCTGAGG - Exonic
900547189 1:3235682-3235704 TCCCCAGCTCCGCCTGACATGGG + Intronic
905221960 1:36454194-36454216 TCAGCTGCTCCTTCTGACTTAGG + Intergenic
905301117 1:36986704-36986726 TCCTCAGCTCCTCCAGGCTTTGG - Intronic
923470720 1:234288267-234288289 TTCGCAGCTGCTCCTGGCTTGGG - Intronic
1062988383 10:1791127-1791149 TCAGCAGCTTGTCCTGCCTGAGG - Intergenic
1069809446 10:71147561-71147583 TCCTGAGCTGGTCCAGACTTTGG - Intergenic
1077561301 11:3263417-3263439 ACCCCTGCTCTTCCTGACTTGGG + Intergenic
1077567197 11:3309246-3309268 ACCCCTGCTCTTCCTGACTTGGG + Intergenic
1080741522 11:35068978-35069000 GCCGCAGCTATTCCAGACTTGGG + Intergenic
1081378656 11:42388780-42388802 TCCGTGTCTCTTCCTGACTTTGG - Intergenic
1081461451 11:43276156-43276178 TCAGCAGGTGGTCCTGACATGGG - Intergenic
1083434014 11:62630439-62630461 TCCGCAGCTCCTCGTGAACTCGG + Exonic
1085069745 11:73532755-73532777 TTGGCAGCTCATTCTGACTTAGG + Intronic
1090830326 11:130416535-130416557 GCCTCAGCCCGTCCTGAATTTGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1113789146 13:113018202-113018224 TCCGCAGCTCGTCCTGACTTTGG - Intronic
1121632528 14:95431784-95431806 TCCCCAGCGTGTCCTGATTTAGG + Intronic
1124790657 15:32723092-32723114 TCCATAGCTCATCCAGACTTAGG - Intronic
1129724761 15:77896114-77896136 GCCTCAGCTCCTCCTGGCTTAGG - Intergenic
1138333114 16:56231061-56231083 TCCTCATCTCTTCCTGTCTTTGG - Intronic
1142011255 16:87715459-87715481 TCCGCAGCTCATCCTGCCCAGGG + Intronic
1142741090 17:1932414-1932436 CCCTCAGCCCCTCCTGACTTCGG - Intergenic
1143299596 17:5899785-5899807 TCAGCTCCTGGTCCTGACTTTGG + Intronic
1148557668 17:48588159-48588181 CCCGCAGCTTGTCCTGACTGGGG + Intronic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152443851 17:80328704-80328726 TCAGCAGCTCATGCTGACTCCGG - Intronic
1152585620 17:81188274-81188296 TCCTCAGCTCCTCCTGGCTTGGG + Intergenic
1157112899 18:44837711-44837733 TGCCCAGCTCCTCCTGACTCAGG + Intronic
1164464243 19:28473972-28473994 TTCCCAGCTCTTCCTGTCTTGGG - Intergenic
933847196 2:86336229-86336251 TCCACAGCTGTTCCTGACTGCGG - Intronic
936627967 2:114168997-114169019 TCCCCAGCTCATTCAGACTTAGG - Intergenic
941001240 2:160205569-160205591 CCCTCTGCTGGTCCTGACTTCGG + Intronic
1169426013 20:5497885-5497907 TCACCTGCTCGTCCTGGCTTGGG - Intergenic
1173942662 20:46925001-46925023 TCCTCACCTCCTCCTGGCTTTGG + Intronic
1178181098 21:30162432-30162454 TCCTCAGCTCCACCTGAGTTAGG + Intergenic
950616703 3:14165653-14165675 TCCACAGCATGTCTTGACTTTGG - Intronic
954199578 3:49016325-49016347 TCCCCAGCTCTTCCTGGCTCTGG - Exonic
956605967 3:71073356-71073378 TCCTCACCTCTTCCTGCCTTGGG + Intronic
982722252 4:158870713-158870735 GCCGCCCCTCGTCCTGGCTTAGG - Intronic
994713091 5:103289864-103289886 TCCACACCACATCCTGACTTGGG - Intergenic
1004326144 6:14675632-14675654 TCAGCAGCTGGTCCTCACTTTGG + Intergenic
1007041402 6:38725836-38725858 TCTGTAGCTGGTCCTGACTGTGG + Intronic
1017265623 6:152442137-152442159 TCCGCAGCTCCTCGTGGCCTCGG + Exonic
1022892314 7:34714144-34714166 TCCTCAGTTCCTCCTCACTTGGG + Intronic
1037695958 8:21224143-21224165 TCCACAGCTCATCCTTAATTAGG - Intergenic
1038243940 8:25836429-25836451 TCAGCACCTGGTCCTGCCTTGGG - Intergenic
1187313177 X:18166389-18166411 TCCGCAGCTAGTCACCACTTGGG + Intronic