ID: 1113793572

View in Genome Browser
Species Human (GRCh38)
Location 13:113043482-113043504
Sequence GATGTGCCAGGCCACGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113793572_1113793582 24 Left 1113793572 13:113043482-113043504 CCATCTCCGTGGCCTGGCACATC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 1113793582 13:113043529-113043551 CGTGTAGCACCTGTTACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 48
1113793572_1113793581 21 Left 1113793572 13:113043482-113043504 CCATCTCCGTGGCCTGGCACATC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 1113793581 13:113043526-113043548 GCACGTGTAGCACCTGTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 117
1113793572_1113793576 -7 Left 1113793572 13:113043482-113043504 CCATCTCCGTGGCCTGGCACATC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 1113793576 13:113043498-113043520 GCACATCCAAGGTCCCTTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 112
1113793572_1113793578 -1 Left 1113793572 13:113043482-113043504 CCATCTCCGTGGCCTGGCACATC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 1113793578 13:113043504-113043526 CCAAGGTCCCTTTGTGGAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113793572 Original CRISPR GATGTGCCAGGCCACGGAGA TGG (reversed) Intronic
900990241 1:6095327-6095349 GAACTGCCGGGCCACGGAGTAGG - Exonic
901617836 1:10555997-10556019 GCAGTGCCAGCCCACCGAGATGG - Intronic
901759041 1:11458906-11458928 GATTTGCCAGGCCCAGGAGGGGG - Intergenic
902611788 1:17602168-17602190 GGAGTGCCGGGCCCCGGAGAAGG - Exonic
902756289 1:18551239-18551261 GATGTGGCAGCCCATGGAGCTGG - Intergenic
902778427 1:18689489-18689511 GATGAGCCAGGCCATGATGAAGG + Intronic
903500237 1:23796523-23796545 GATGGTCCAGGCTATGGAGAAGG - Exonic
907390292 1:54153702-54153724 TATGTGCCAGGCCCCGCACAAGG + Exonic
913200195 1:116489744-116489766 GATGGGCCAGGAAAGGGAGAAGG + Intergenic
914901201 1:151712061-151712083 GAAGTGCCAGGCCACGAAGAAGG - Intronic
917627590 1:176861932-176861954 GAGTTGACAGGCCAGGGAGAGGG - Exonic
922726585 1:227925649-227925671 GATGAGCCAGGCAGGGGAGAGGG + Intronic
922886515 1:229024872-229024894 GAAGAGCCAGGGGACGGAGAGGG - Intergenic
924627181 1:245705210-245705232 GATCTCGCAGGCCACGGTGAAGG + Intronic
1064228279 10:13506460-13506482 GATGAGGCAGGCAACGGAGCTGG + Intronic
1067029015 10:42868008-42868030 GAAGACACAGGCCACGGAGAGGG + Intergenic
1067054808 10:43044336-43044358 GCTGGGCCTGGCCATGGAGACGG + Intergenic
1070716845 10:78728764-78728786 GATGTGCCTTGACACAGAGAAGG - Intergenic
1071334342 10:84589099-84589121 GAGGTGCCAGGCCTCAGTGAAGG - Intergenic
1071468128 10:85959324-85959346 TATTTGCCAGGTCACAGAGAGGG - Intronic
