ID: 1113796451

View in Genome Browser
Species Human (GRCh38)
Location 13:113061439-113061461
Sequence GAGACATATGGGCCAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113796446_1113796451 28 Left 1113796446 13:113061388-113061410 CCTGGTCAGCTGCCTTGGCGAGC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 133
1113796447_1113796451 16 Left 1113796447 13:113061400-113061422 CCTTGGCGAGCTCACATCTTCTC 0: 1
1: 0
2: 4
3: 12
4: 132
Right 1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 133
1113796448_1113796451 -9 Left 1113796448 13:113061425-113061447 CCACAAAGAGAACAGAGACATAT 0: 1
1: 0
2: 1
3: 39
4: 419
Right 1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 133
1113796445_1113796451 29 Left 1113796445 13:113061387-113061409 CCCTGGTCAGCTGCCTTGGCGAG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113796451 Original CRISPR GAGACATATGGGCCAGCACC AGG Intronic
900539976 1:3197755-3197777 GAGGCCTGTGGGCCAGCTCCTGG + Intronic
900713685 1:4130529-4130551 GAGACACATGCCCCAGCACAGGG - Intergenic
902711477 1:18242987-18243009 GAGTCAGATGGGCCACCCCCAGG - Intronic
903342441 1:22662793-22662815 CAGAAATAAGGGCCAGCTCCTGG - Intergenic
905924189 1:41738213-41738235 GAGACATATAGACAAGCAGCTGG + Intronic
906256553 1:44355067-44355089 GAGACGTCGGGGCCTGCACCTGG - Exonic
907917916 1:58887719-58887741 GTGGCATATGGGCCTGCCCCTGG + Intergenic
908766050 1:67555508-67555530 GAGGGAGATGGACCAGCACCAGG + Intergenic
911005670 1:93219918-93219940 GAGATATATGGGGAAGGACCTGG + Intronic
912161138 1:106986669-106986691 GAGACATATGGGATTGCACTTGG + Intergenic
912419072 1:109531330-109531352 CAGACATCTGATCCAGCACCTGG - Intergenic
917516323 1:175711475-175711497 GAGTCAGATGGAGCAGCACCCGG + Intronic
919168656 1:193927213-193927235 CCGACATCTGTGCCAGCACCTGG - Intergenic
921880903 1:220253241-220253263 GGTACATGTGGGCCAGCAACAGG + Intronic
1063003669 10:1947829-1947851 GAGACAGATGGGAAAGCCCCAGG - Intergenic
1064205863 10:13322898-13322920 CAGCCATCTTGGCCAGCACCGGG + Exonic
1065735471 10:28747377-28747399 AAGACACATATGCCAGCACCAGG - Intergenic
1066705799 10:38176077-38176099 GAGACCTATGAGGCAGCAGCTGG + Intergenic
1070660916 10:78304643-78304665 GAGACAGATGTGCCAGAGCCAGG - Intergenic
1072794291 10:98342674-98342696 TGGTCATATCGGCCAGCACCAGG + Intergenic
1075091558 10:119446748-119446770 GTGGCATCAGGGCCAGCACCAGG - Intronic
1080516560 11:33027143-33027165 GAGGCATCTGGGACAGCATCTGG + Intronic
1082783371 11:57303250-57303272 GAGGCAGGTGGGCCAGTACCTGG - Intronic
1084970824 11:72771214-72771236 GAATCAGGTGGGCCAGCACCTGG + Intronic
1085772865 11:79340386-79340408 GAGACAAATGTGACAGCCCCAGG + Intronic
1086569183 11:88263234-88263256 GGTACATTTGGGCCAGCAACAGG - Intergenic
1097521090 12:60672178-60672200 GGGACATTTGGGCCAGCAACAGG - Intergenic
1100286387 12:93170905-93170927 GAGCCAAATAGGCCAGCACTTGG - Intergenic
1100568144 12:95818650-95818672 GAGAAATATTGGTCAGCATCAGG + Intronic
1101445099 12:104731913-104731935 GAGACAGATGAGCCTGCCCCAGG + Intronic
1105291428 13:19056063-19056085 GTGACATATGCCCCAACACCAGG + Intergenic
1106966387 13:35075103-35075125 GAGACATAAGTGGCAGAACCAGG + Intronic
1113339780 13:109410879-109410901 TGGACATATGGGCCAGTACTTGG - Intergenic
1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG + Intronic
1115052516 14:29080600-29080622 GATACATATGTCCTAGCACCAGG - Intergenic
1115136162 14:30110545-30110567 TAAAAATATGGTCCAGCACCAGG + Intronic
1117413216 14:55469185-55469207 GAGACATATGGCTCAGGCCCAGG + Intergenic
1118602492 14:67480588-67480610 GAGACAGATGGCACAGCACAGGG + Intronic
