ID: 1113794473

View in Genome Browser
Species Human (GRCh38)
Location 13:113049140-113049162
Sequence TCACAGCCCTGGTTTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113794464_1113794473 28 Left 1113794464 13:113049089-113049111 CCGGCAGGAGATGATGATGGTGG 0: 1
1: 0
2: 2
3: 27
4: 329
Right 1113794473 13:113049140-113049162 TCACAGCCCTGGTTTCATGAAGG 0: 1
1: 0
2: 0
3: 22
4: 149
1113794471_1113794473 -7 Left 1113794471 13:113049124-113049146 CCAGGAGACATGGAGCTCACAGC 0: 1
1: 0
2: 2
3: 28
4: 216
Right 1113794473 13:113049140-113049162 TCACAGCCCTGGTTTCATGAAGG 0: 1
1: 0
2: 0
3: 22
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113794473 Original CRISPR TCACAGCCCTGGTTTCATGA AGG Intronic