1071691720 10:87827298-87827320 CGTGTGACAGGCCACGGAGCTGG - Intronic
1071756502 10:88547304-88547326 CATGTGCCAGGACAGGCAGATGG - Intronic
1072507425 10:96082587-96082609 GCTGAGCCAAGCCTCGGAGAGGG + Intergenic
1075325043 10:121524746-121524768 GCTGGGCCAGGCCACGAAGGGGG - Intronic
1076345851 10:129778478-129778500 GATCTTCAAGGCCAGGGAGATGG + Intergenic
1077481631 11:2817575-2817597 GATGTCCCTGGCCAGGGAGGTGG + Intronic
1077817279 11:5697990-5698012 ACTGTGCCAGGCCAGGTAGAGGG + Intronic
1078185046 11:9044946-9044968 AAAGTGCCAGGCCAAGGTGAGGG - Intronic
1079104153 11:17559694-17559716 TCTGTGCCAGGCCAGGAAGATGG - Intronic
1080552249 11:33382816-33382838 GAAGTCCCAGGGCAGGGAGAGGG - Intergenic
1081867147 11:46366290-46366312 AAGGTGCCAGGCCCTGGAGAGGG + Exonic
1083635238 11:64117332-64117354 CATGTGCCAGGGCCCTGAGAAGG + Exonic
1089396231 11:118137780-118137802 GCTGTGCCACGCCAGGGGGAGGG + Intronic
1090076273 11:123581860-123581882 GATGTGCCAGCCCATGCAAAGGG + Intronic
1090973616 11:131663508-131663530 CACGGGCCAGGCCACTGAGAGGG + Intronic
1092118815 12:6029381-6029403 GCGGTCCCAGACCACGGAGAGGG + Exonic
1092245350 12:6861015-6861037 CAAGTGCCTGGCCACAGAGAAGG + Exonic
1096687832 12:53300431-53300453 GAGGTCCCAGGCCAGGGAGATGG - Intronic
1098163379 12:67669302-67669324 AGTGAGCCAGGCCAAGGAGAGGG - Intergenic
1102893899 12:116583008-116583030 GAGTTCCCAGGCCACGGAAATGG - Intergenic
1102959784 12:117085075-117085097 GAGGTTCTAGGCCACGGGGATGG + Intronic
1103919982 12:124394297-124394319 GATGGGCCAGGCCAAGGTCAGGG + Intronic
1104721078 12:131045519-131045541 GATGTGCCCGGGCAGGGAGGCGG - Intronic
1106329241 13:28723960-28723982 GCTGGGCCAGGCGATGGAGAAGG - Intergenic
1107537482 13:41349994-41350016 AATGTGCCAGGCCACCGTGGTGG + Intronic
1111790995 13:92854678-92854700 GATTTGCCAGGCTACGGTGAAGG - Intronic
1113793572 13:113043482-113043504 GATGTGCCAGGCCACGGAGATGG - Intronic
1115754290 14:36517724-36517746 GAAGCGCCAGGCCAAGGACAAGG - Exonic
1117033852 14:51706135-51706157 GATGGGACAGGACAGGGAGAAGG - Intronic
1117340537 14:54788015-54788037 GATGACCCAGGCTACAGAGAAGG - Intronic
1119431455 14:74570602-74570624 GATGTGCCAGGCCTCTGCTAAGG + Intronic
1121603340 14:95222488-95222510 GAAGTGCCAGGCCACGCTCATGG + Intronic
1122223522 14:100258230-100258252 GATGTGCCAGGCTAGAGGGATGG + Intronic
1122294284 14:100696410-100696432 CACGAGCCAGGCCAGGGAGAGGG + Intergenic
1123192731 14:106586542-106586564 GGTCTGCCAGGCTCCGGAGAAGG - Intergenic
1126300023 15:47184690-47184712 GCTGTGCCAGGCCGGGGGGAGGG + Intronic
1127854483 15:62943241-62943263 GGTGAGCCAGGCCAAAGAGAGGG + Intergenic
1129917309 15:79284865-79284887 GATGTGCCAGTCCATGTGGAAGG - Intergenic
1130184453 15:81666575-81666597 GAGGGGCAAGGCCAAGGAGAAGG + Intergenic