1118607291 14:67513882-67513904 GAGACATAAGGCCAAGCACTGGG + Intronic
1118613130 14:67556847-67556869 GAGAAATATGGGTCAGCACATGG + Intronic
1128963914 15:72038269-72038291 GAGACTTATGGCCCAGAACATGG - Intronic
1129082846 15:73055734-73055756 GAGACACAGGGGCCAGGAACTGG - Intronic
1130103138 15:80909141-80909163 GAAGCATATGGGACAGCAGCTGG + Exonic
1132635383 16:942864-942886 GTGACATGTGGGATAGCACCAGG - Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134077599 16:11302865-11302887 TTGGCATATGGCCCAGCACCTGG + Intronic
1139632227 16:68237614-68237636 GAGACGCATGGGCCAGTGCCCGG - Intronic
1142495569 17:304860-304882 CAGAAATAGGGGCCAGCCCCCGG + Intronic
1144447249 17:15342156-15342178 TAAAAATGTGGGCCAGCACCTGG - Intergenic
1146400402 17:32496591-32496613 GAGGCATCTGGTCCAGCACGAGG - Intronic
1146634304 17:34492748-34492770 GAGACAAAGCGGCCAGCAGCAGG - Intergenic
1148555435 17:48576326-48576348 AAGACAGATGGGCCTGGACCTGG + Exonic
1151715190 17:75827617-75827639 GAGGCAGATGGGCCAGGGCCAGG + Exonic
1156921406 18:42526894-42526916 GGGCCACATGGGCAAGCACCAGG - Intergenic
1157823792 18:50793970-50793992 GAGACATTTGGGCCATTACCTGG + Intergenic
1164039600 19:21483358-21483380 GACACACATGGGCCCGCAACCGG - Intronic
1164935707 19:32208976-32208998 GAGTCATATGCACCAGCACATGG - Intergenic
1166826659 19:45614099-45614121 GAGACATCTGAGCTAGGACCTGG - Intronic
925089740 2:1144165-1144187 GAGACATATGGGAAAGGATCTGG + Intronic
928417965 2:31112447-31112469 GAGATGTATGGGACAGCACCAGG + Intronic
930376639 2:50575374-50575396 GCGACATATGGGCTAGCAGTAGG + Intronic
937751909 2:125486011-125486033 GAGATACATGGCCCAGCAGCAGG - Intergenic
940342872 2:152599877-152599899 GAGACATGAGAGCCAGCAGCAGG + Intronic
941667392 2:168256036-168256058 TAGACATATGTGCATGCACCTGG - Intergenic
942445655 2:176076238-176076260 GAGATAGATGGGCCAGCAAACGG - Intergenic
944433396 2:199660433-199660455 CAGCCATCTTGGCCAGCACCGGG - Intergenic
944478247 2:200128512-200128534 AAGACATATGGGCCTGCATGAGG - Intergenic
946872422 2:224096454-224096476 GAAACAAATTAGCCAGCACCCGG - Intergenic
948382453 2:237560093-237560115 GAGACATATGGGGTAGGACTTGG - Intergenic
1170683236 20:18545352-18545374 GAGACATTTGGGCAGTCACCTGG + Intronic
1175283161 20:57819020-57819042 GAGAGAGCTGGGCCAGCCCCTGG - Intergenic
1176182717 20:63758438-63758460 GAGACACATGGGGAAGCACCAGG - Intronic
1181390214 22:22575047-22575069 GAGACAGATGGGAGAGCAACAGG + Intergenic
1182111750 22:27728679-27728701 GAGACATCTAGGCCATCAGCAGG + Intergenic
1183606378 22:38868813-38868835 GAGGCATATGGGCTACCTCCAGG - Intronic
1184002012 22:41682050-41682072 GCGACATGTGGGGCCGCACCTGG - Intronic
1185423281 22:50747399-50747421 GAGCCAGGTGGGCCAGCACATGG + Intergenic
950411347 3:12839973-12839995 GAGACATAAGTACCAGCACTAGG + Intronic
952748046 3:36800635-36800657 GGGCCATATGGGGAAGCACCAGG + Intergenic
954506105 3:51075353-51075375 TAGACATTTGGGCCTGGACCTGG + Exonic
956689621 3:71863841-71863863 GAGCCACATGGGGAAGCACCAGG + Intergenic
956702752 3:71973093-71973115 GAGCCTCATGGGCCAGCCCCTGG - Intergenic
959608643 3:108269289-108269311 GAGAAATGTGGGCCAGCTCATGG + Intergenic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
962412846 3:135156370-135156392 GAGACCTATGGGCCTGCAACAGG + Intronic
963594926 3:147314575-147314597 AATACATATGGGTCAGCCCCTGG + Intergenic
963855597 3:150250080-150250102 GGGACATATGGCCGAGCATCTGG - Intergenic
968647784 4:1748955-1748977 GAGCCACCTGGGCCCGCACCAGG + Intergenic
968814415 4:2814633-2814655 GAGACACATGGGCCAGCGTTGGG - Intronic
969017677 4:4115402-4115424 GAGAGACATGAGCCAGAACCGGG + Intergenic
