ID: 1113793114

View in Genome Browser
Species Human (GRCh38)
Location 13:113041195-113041217
Sequence CAGAGTCACCAGAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113793114_1113793120 1 Left 1113793114 13:113041195-113041217 CCTTCATCCCTCTGGTGACTCTG 0: 1
1: 0
2: 5
3: 31
4: 294
Right 1113793120 13:113041219-113041241 GGACTGCTTCCTGCTGAAACTGG 0: 1
1: 0
2: 1
3: 27
4: 500
1113793114_1113793121 2 Left 1113793114 13:113041195-113041217 CCTTCATCCCTCTGGTGACTCTG 0: 1
1: 0
2: 5
3: 31
4: 294
Right 1113793121 13:113041220-113041242 GACTGCTTCCTGCTGAAACTGGG 0: 1
1: 0
2: 2
3: 24
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113793114 Original CRISPR CAGAGTCACCAGAGGGATGA AGG (reversed) Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
902884868 1:19397536-19397558 AAGAGTCACCAGCTGGATGGTGG + Intronic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903662235 1:24985180-24985202 CAGAGTCTGCAGAGCCATGAGGG - Intergenic
904368491 1:30033812-30033834 CAGAGTCACCAGTGAGATTGAGG - Intergenic
905623103 1:39466306-39466328 CAGAGTCACAAGTGGTAGGAGGG - Intronic
905993371 1:42359510-42359532 CAGCTTCAACAGTGGGATGAGGG - Intergenic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
907294341 1:53439793-53439815 CAAAGTCACCAGGGTGGTGAAGG - Intergenic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908110023 1:60887477-60887499 CAGAGTCTCCAGAAGGATTTTGG + Intronic
908218283 1:61977581-61977603 TAGAGTCCCCCCAGGGATGAGGG + Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
908736778 1:67284845-67284867 CATGCTCACCAGAGGGGTGATGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
915973871 1:160372226-160372248 CAGGGTCAGCAGTGGAATGAAGG + Exonic
916286696 1:163113389-163113411 CAGTGTCATCAGTGGGCTGAGGG - Intronic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
917716398 1:177742065-177742087 CAGTGTCACCACAGTGGTGATGG + Intergenic
917758863 1:178133332-178133354 CAGTGTCACCAAAGTGATCATGG - Intronic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920355083 1:205365989-205366011 CAGATTCACCAGTGAGATGCTGG + Intergenic
921761138 1:218916551-218916573 CAGAGTCACCAGAAGTTTAAGGG + Intergenic
922806719 1:228394147-228394169 AAGAGTCTTCAGAGAGATGATGG - Exonic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
1062902039 10:1153903-1153925 CAGAGACACCAGTGGGGTGGGGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065236413 10:23657318-23657340 CAGAGTCTCTATAGGGAAGAGGG - Intergenic
1065266209 10:23978889-23978911 CAGAGCCACCAGAGAGAACATGG - Intronic
1068059467 10:52049381-52049403 CAGAATCACAAGAGTGATAATGG + Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074561101 10:114535936-114535958 CAGATTTACCAGGGGGATGGTGG + Intronic
1075511492 10:123076017-123076039 CAGAGTCACAAGATGGCTGCTGG + Intergenic
1078511645 11:11988648-11988670 AAGACTCCCCAGAGGCATGAGGG - Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1080021168 11:27561636-27561658 CAGAATCTCCTGAGGGTTGAGGG + Intergenic
1081482194 11:43499897-43499919 GAGCGTCACCAAAGGGATTATGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083167562 11:60900506-60900528 CAGAGACAGCAGCGGGGTGAGGG + Intronic
1083363575 11:62128152-62128174 CAGAGCCACCATGGGGACGACGG + Exonic
1086194709 11:84123616-84123638 CAGAGTCTCCAGTGTGATGCTGG + Intronic
1087016568 11:93559924-93559946 CAGAGCCACATGAGAGATGAAGG + Intergenic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1089557647 11:119323419-119323441 CCCAGCCACCAGAGGGATGTGGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091461578 12:647150-647172 CACAGACACCTGAGGGATGGGGG - Intronic
1091696245 12:2630181-2630203 CACAGTCACCAGAGAAATAAGGG + Intronic
