ID: 1113795657

View in Genome Browser
Species Human (GRCh38)
Location 13:113056184-113056206
Sequence TAGTTTATGCACAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113795645_1113795657 16 Left 1113795645 13:113056145-113056167 CCCTGGACGGGGAGGGCAGCCGC 0: 1
1: 0
2: 5
3: 14
4: 189
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795644_1113795657 20 Left 1113795644 13:113056141-113056163 CCTGCCCTGGACGGGGAGGGCAG 0: 1
1: 1
2: 2
3: 45
4: 415
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795649_1113795657 -7 Left 1113795649 13:113056168-113056190 CCAGTGACCGAGCCCTTAGTTTA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795646_1113795657 15 Left 1113795646 13:113056146-113056168 CCTGGACGGGGAGGGCAGCCGCC 0: 1
1: 0
2: 2
3: 33
4: 438
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795642_1113795657 23 Left 1113795642 13:113056138-113056160 CCACCTGCCCTGGACGGGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 403
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795648_1113795657 -6 Left 1113795648 13:113056167-113056189 CCCAGTGACCGAGCCCTTAGTTT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1113795647_1113795657 -3 Left 1113795647 13:113056164-113056186 CCGCCCAGTGACCGAGCCCTTAG 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113795657 Original CRISPR TAGTTTATGCACAAGGGGCA GGG Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904907670 1:33910218-33910240 TGGCTTATGAACAAGGGGCAGGG + Intronic
904940571 1:34163093-34163115 CAGGATATGCCCAAGGGGCAGGG + Intronic
907296776 1:53460632-53460654 TAATTTATGTACAAGGTGAAGGG - Intronic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
921575501 1:216830378-216830400 TAATTTATGCCCAAGGCACAGGG + Intronic
921886245 1:220309490-220309512 TAATTTTTGCATAAGGTGCAAGG - Intergenic
924548019 1:245048430-245048452 TAGTTTATGTATATGAGGCAGGG + Intronic
924829226 1:247574813-247574835 GAGTTTATGCACAAGTGACCAGG + Exonic
1063294834 10:4794752-4794774 TAATTTTTGCATAAGGTGCAAGG + Intronic
1065374373 10:25023060-25023082 CAGTTTATGTACCATGGGCATGG + Intronic
1067663398 10:48253276-48253298 TAATTTTTGCATAAGGTGCAAGG - Intronic
1069222400 10:65901053-65901075 GAGTTTTTGCATCAGGGGCATGG + Intergenic
1071438995 10:85673336-85673358 TAGTTGATGAAGAAGTGGCAAGG + Intronic
1073153177 10:101325736-101325758 TAGCTTGGGCACAAGGGACATGG - Intergenic
1078842519 11:15091969-15091991 TAGTTTAGGCCCTAGAGGCAGGG + Intergenic
1080458065 11:32432879-32432901 TATTTTGTGCCCCAGGGGCATGG + Intronic
1084337472 11:68468409-68468431 TTGTTTACTCAGAAGGGGCAGGG - Intronic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1087572259 11:99943700-99943722 TAATTTATGTACAAGGTGTAAGG + Intronic
1090092782 11:123713638-123713660 TAATTTTTGTACAAGGTGCAAGG + Intergenic
1099164717 12:79289938-79289960 TAATTTGTGAACAAGGGGCTTGG - Intronic
1100813973 12:98367651-98367673 TAATTTTTCCCCAAGGGGCAGGG - Intergenic
1101021049 12:100554022-100554044 TAGTGTATGGCCATGGGGCAGGG + Intronic
1101244244 12:102870329-102870351 TCATTTATTCACAAGGAGCATGG + Intronic
1101421376 12:104554181-104554203 TAGCTTATGCTCAAGGGGGAAGG + Intronic
1102192337 12:110998169-110998191 TAGTTTGTGGACAGGGGGCTAGG - Intergenic
1109842559 13:67938502-67938524 AAGTTCTTGCACAAGAGGCAAGG + Intergenic
1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG + Intronic