1131219501 15:90570322-90570344 GATGAGGCAGGGCTCGGAGATGG + Intronic
1132305412 15:100808293-100808315 GAGCTGCTAGGCCACAGAGAGGG - Intergenic
1133136695 16:3717369-3717391 GGCGGGCCGGGCCACGGAGACGG - Intronic
1134008515 16:10834318-10834340 GGTGTGCCAGGCAAGGGAGACGG - Intergenic
1135505975 16:23036620-23036642 GATTTGCAAGGCCAAGGAAATGG + Intergenic
1135933408 16:26758866-26758888 GCTGTGCCAGGCATTGGAGATGG + Intergenic
1135941048 16:26822247-26822269 GAAGTGAGAGGCCACAGAGAAGG + Intergenic
1138096482 16:54215710-54215732 CATGAGCCAGGCCAGGGAGTGGG - Intergenic
1138554449 16:57763585-57763607 CAGGTGGCAGGCCAGGGAGAGGG - Intronic
1139106604 16:63834561-63834583 GATGTGGCAGGCGAGGCAGATGG + Intergenic
1139528223 16:67529200-67529222 GATGGGCCAGGCCAGAGAGCGGG + Intronic
1139966137 16:70746462-70746484 TGTGTGCCAGGCCACGGGCAGGG - Intronic
1140889044 16:79269678-79269700 GAAGTCACAGGCCACAGAGAAGG - Intergenic
1142928560 17:3262214-3262236 GAAGTGCAAGGCCAGGGAGTAGG + Intergenic
1143739868 17:8944733-8944755 GAAGTACCAGGACACGGAGCTGG + Intronic
1144682303 17:17204170-17204192 GAGGTGGCAGGCCGCGGGGAGGG - Intronic
1144769750 17:17752906-17752928 TGTGTGCCAGGCCACAGACAGGG - Intronic
1145931206 17:28687125-28687147 GATGCGCCGGGCCAGGGAGACGG - Exonic
1147768579 17:42852566-42852588 GAAGTGCCAGTCCACGTAGGTGG - Exonic
1147771174 17:42868498-42868520 GAAGTGCCAGTCCACGTAGGTGG - Intergenic
1148344233 17:46892732-46892754 GATGTGCCAGGCCAGGTACTGGG + Intergenic
1151069136 17:71188396-71188418 GATGTGCCAGCCTACGAAGATGG + Intergenic
1152710520 17:81868728-81868750 GTTGAGCCAGGCCAGGGAGGCGG + Exonic
1152724871 17:81940212-81940234 GCTGTGCCAGCTCACAGAGAAGG - Exonic
1154080900 18:11255446-11255468 GATGTGAAATGCCACGAAGATGG - Intergenic
1157351701 18:46893835-46893857 ACTGTGCCTGGCCAAGGAGAGGG - Intronic
1157639041 18:49194040-49194062 GACGTGCCAGGGCATGGAGTGGG + Intronic
1157732994 18:50020823-50020845 AAAGTGCTAGGCCAGGGAGATGG + Intronic
1161089030 19:2351172-2351194 GAAGGGCCAGGGCAAGGAGAGGG - Intronic
1162549477 19:11350693-11350715 GCTGGGCCAGGCCAGGGTGAGGG + Intronic
1163393032 19:17042054-17042076 GCTGTGCCAAGCCACGCAGCAGG + Intergenic
1163552117 19:17971285-17971307 CATGTGCCAGGCCTGGGAGAAGG - Intronic
1165105555 19:33467903-33467925 GATGTACCAGGCACCGGTGATGG + Intronic
1165888990 19:39099294-39099316 GATGAGACTGGCTACGGAGACGG + Intronic
1167110106 19:47455299-47455321 GATGTGTCAGGCTACTGAGCAGG + Intronic
1167490769 19:49791824-49791846 GGTGTGCGAGGCCAGCGAGAGGG - Intronic
930032781 2:47068674-47068696 GCTGTGCCAGCCCAGGGATAAGG - Intronic
932475635 2:72004046-72004068 GGTGCCCCAGGCCAGGGAGAGGG + Intergenic