1095042964 12:37464514-37464536 CTGAGTCACAGGAGGAATGATGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1103018120 12:117511956-117511978 CGGAGTCATCGGAGGGATCAAGG - Intronic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1103507987 12:121454282-121454304 CAGAGCCACCCCAGGGAGGATGG + Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114663528 14:24366110-24366132 CAGAGTCATCAGGGGAATGAGGG + Intronic
1114829274 14:26119759-26119781 CACATTCAGCAGAGGCATGAAGG + Intergenic
1115152451 14:30301741-30301763 GAGAGTCACAGGGGGGATGAGGG - Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1120967803 14:90183003-90183025 CACTCTCATCAGAGGGATGAGGG - Intronic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122700397 14:103584460-103584482 CAGAATCTCCTGAGTGATGAAGG - Intronic
1202941501 14_KI270725v1_random:152117-152139 CTGAGTCACCGGAGGAACGATGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124413554 15:29456429-29456451 CACAGTCACCAAAGGGATGGGGG + Intronic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126291973 15:47091290-47091312 CTGAGTCACAGGAGGAATGATGG - Intergenic
1128338167 15:66801919-66801941 AAGAGGCAGCAGAGGGTTGAGGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131916728 15:97274097-97274119 CAGAATATCCAGAGGGATCACGG - Intergenic
1132074171 15:98805923-98805945 CACAGACTCCACAGGGATGAGGG + Intronic
1132075706 15:98818162-98818184 CAGAGTCACATGAGGGGTTAGGG + Intronic
1132631297 16:918923-918945 CAGAGACACCTGTGGGATGTGGG + Intronic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136779573 16:32887716-32887738 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1136891043 16:33973802-33973824 CAGAGGCTCGAGAGGGATGTAGG - Intergenic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1140445573 16:75024890-75024912 CATATACACCAGAGGGATCATGG - Intronic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141175771 16:81718078-81718100 CTGAGTCACCAGAGGGGAAAAGG + Intergenic
1141254294 16:82386421-82386443 CAGAGCCACCAGTGGGGAGAGGG - Intergenic
1141703188 16:85651675-85651697 CAGAGTCAGAAGAGGGCTGGAGG - Intronic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1203081989 16_KI270728v1_random:1149804-1149826 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1143328758 17:6119042-6119064 AAGAGTCACCAGAGAGCTGTTGG - Intronic
1145231242 17:21174885-21174907 CAGAGCCCCCACAGGAATGAGGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1148466043 17:47865889-47865911 CAGACCCACAAGAGGAATGATGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148769723 17:50059950-50059972 CTGAGTCACCAGTGGGGAGAGGG + Intronic
1149356039 17:55840308-55840330 TAGATTCCCCAGAGGGAAGATGG + Intronic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1152175490 17:78784069-78784091 CAGACTCACCAGAAGGTTCAAGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155652033 18:28153976-28153998 CAGACTCTCAAGAGGCATGATGG + Intronic
1156108645 18:33696525-33696547 TAGATTAACCAGAGGGATAATGG + Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159041444 18:63326663-63326685 CAGAGCCATCTGAGGGATGAAGG + Intergenic
1161143680 19:2664432-2664454 CAGAGCCACGAGACTGATGACGG + Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162111188 19:8400547-8400569 CAGATGTACCTGAGGGATGAAGG - Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1164403287 19:27918546-27918568 CAGAGGCACCAGAGGGCTCATGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1165972123 19:39640344-39640366 CAGTATCACCAGAGAGATCAGGG + Intergenic
1166300391 19:41909267-41909289 CAGACTCACCTCAGGGGTGAGGG + Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
1167000202 19:46741324-46741346 ATGAGGCAGCAGAGGGATGAAGG - Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1167964434 19:53132043-53132065 CACAGTATCCAGAGAGATGAAGG - Intronic