1114320084 14:21540014-21540036 GAGATTATGCACAAGTGGCCTGG - Intergenic
1116451632 14:45073066-45073088 TAGTTCATGCAAAAGTGGTAAGG - Intronic
1121235981 14:92391504-92391526 TACTTTAGGCACATGGGGTAAGG - Intronic
1122824786 14:104364367-104364389 TAGTTGGTGCAGAAGGGGGAGGG - Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125963019 15:43848372-43848394 TAGATTCTGCACACGGGGCAGGG - Intronic
1131443302 15:92475024-92475046 TATTTTATGGACAAGGCCCATGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1136055648 16:27687447-27687469 TAGTCTAAGAAAAAGGGGCAAGG - Intronic
1138865400 16:60812448-60812470 TAGTTTATTCAAAAAGTGCAAGG + Intergenic
1139363501 16:66418610-66418632 GAGTTTTTGCACACGGGGAAAGG - Intergenic
1143980718 17:10867283-10867305 CAGTGTATTCACATGGGGCAGGG - Intergenic
1145834674 17:27945268-27945290 TTTTTCATGGACAAGGGGCAGGG + Intergenic
1148605406 17:48925487-48925509 TCATTTAAGCACAAAGGGCAGGG + Intronic
1148915465 17:50973530-50973552 GATTTTATGTACATGGGGCAAGG - Intronic
1153466859 18:5397604-5397626 AAGTGCATGCACCAGGGGCAGGG - Intronic
1162996256 19:14337649-14337671 TGGTTTATGTACAGTGGGCATGG - Intergenic
1164401107 19:27903012-27903034 TAGACTATGGGCAAGGGGCAGGG - Intergenic
1167674960 19:50878157-50878179 CAGCTCCTGCACAAGGGGCAAGG - Intronic
1167791309 19:51684433-51684455 TATTTTCTGAACAAAGGGCATGG - Intergenic
933237271 2:79878987-79879009 TAGTTTTTGCATAAGGTGTAAGG + Intronic
934762445 2:96864138-96864160 TTGTTAATGCACTGGGGGCAGGG + Exonic
937114034 2:119391353-119391375 TAGTTTTTGCGAAAGGGGGAAGG - Intergenic
937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG + Intronic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939215895 2:139237942-139237964 TTGTTTTTGTACAAGGAGCATGG - Intergenic
939704977 2:145441579-145441601 TAATTTTTGCACAAGGTGTAAGG - Intergenic
940799233 2:158115146-158115168 CTGTTTATGCACAAGGAGCTCGG + Exonic
943389241 2:187242744-187242766 TAATTTGTGCATAAGAGGCAGGG - Intergenic
943640481 2:190352612-190352634 TTGTTTGTGCAGAAGGGACAGGG - Intronic
944222925 2:197320371-197320393 TAGTTGAGGCAAAAGGGGCTGGG - Intergenic
945700925 2:213170177-213170199 AAGTTTATGCAGAGGGGCCAGGG - Intergenic
1178216811 21:30607913-30607935 TAATTTTTGCATAAGGTGCAAGG - Intergenic
1178968050 21:37143070-37143092 TAATTTTTGTACAAGGTGCAAGG - Intronic
1180692024 22:17724877-17724899 AGGTGTATGCACAAGGGGCTAGG - Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1182197482 22:28533884-28533906 TAATTTTTGTACAAGGGGTAAGG - Intronic
1184779823 22:46641890-46641912 TAGTTCATAGACAAGGGGCAGGG + Intronic
950353123 3:12376732-12376754 AAGTTTCAGCAGAAGGGGCAGGG - Intronic
951490986 3:23270341-23270363 TATTTTGTGCACAAAGGGCTTGG + Intronic
955423104 3:58759701-58759723 TAATTTTTGTACAAGGTGCAAGG + Intronic
957172123 3:76751277-76751299 TAGTTTTTGTATAAGGTGCAAGG - Intronic
957227806 3:77472225-77472247 TAGTTCATGCTCAAGGGGAGGGG + Intronic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958811649 3:98866873-98866895 TAGTTTTTGCATAAGGTGTAAGG + Intronic
959092620 3:101920222-101920244 TAGTTTTTGCATAAGGTGTAAGG + Intergenic
961546856 3:127640259-127640281 TTGTGTGTGCACATGGGGCAAGG + Intronic
965315596 3:167186277-167186299 TTGTCTATGTACAAAGGGCATGG - Intergenic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