933810182 2:86028203-86028225 GATGCCCCAGACCACGGGGAAGG - Intronic
934323485 2:91986111-91986133 AAAGTGCAAGGCCAAGGAGAAGG - Intergenic
946946043 2:224823950-224823972 GATATGAGAGGCCACAGAGAAGG - Intronic
948005554 2:234605001-234605023 GATGCACCAGACCACAGAGATGG - Intergenic
1169896311 20:10508698-10508720 TAGCTGCCAGCCCACGGAGAAGG - Intronic
1171210812 20:23315573-23315595 GATGGGAAAGGGCACGGAGATGG - Intergenic
1172617539 20:36299039-36299061 TTTGTGCCAGGCCTCGGAGCTGG - Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175948518 20:62569973-62569995 GAAGTCCCAGGCCACGGACACGG - Intronic
1177862860 21:26474970-26474992 GTTCTGCCAGGCAATGGAGAAGG - Intronic
1179718509 21:43302372-43302394 GAGGGGCAAGGCCAAGGAGAGGG + Intergenic
1179839006 21:44058274-44058296 GGTGTTCCAGGCCATGGAGTGGG + Intronic
1179888610 21:44325063-44325085 GCTGGGCCAGGCCTGGGAGAGGG - Intronic
1180625536 22:17191201-17191223 CACGTGCCAGGCCACGCACATGG + Intronic
1181362465 22:22348542-22348564 TATGTGCCAGGCTATGGGGAGGG + Intergenic
1182429390 22:30291060-30291082 GATGTTCCAGGCCCAGGCGAAGG + Intronic
1183444961 22:37847449-37847471 ACTGTGCCAGGCCTCGGAGAAGG + Intronic
1185259085 22:49851778-49851800 GATGTGTCAGAGCCCGGAGAGGG + Intergenic
950329823 3:12147422-12147444 GATGCCTCAGGCCACGCAGAAGG - Intronic
953987029 3:47451940-47451962 TATGTGCCAGGCCCCTGAGATGG - Intronic
955004915 3:54959359-54959381 CATGTTACAGGGCACGGAGATGG - Intronic
959029123 3:101277373-101277395 TATGTGCCAGGCAATGTAGAAGG + Intronic
961469184 3:127100810-127100832 GAGGCCCCAGGCCACGGAGGAGG + Intergenic
961678314 3:128581989-128582011 GGGGCGCCAGGCCACGGAAAAGG - Intergenic
968454050 4:688378-688400 GAGGCGCCAGGTCACGGGGATGG - Intronic
968750525 4:2386694-2386716 GATGTCCCAGGTCACAGGGATGG - Intronic
969278088 4:6150462-6150484 GCTGTGTCAGGCCCCGGACAGGG - Intronic
969461310 4:7330569-7330591 GAGGTGCCATGCCAAGCAGAAGG - Intronic
969905945 4:10396138-10396160 GATATGCCTGGACATGGAGAGGG + Intergenic
971290825 4:25337543-25337565 CATCTGCCAGGCCACAGTGATGG - Intronic
974637629 4:64585109-64585131 GATGGGCCTGGCCTCGGAGGGGG - Intergenic
978215516 4:106197130-106197152 GAAGTTCCAGGCCACTGACAGGG + Intronic
981199452 4:141962992-141963014 GATTGGCCTGGCCACTGAGATGG + Intergenic
989110303 5:37900863-37900885 GATGTGAGAGGCCACCTAGAGGG + Intergenic
995609413 5:113893044-113893066 GAGGTGACAGGCCAATGAGAGGG + Intergenic
997251423 5:132391622-132391644 GAGGGGCCAGACCACTGAGAGGG + Intronic
997396959 5:133568742-133568764 GAGGTGCCAGGCCTTGGAGCAGG - Intronic
997585040 5:135039115-135039137 GAAGTCCCGGGCCACGCAGAGGG + Intronic
999125022 5:149240176-149240198 GATGGGGCAGGCCACGAGGATGG - Intronic