1202698905 1_KI270712v1_random:148046-148068 CAGAGTGTCCAGAGCAATGAGGG + Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
928752143 2:34482967-34482989 CACAGTCAACATATGGATGAGGG - Intergenic
929049069 2:37819238-37819260 CAAGGCCACCAGAGGGGTGATGG - Intergenic
932749340 2:74361447-74361469 GAGCGGCACCAGAGGGCTGAGGG + Exonic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
933798517 2:85941276-85941298 CAGAGCCTCCAGAGGGAGCAAGG - Intergenic
936152978 2:110031821-110031843 CCGAGTCACCTGAGGGCTGGTGG - Intergenic
936191702 2:110339591-110339613 CCGAGTCACCTGAGGGCTGGTGG + Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
938607653 2:132912420-132912442 CATAGTCCACAGAGGGTTGAAGG - Intronic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
946930660 2:224667204-224667226 CAGAGTCACTAGAGGGTTAATGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948333215 2:237187573-237187595 CAGAGTCACAAGAGCACTGATGG - Intergenic
1169255483 20:4093530-4093552 CAGAGACCCAAGAGGGCTGATGG - Intergenic
1169828089 20:9791525-9791547 AAAAGTCATCAGAGAGATGAAGG - Intronic
1170043830 20:12065359-12065381 CAGAGACTACAGAGAGATGATGG - Intergenic
1171198573 20:23223120-23223142 AAGAGTCACCAGATGGACCATGG + Intergenic
1171537384 20:25907269-25907291 CTGAGTCACAGGAGGAATGATGG + Intergenic
1171840337 20:30202608-30202630 CTGAGTCACAGGAGGAATGATGG + Intergenic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173821997 20:46025605-46025627 CTGAGTCTGCAGAGGAATGAGGG + Intronic
1175166686 20:57049059-57049081 CAGGCCCACCAGAGGCATGAGGG + Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1176430379 21:6571730-6571752 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1179272273 21:39860719-39860741 CAGAGGCATCAGAGGGATCTGGG + Intergenic
1179588022 21:42386164-42386186 GAGAGTCACAAGATGGAAGATGG + Intronic
1179705773 21:43179192-43179214 CAGAGCCTCCAGAGGGAACACGG - Intergenic
1180615307 22:17122165-17122187 CAAAGGCTCCAAAGGGATGATGG + Intronic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181915158 22:26273933-26273955 CAGAGTCACCTGAGAGAGCAGGG + Intronic
1183207301 22:36428334-36428356 CAGAGCCTCCAGAAGGATCAAGG - Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184264939 22:43341964-43341986 CACAGACACAAGGGGGATGATGG + Intronic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950469232 3:13174366-13174388 TATAGTCTCCAGTGGGATGAAGG - Intergenic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953625622 3:44568236-44568258 CAGAGTCATCAGGGGTACGAAGG - Intronic
953777010 3:45828110-45828132 CACAGCCTGCAGAGGGATGAGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
956712639 3:72051760-72051782 TGGAGCCACCAGAGGGATGATGG - Intergenic
956749598 3:72335534-72335556 CAGAGCCACCTGCGGGTTGAGGG + Intergenic
956825154 3:72991241-72991263 TGGAGTCACCACAGGCATGATGG - Intronic
958140761 3:89559491-89559513 CAGAGTCACCTGAGGAATGCAGG - Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
962176476 3:133160693-133160715 CAAAGTCAACAGAGGTTTGAAGG - Intronic
963547287 3:146676159-146676181 CAGATTCAACAGAGGGACTATGG + Intergenic
965071416 3:163920053-163920075 CAGAGGGACCAGAGGGGTAAAGG - Intergenic
965907381 3:173725755-173725777 CAGACTCATCAGAGGCTTGACGG + Intronic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968728051 4:2257311-2257333 AAGAGTCCCCTGAGGGATGCTGG - Intronic
971124859 4:23742432-23742454 CAGACTCCCCTGAAGGATGAAGG + Intergenic
971261218 4:25058587-25058609 CAGAGCCTTCAGAGGGATCACGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
976187831 4:82459894-82459916 CAAAGTCAGCAGGGGGATGTGGG - Intronic