974379551 4:61120956-61120978 CAGTCTATGTAAAAGGGGCACGG - Intergenic
975533381 4:75423662-75423684 TGGCTCATGCACAATGGGCATGG - Intergenic
981806536 4:148722215-148722237 TAGTTGATGCAGCAGTGGCAGGG - Intergenic
984704428 4:182837314-182837336 TAGGTTCTGCACAAGAGGGATGG - Intergenic
989225267 5:39020231-39020253 TAGTTGATGCAGCAGTGGCAGGG + Intronic
990141600 5:52710924-52710946 TATTTTTTGAAAAAGGGGCACGG - Intergenic
990761362 5:59133630-59133652 TGGCTTATGCCCAAGGGGTAGGG - Intronic
992503959 5:77367400-77367422 TAGTTCAAACACAAGGGGAAGGG - Intronic
994214035 5:97116874-97116896 AAGTTTATGAACTAGGGGCTGGG + Intronic
998280281 5:140800341-140800363 TAGTTCTTGAAAAAGGGGCATGG + Intronic
1001092476 5:168751484-168751506 TAGATTATGCAGAAGGGAAATGG + Intronic
1004208887 6:13617369-13617391 TAGTTTAGGCACAGGAGACAGGG - Intronic
1005330010 6:24740837-24740859 TATTTTTTGCACCAGAGGCAGGG - Intergenic
1005368148 6:25100466-25100488 TATTTTGTGAACAAAGGGCAGGG - Intergenic
1008158516 6:48047769-48047791 CAGTCTATGCACCAGGGGCTGGG + Intronic
1008369232 6:50714441-50714463 CAGTAGATGCACAAGGGGGATGG + Intronic
1009863724 6:69369393-69369415 TAGTTTATCTTAAAGGGGCATGG - Intronic
1010332576 6:74641540-74641562 TAGTATAGGAACAATGGGCAAGG - Intergenic
1012278212 6:97298641-97298663 GAGTTTATGGTCTAGGGGCAAGG + Intergenic
1012618735 6:101312882-101312904 TAGTTTTTGAACAAGAGGCCCGG - Intergenic
1014870872 6:126594994-126595016 TAATTTTTGCACAAGGTGTAAGG + Intergenic
1016848168 6:148589911-148589933 TAGTTTATGAAGAAGTGGCAGGG + Intergenic
1020719702 7:11726570-11726592 AAGTTAATGCAAAAGGGGAAAGG - Intronic
1021557248 7:21932626-21932648 TAATTTTTGTACAAGGTGCAAGG - Intronic
1024339169 7:48239559-48239581 CAGTTGATGCACATGGGACAAGG - Intronic
1026188329 7:68101702-68101724 TAGTTTCTGCCCAATCGGCAGGG - Intergenic
1029956340 7:104644297-104644319 TAGTGTTTGCACAAGGGCTATGG - Intronic
1035322164 7:158039003-158039025 TAGTTTATGCCAAAGGGGGAGGG - Intronic
1038385631 8:27141855-27141877 TAGTGTATGCACTTGGGGAATGG - Intergenic
1041816898 8:61983533-61983555 TAGTTTATTCATATTGGGCAGGG - Intergenic
1045700168 8:104857064-104857086 TAGATAATGTACAAGAGGCATGG + Intronic
1051741505 9:20256836-20256858 TATTTCATGCTCAATGGGCATGG - Intergenic
1056384725 9:86086619-86086641 TAGTTTTTGTACAAGGTGTAAGG + Intronic
1056624081 9:88239301-88239323 TAGTTTATTCAGGAGGTGCAGGG - Intergenic
1057817086 9:98303746-98303768 TATTTTTTCCACAAGGAGCAAGG - Intronic
1058749738 9:108027753-108027775 TAATTTTTGTACAAGGTGCAAGG + Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060039588 9:120288393-120288415 TAGTTTGTGAACAAGGAACATGG - Intergenic
1187054762 X:15732141-15732163 TAGTTTATGAACACTGGGCTGGG + Intronic
1187657025 X:21487875-21487897 TTGTTTTTGAACAAGGGGCTTGG - Intronic
1190094568 X:47468339-47468361 CAGTTTATGCTCAAGTGGCATGG - Intronic
1192848483 X:74929274-74929296 TAGTTTTTCCATAGGGGGCATGG + Intergenic
1193443837 X:81576173-81576195 TACTTTATGCAAAAGGTACAAGG - Intergenic
1194100100 X:89693631-89693653 TATTTTCTGCAGTAGGGGCAGGG + Intergenic
1195726471 X:107922576-107922598 TTGGTTATCCACAAGGGGTAGGG - Intronic
1198657390 X:138929670-138929692 TATTTTAGGCACAAGGGACAGGG - Intronic
1198737464 X:139802863-139802885 TACATTTTGTACAAGGGGCAGGG + Intronic
1200453102 Y:3354990-3355012 TATTTTCTGCAGTAGGGGCAGGG + Intergenic