1001192204 5:169641617-169641639 GAGGAGCCAGGCCTCGGAAAGGG + Intronic
1001299037 5:170520493-170520515 GATGTGCGAGGCCCCAGGGAGGG - Intronic
1001381719 5:171310168-171310190 GATGCGCCGGGTCACGGTGAAGG - Exonic
1002449872 5:179312635-179312657 GATGAGCCAGGCAGAGGAGAAGG + Intronic
1002661026 5:180791264-180791286 GAAGAGCCAGGTCAGGGAGAAGG + Exonic
1002985932 6:2190924-2190946 GATGTTCCAGGCCTGGGAGCGGG - Intronic
1005676194 6:28157847-28157869 CATGTACCAGGCCAGGCAGATGG + Exonic
1006330632 6:33388049-33388071 ACTGTGCCTGGCCAAGGAGACGG - Intergenic
1015063606 6:128998057-128998079 GATATGCCAGGTCAAGGAAAGGG + Intronic
1016510361 6:144835938-144835960 GGTGTGCTAGGCCTGGGAGAAGG + Exonic
1018538811 6:164854145-164854167 GATGTTCCAGCTCAAGGAGAGGG + Intergenic
1020283569 7:6663862-6663884 GGTGTGCCAGGCGATGGAGGGGG + Intergenic
1021996696 7:26185235-26185257 GACTTCCCAGGCCACGGAAAAGG - Exonic
1023006726 7:35878259-35878281 AATTAGCCAGGCCAAGGAGAAGG + Intronic
1023594065 7:41810411-41810433 CATGTCCCAGGGCACGTAGAAGG - Intergenic
1023848403 7:44136853-44136875 GATGTGACAGCCCAAGGAGCTGG + Intergenic
1024067435 7:45752381-45752403 AATTAGCCAGGCCAAGGAGAAGG - Intergenic
1025004152 7:55342454-55342476 GAGGTGCCAGGCCAAGCAGCTGG - Intergenic
1028556818 7:92134286-92134308 GCTGGGCCAGGCGATGGAGAAGG - Exonic
1031033899 7:116766344-116766366 GATGAGCCAGGGCAGGGAGCGGG + Intronic
1034380758 7:150690243-150690265 GAGGTCCCAGGGCAAGGAGATGG - Intronic
1039791843 8:40882554-40882576 GGTGTGCCAGGCCAGGGGGCTGG - Intronic
1048034086 8:130660570-130660592 GAGTTTCCAGGCCATGGAGAGGG - Intergenic
1048293986 8:133200816-133200838 AATGTTCAAGGACACGGAGATGG - Intronic
1049410235 8:142470755-142470777 GCTGTGACCGGCCACGGAGATGG + Intronic
1049605127 8:143525828-143525850 AATGGGCCAGGCCATGGAGGCGG + Intronic
1049670843 8:143869221-143869243 TCTGTGGCAGGCCATGGAGAAGG - Exonic
1049680961 8:143917955-143917977 GGTGTACCAGGCCATGAAGAAGG - Exonic
1049847342 8:144809415-144809437 GATGTGCCTGCCCACGCTGAGGG - Intronic
1049995703 9:1031967-1031989 CCCGTGCCAGGCCACAGAGAAGG - Intergenic
1060890315 9:127183871-127183893 GATGTGACAGGCTGCTGAGATGG - Intronic
1060986901 9:127825258-127825280 GATGAGCCAGGACACGTAGGGGG + Exonic
1062480769 9:136749950-136749972 GCTGGGCCAGGCCTCTGAGAAGG + Intergenic
1062520550 9:136955947-136955969 GATGCCCCAGGCCTGGGAGAGGG + Intronic
1185767991 X:2741475-2741497 GATGTGGCAGGACACGGGAAAGG - Intergenic
1186337590 X:8607474-8607496 GAAGAGCCAGGCCAGGAAGAAGG - Intronic
1190059646 X:47202588-47202610 GATATGTCAGGCCACAGTGAGGG - Intronic
1198996888 X:142582738-142582760 CATGTGCCAGGCCATGGAACTGG - Intergenic
1199854456 X:151749157-151749179 GCTGTGGCAGGACTCGGAGAAGG - Intergenic