969549826 4:7857594-7857616 GATACATGGGGCCCAGCACCAGG + Intronic
969573530 4:8023880-8023902 GAGCCAGCTGAGCCAGCACCAGG - Intronic
976212124 4:82681859-82681881 GAGACATCTGGGCCAAGAACCGG - Intronic
978488798 4:109287900-109287922 GAGACATATGGGCCAAGAATAGG + Intronic
980863961 4:138531589-138531611 GTGACATATGGGGCACCATCAGG + Intergenic
982997079 4:162362734-162362756 AAGACAAATGGGACAGCTCCTGG + Intergenic
983123644 4:163920697-163920719 GAGACAGATGGGCCAAGAGCTGG + Intronic
985827817 5:2205623-2205645 GAGACGACGGGGCCAGCACCAGG - Intergenic
986826302 5:11526496-11526518 CAGCCAGCTGGGCCAGCACCTGG - Intronic
987404958 5:17515658-17515680 GAAACCTATGGGCCAGATCCAGG - Intergenic
987412559 5:17629389-17629411 GAAACCTATGGGCCAGATCCAGG - Intergenic
991079693 5:62584901-62584923 GGCACATCTGGGCCAGCAGCAGG - Intronic
992120526 5:73587602-73587624 GAAACAGATGGGCCAGAGCCAGG - Intergenic
995578968 5:113574362-113574384 GATGCATGTGGGCCAGCAACAGG - Intronic
998373029 5:141673174-141673196 GAGCCATGTGTGCCAGCCCCTGG + Intronic
1001316496 5:170644673-170644695 GAAACAAATGGGCCATCAGCAGG + Intronic
1003534956 6:6968826-6968848 GAGTCATCTGGGCAAGCAGCTGG + Intergenic
1003736050 6:8878691-8878713 GAGAGAAATGGCCCACCACCTGG - Intergenic
1007378204 6:41470518-41470540 GAGCCATCTGGGCCAGCGCGGGG + Intergenic
1007921171 6:45610916-45610938 TAGACATATTGTTCAGCACCTGG + Intronic
1009279805 6:61733881-61733903 GAAAGAGATGCGCCAGCACCAGG - Intronic
1011942732 6:92863010-92863032 GAGACATAATTGCCAGAACCAGG + Intergenic
1014636569 6:123854566-123854588 GAAACATTTGGCACAGCACCTGG - Intronic
1017693696 6:156992783-156992805 GCAACATAAGGGTCAGCACCAGG + Intronic
1019927754 7:4204596-4204618 GAGGGAGATGGCCCAGCACCCGG - Intronic
1023146964 7:37160861-37160883 CAGACATAGGGGGCAGCACAGGG + Intronic
1023472905 7:40544268-40544290 GAGACACAGGGGCCAGAGCCTGG - Intronic
1023942893 7:44781373-44781395 GAGAGATGTGGCACAGCACCAGG + Intergenic
1027121863 7:75527803-75527825 GACACATACGGGCCAGGCCCGGG + Intergenic
1027164509 7:75824922-75824944 CAGACATGTGTGCCTGCACCTGG - Intergenic
1030809362 7:113956004-113956026 GAGAGATATGGGTCAGCAATTGG + Intronic
1037603997 8:20422320-20422342 GAGAGATTTGTGCCAGGACCTGG + Intergenic
1039412319 8:37365344-37365366 GAGACGTATGTGCCACCACAAGG + Intergenic
1039881517 8:41628154-41628176 GGGGCATTTGGGCCATCACCCGG + Intergenic
1040741520 8:50580946-50580968 GAGACACATGGGCCAGGATGTGG + Intronic
1041168075 8:55111200-55111222 GACACATACGGCCCAGCTCCTGG + Intronic
1041689107 8:60672015-60672037 GGGACAGATGGGACAGCACCAGG - Intergenic
1048243201 8:132764980-132765002 GAGATATATGGGCCAAAGCCTGG + Intergenic
1049461929 8:142734265-142734287 AAGACATAGAGTCCAGCACCTGG - Intronic
1049469420 8:142768834-142768856 GAGACACCTGAGCCAGCGCCAGG + Intronic
1055501981 9:76910194-76910216 GAACCAAATTGGCCAGCACCTGG + Intergenic
1062042722 9:134411507-134411529 GAGGTCTAAGGGCCAGCACCAGG + Intronic
1062162874 9:135089354-135089376 GAGACAGTAGGGCCAGCAGCAGG + Intronic
1062508985 9:136894510-136894532 GATCCATAGGGACCAGCACCGGG + Intronic
1188025339 X:25202445-25202467 CAGAAAAATGGGGCAGCACCTGG + Intergenic
1188563923 X:31503452-31503474 GAAAGACATGGGCCAGCAGCTGG - Intronic
1190502770 X:51095879-51095901 GAGACAGATGAGGCAGCACTGGG + Intergenic
1192727805 X:73770123-73770145 CAGCCATCTTGGCCAGCACCAGG - Intergenic
1193408065 X:81127678-81127700 GAAACACATGGGCCATCAACTGG + Intronic
1195064229 X:101225157-101225179 GAGTCTAATGGGGCAGCACCAGG - Intronic
1198339207 X:135698066-135698088 GAGACATCTGGGCCCCCAGCTGG + Intergenic