977119455 4:93079589-93079611 CAGATTCACTAGTGGTATGATGG + Intronic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
983845959 4:172518114-172518136 TAGAGTCACCAAAGGGATCCTGG + Intronic
985868052 5:2530780-2530802 CACAGCCACCAGAGGCATGGCGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
988213702 5:28243866-28243888 TAGAGTCTCCAGGGGGGTGATGG - Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
993782137 5:92079995-92080017 GAGAGTCGCAAGAGAGATGAGGG - Intergenic
995598595 5:113773138-113773160 CAGAGTCTCCAAAGTGATAATGG - Intergenic
997468601 5:134104230-134104252 CAGAGACAGATGAGGGATGAGGG - Intergenic
997817969 5:137036221-137036243 CAGAGTTACTAGATGGATAAGGG - Intronic
997875649 5:137544498-137544520 CTGAGTCAACAGTGGGATGTGGG - Intronic
1000914591 5:167064896-167064918 GAGAGTAACGAAAGGGATGAAGG + Intergenic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001464573 5:171952097-171952119 TGGAGTCACTAGAGGGATAAAGG - Intronic
1002538643 5:179892117-179892139 CAGAGCCACCAAAGGGGTGAGGG - Intronic
1002807655 6:592553-592575 CAGGGTCACCAGACGCATGAAGG + Exonic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1004613644 6:17269212-17269234 CAGAGTCACTGGGGGGGTGATGG - Intergenic
1007046191 6:38776736-38776758 AAGAGACACCAGATGGATGAAGG + Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007269855 6:40628235-40628257 CAGAGTCACAAGAGGGAAACCGG + Intergenic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1017324102 6:153127479-153127501 CAGACATACAAGAGGGATGAAGG - Intronic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019127080 6:169847820-169847842 GAGATTCACCAGAGGAGTGATGG + Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022344782 7:29503614-29503636 CATGGTCACAGGAGGGATGAGGG + Intronic
1022379408 7:29845705-29845727 CAGAGTCGGATGAGGGATGAGGG + Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025288861 7:57694098-57694120 CTGAGTCACAGGAGGAATGATGG + Intergenic
1027191167 7:75996154-75996176 CTAAGTCACCAGGGGGATGCAGG + Intergenic
1028333410 7:89624070-89624092 TATAGTCACCAGAGTGCTGAAGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030570864 7:111221974-111221996 CACAGTCAGCAGGGGGATGATGG + Intronic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1032480006 7:132238802-132238824 CAGAGTCACAAGAGGGGGGGGGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1035610318 8:957995-958017 CAGAGTTTCTACAGGGATGACGG - Intergenic
1037823733 8:22148314-22148336 CAGATCTACCAGTGGGATGAGGG - Exonic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1038701846 8:29856256-29856278 CAGAGCCTCCAGAGGGAGCACGG + Intergenic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1043592683 8:81848414-81848436 CAGAGTCTCCAAAGAGATAATGG + Intergenic
1046997389 8:120539416-120539438 CAGAGTCATTAGAGGGTTAAAGG + Intronic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1048624592 8:136171520-136171542 CAGAGACACCAGAAGAATCAGGG - Intergenic
1049195711 8:141314561-141314583 CAGAAGCACGAGAGGGGTGAGGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1051077489 9:13257256-13257278 CAGAGTCCCCACATGCATGATGG - Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052489805 9:29150944-29150966 CAGAGTCACCAGAGTCATCAAGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1054835440 9:69671741-69671763 GAGAGTCAGCCGAGAGATGAGGG + Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1203611678 Un_KI270749v1:12854-12876 CTGAGTCACAGGAGGAATGATGG - Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1190124361 X:47690296-47690318 CAAAGTCACTAGAGGGCTGCCGG + Intergenic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1194935875 X:99948214-99948236 CAGATTTCCCAGAGTGATGAAGG - Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic