ID: 1113796963

View in Genome Browser
Species Human (GRCh38)
Location 13:113064034-113064056
Sequence TAGCAGGGAAGGAGGGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 2, 1: 0, 2: 2, 3: 41, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113796955_1113796963 6 Left 1113796955 13:113064005-113064027 CCTATGGCTAGTGTGCAGTGCCT 0: 2
1: 0
2: 1
3: 7
4: 156
Right 1113796963 13:113064034-113064056 TAGCAGGGAAGGAGGGCGCACGG 0: 2
1: 0
2: 2
3: 41
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113796963 Original CRISPR TAGCAGGGAAGGAGGGCGCA CGG Intronic
900373746 1:2344018-2344040 TGGCCGGGAAGGAGGTCCCAGGG - Intronic
900391578 1:2436172-2436194 GAGGAAGGAAGGAGGGAGCAGGG - Intronic
900502594 1:3013816-3013838 GAGCAGAGAAGGAGGGGCCATGG - Intergenic
900929977 1:5730279-5730301 GAGCAGGGAGAGAGGGAGCAAGG + Intergenic
901506924 1:9690638-9690660 TTGCAGGGATAGAGGCCGCAGGG + Intronic
901511820 1:9721421-9721443 CTGCAGGGAAGGAAGGCGCTGGG - Intronic
901769848 1:11524655-11524677 TGGCAGGGATGGTGGGCACAGGG - Intronic
902827629 1:18987902-18987924 TACCATGGAAGGAGAGCTCAGGG + Intergenic
903207019 1:21790158-21790180 TAGAAGTGAGGGAGGGTGCAGGG - Intergenic
903233230 1:21934291-21934313 TAGCAGGCAAAGAGGGTCCAAGG + Intronic
904424684 1:30415770-30415792 CAGCAAGGAAGGAGGGAGCTGGG - Intergenic
905777678 1:40679746-40679768 TTGCTGGGAAGGCGGGCACATGG + Intergenic
908477729 1:64505752-64505774 GACCGGGGAAGGAGGGCGCCCGG - Intronic
909663292 1:78107161-78107183 AAGGAGGGAGGGAGGGAGCAAGG - Intronic
910338090 1:86155977-86155999 GAGAAGGGGAGGAGGGCGCGAGG + Intronic
912391943 1:109308984-109309006 TAGCAGGGTAGGATGGCTAACGG + Intergenic
912519210 1:110233861-110233883 GAGCAGGGAGGGAGGGCCAAGGG - Exonic
913229998 1:116733924-116733946 TAGCTGGGAGGGTGGGGGCAAGG - Intergenic
913575113 1:120164419-120164441 GAGGAGGGAAGGAGGGGGCAGGG - Intronic
914557418 1:148780060-148780082 GAGGAGGGAAGGAGGGGGCAGGG - Intergenic
914615416 1:149350170-149350192 GAGGAGGGAAGGAGGGGGCAGGG + Intergenic
915078273 1:153330663-153330685 TGGCAGGGGAGGAGGGCAAAAGG + Exonic
915333034 1:155125445-155125467 AAGCAGGGAAAGAGGGCTCCGGG + Intergenic
915637618 1:157197455-157197477 TAGCAGTGAAGGAGGAGGCTGGG + Intergenic
917130674 1:171739212-171739234 TGGAAGGGGAGGAGGGCTCAAGG + Intronic
918342909 1:183582014-183582036 CAGCAGGGAACGAGGGGGCTGGG - Intronic
919801973 1:201359566-201359588 AGGTAGGGAAGGAGGGGGCAGGG + Intronic
919884652 1:201924402-201924424 AAGCAAGGAAGGAGGGAGGAAGG + Intronic
919884683 1:201924506-201924528 AAGCAAGGAAGGAGGGAGGAAGG + Intronic
920046992 1:203139735-203139757 TAGCAGGGAGCGAGAGCCCATGG + Intronic
921486798 1:215724462-215724484 TGGGAGGGAGGGAGGGAGCAGGG + Intronic
922746184 1:228045463-228045485 TAGAAGGGAAGCAGGGCAGATGG + Intronic
923332957 1:232942566-232942588 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
924022300 1:239797204-239797226 TGGGAGGAAAGGAGGGGGCAAGG + Intronic
924565877 1:245198043-245198065 TAGGAGGAAGGGAGGGAGCAGGG - Intronic
924597312 1:245458515-245458537 ACACAGGGAAGGAGGGAGCAAGG - Intronic
924730671 1:246708820-246708842 AAGCAGGGAAGGAGGGAGGGAGG - Intergenic
1063088218 10:2838676-2838698 TAGGAGGGAAGGCAGGCTCATGG + Intergenic
1064798317 10:19039337-19039359 TAGGAGGGAGGGAGGCGGCAGGG + Intergenic
1064812915 10:19222092-19222114 AAGAAGGGATGGAGGGAGCAAGG - Intronic
1065930621 10:30475713-30475735 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1070312206 10:75282046-75282068 TAACAGGGAAGGAGCGGGGATGG - Intergenic
1070549910 10:77482927-77482949 AAGAAGGGAAGGAGGGAGAAAGG - Intronic
1071867714 10:89755390-89755412 AAGGAGGGAGGGAGGGAGCAAGG - Intronic
1071877936 10:89862691-89862713 TGGCAGGGAAGGATGGAGGAGGG - Intergenic
1072844710 10:98816993-98817015 AAGCAGAGAAGGAGAGCACAAGG - Intronic
1073813347 10:107176220-107176242 AAACAGGGAAGGAGGGAGGAAGG - Intergenic
1074311785 10:112328682-112328704 TAGCAGGGGAGGGGGTCACAAGG - Intergenic
1074753336 10:116607514-116607536 TAGGAGGGAGGAAGGGCACAGGG + Intronic
1074977925 10:118595982-118596004 TAGGAGGGAAGGAGCGGGGAAGG + Intergenic
1075400477 10:122158006-122158028 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1075672246 10:124270606-124270628 CAGCAGGGAAGGAGGGGGCTGGG - Intergenic
1076721927 10:132396747-132396769 GGGGAGGGAGGGAGGGCGCAGGG + Intergenic
1077292978 11:1808105-1808127 TAGCTGGGTGGGAGGGCACATGG + Intergenic
1077470395 11:2756036-2756058 TGGCAGGGATGTAGGGCCCAGGG + Intronic
1077630392 11:3807807-3807829 CAACAGGGAAGGAGGGTGAAGGG - Intronic
1077893946 11:6440027-6440049 TTACAGGAAAGGAGGGCACATGG + Intronic
1078859430 11:15233718-15233740 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1079018521 11:16889237-16889259 TAGCAGAGGAGGAGGTCACAAGG - Intronic
1079353577 11:19713166-19713188 AAGGAGAGAAGAAGGGCGCAAGG - Intronic
1080270562 11:30446983-30447005 TAGCAGGGAAGGAGGGATGGAGG + Intronic
1080557064 11:33427487-33427509 TAGCAGCGAAGGGGGATGCATGG - Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1083262139 11:61528899-61528921 CTGCTGGGAGGGAGGGCGCATGG + Intronic
1083741984 11:64716080-64716102 TAGCAGGGAAGGAGGAAGGGAGG - Intronic
1083864357 11:65445702-65445724 TAGCAGGGCAGGAGGGCTTCTGG - Intergenic
1084685374 11:70691301-70691323 AAGGAGGGAAGGAGGGAGAAAGG + Intronic
1085626960 11:78081089-78081111 TAGCAGGGGAGGGGGTCACAAGG - Intergenic
1086307165 11:85493797-85493819 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1086486647 11:87310477-87310499 GAGGAGGGAGGGAGGGAGCAGGG + Intronic
1086514968 11:87601173-87601195 CAGCACAGAAGGAGGCCGCATGG + Intergenic
1087207980 11:95417148-95417170 AAGGAAGGAAGGAGGGAGCAAGG + Intergenic
1088402171 11:109433137-109433159 AAGCAGGGAAGGAGGGGGTATGG + Intergenic
1088675195 11:112186105-112186127 TAGAAGAGAAGGAGGGCAAAGGG + Intronic
1089390691 11:118099674-118099696 AAGATGGGAAGGAGGGGGCAGGG - Intronic
1089691679 11:120190719-120190741 TAGCTGGGAAGGAGGGATCCTGG + Intergenic
1089744717 11:120608747-120608769 GAGCAGGGCAGGAGGTAGCAGGG - Intronic
1090190460 11:124763007-124763029 GAGCAGGGAAGGTTGGCACAAGG + Intergenic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1091195890 11:133730496-133730518 TAGAAGGGGAGGGGGGTGCAGGG - Intergenic
1092934493 12:13347870-13347892 GAGCAGGGAAGGAGAGCCCCAGG - Intergenic
1092987763 12:13863096-13863118 TAGCAATGAAGGAAGGAGCAAGG + Intronic
1094589074 12:31804405-31804427 TGGGAGGGAAGGAGGGCAGAAGG - Intergenic
1095211272 12:39497975-39497997 GAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1095803960 12:46297654-46297676 TGGCAGGGAAGGAGAGGGGAAGG - Intergenic
1096540586 12:52304794-52304816 CAGAAGGGAAGGAGAGGGCATGG + Intronic
1098150116 12:67537932-67537954 TGGCAGGGAGAGAGGGGGCAGGG + Intergenic
1098861409 12:75714983-75715005 CACCAAGGAAGGAGGGGGCAGGG - Intergenic
1099005783 12:77233252-77233274 TATCAGGGATGGAGGGAGGAAGG - Intergenic
1099602774 12:84762226-84762248 AAGCAAAGAAGGAGGGAGCAAGG + Intergenic
1099669268 12:85669569-85669591 TAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1100807742 12:98305013-98305035 TAGCAGGAAGGGAGGGAGAAAGG - Intergenic
1101303262 12:103503269-103503291 TACCAGGTCAGGAGGGCCCAGGG + Intergenic
1101303668 12:103505665-103505687 TACCAGGGATGCAGGGCTCAAGG + Intergenic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103560455 12:121790709-121790731 CAGCAGAGAAGCAGGGCTCAGGG - Intronic
1103890113 12:124232280-124232302 TCCCAGGGAAGGAGGGGCCAGGG - Intronic
1103956804 12:124581979-124582001 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1105015910 12:132786791-132786813 TGGAAGGGAAGGAGGGCGTGAGG + Intronic
1106065176 13:26340856-26340878 TAGAAGGGAGGGAGGGAGGAAGG + Intronic
1106230266 13:27815986-27816008 AAGGAGGGAAGGCGGGAGCATGG - Intergenic
1106230747 13:27819531-27819553 AAGCAGGGAGGGAGGCCACAGGG + Intergenic
1110221575 13:73079830-73079852 TAGCACAGAAGGAGGGCACTGGG + Intergenic
1110236365 13:73221677-73221699 TAGCAGGTGTGGAGGGCGCAGGG - Intergenic
1113796700 13:113062426-113062448 TAGCAGGGAAGGAGGGCGCACGG - Intronic
1113796963 13:113064034-113064056 TAGCAGGGAAGGAGGGCGCACGG + Intronic
1114457487 14:22865625-22865647 AGGCAGGGAAGGAGGACCCAGGG - Intergenic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116805387 14:49489455-49489477 AAGGAGGGAAGGAGGGAGAAAGG + Intergenic
1117092348 14:52263918-52263940 AAGGAGGGAAGGAGGGTGAAGGG - Intergenic
1118332676 14:64826068-64826090 TGGCAGGGGAAGAGGGCACAAGG - Intronic
1118698314 14:68407867-68407889 TGGAAGGGCAGGTGGGCGCAGGG + Intronic
1118905491 14:70020481-70020503 TAGCTGGGAAGGAGGAAGGAAGG + Intronic
1119423782 14:74523250-74523272 TTGCAGGGAGGGATGGCGCTGGG - Intronic
1119741718 14:77018015-77018037 TGGCATGGAAGGAGGGGGTAAGG - Intergenic
1119853971 14:77885657-77885679 TAGCAGGGATAGAGGGAGGAAGG + Intronic
1121312901 14:92944741-92944763 TATGAGGGAACCAGGGCGCAAGG - Intronic
1121614273 14:95302348-95302370 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1122059798 14:99129397-99129419 GAGCAGGGAAGGAGGCTGGATGG - Intergenic
1122078048 14:99248152-99248174 GAGCAGGGAGGGAGGGAGGAGGG - Intronic
1123907046 15:24931690-24931712 TAGCAGGGAATGGTGGCACATGG + Intronic
1125283903 15:38072472-38072494 CAGCAGGGAAGGTGGGTGTAAGG + Intergenic
1125450727 15:39803892-39803914 AATCAGGGAAGGAGGGAGCATGG + Intronic
1126370173 15:47937846-47937868 AGGCAGGGAAGGAGGGAGCAAGG + Intergenic
1128651125 15:69414494-69414516 GAGCAGGGAGAGAGGGCGGACGG + Intronic
1129115197 15:73361732-73361754 TTTCAGGGTAGGAGGGGGCAGGG + Intronic
1129388256 15:75207505-75207527 TTCCACAGAAGGAGGGCGCAAGG + Exonic
1129766850 15:78175082-78175104 TAGCAGGGCAGGTGAGAGCATGG - Intronic
1129843481 15:78757667-78757689 TGGAAGGGAGGGAGGGAGCATGG - Intergenic
1130130067 15:81133675-81133697 ACCCAGGGAAGGAGGGAGCAAGG + Intronic
1131135347 15:89930337-89930359 TAGCAGGGTCAGAGGGCACAAGG - Intergenic
1132415563 15:101616231-101616253 TAGCAGGGCAGGAGGCCAGAGGG + Intergenic
1132671089 16:1102613-1102635 AGGCAGGGCATGAGGGCGCAAGG - Intergenic
1132828315 16:1915812-1915834 GAGGAGGGAAGGAGGGCCTATGG + Intronic
1132870774 16:2114834-2114856 GAGCAGTGCAGGAGGGCGCCAGG + Exonic
1133029170 16:3001490-3001512 TGGGAGGGGAGGAGGGGGCAAGG + Intergenic
1133881895 16:9790088-9790110 CTGCAGGGAAGGAGGGTGCCTGG + Intronic
1134095141 16:11414077-11414099 TTGCAGGGCAGAAGGACGCAGGG + Intronic
1134950177 16:18347924-18347946 GAGCAGTGCAGGAGGGCGCCAGG + Intergenic
1136131603 16:28225418-28225440 TATCAGGAAAGTAGGGCTCAGGG - Intergenic
1136629173 16:31479365-31479387 TAGCAGAGAAGGATGGGGCCAGG + Intergenic
1137271783 16:46907062-46907084 TAGCAGGGAGGGTGGCAGCACGG + Intronic
1137273708 16:46919576-46919598 GAGCTGGAAAGGAGGGGGCACGG + Intronic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1138401645 16:56749938-56749960 TAGCAGGTAAGGAGCCTGCAGGG - Intronic
1138972057 16:62157309-62157331 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1139210063 16:65068116-65068138 AAGGAGGGAGGGAGGGGGCAGGG + Intronic
1139493966 16:67302681-67302703 TAAAAGGGAAGGAGGGTGGATGG - Intronic
1139588446 16:67919414-67919436 TGGCAGGGAAGAAGGGCTTAGGG - Intronic
1140092954 16:71852252-71852274 TAGAAGGGCAGGAGGCCCCAAGG + Exonic
1140967683 16:79983063-79983085 TGGCAGGGATGGAGGGAGGAAGG - Intergenic
1141537043 16:84689136-84689158 TAGGAGGGAGGGAAGGCACATGG - Intergenic
1142381151 16:89732935-89732957 CAGCAGAGGATGAGGGCGCAGGG - Intronic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1142759526 17:2034750-2034772 CAGCAGGGGAGGGGGGAGCAGGG - Intronic
1143485553 17:7251812-7251834 GAGCAGGGAAGGAGGGGGAGGGG + Intronic
1143714631 17:8758123-8758145 GATCGGGGAAGGAGGGTGCAGGG - Intronic
1145107011 17:20126187-20126209 GAGCAGGGAAGGAGGGAGAAAGG - Intronic
1145265671 17:21378524-21378546 GAGCAGGGAGTGAGGGCGGAGGG + Intronic
1146845417 17:36179014-36179036 GAGCAGGGTGGGAGGGGGCAAGG + Intronic
1146873632 17:36390857-36390879 GAGCAGGGTGGGAGGGGGCAAGG + Intronic
1146880991 17:36441945-36441967 GAGCAGGGTGGGAGGGGGCAAGG + Intergenic
1147065756 17:37922016-37922038 GAGCAGGGTGGGAGGGGGCAAGG - Intergenic
1147154458 17:38536665-38536687 TAGCAAGGAAGGAGGGCATGGGG - Intronic
1147807862 17:43144928-43144950 CAGCAGGGAAGGTGGGTGCCAGG - Intergenic
1148064559 17:44859470-44859492 TAGCAGGCCAGGAGGGCTAAAGG - Intronic
1148140264 17:45323192-45323214 TAGAAGGGAAGGAGAATGCAGGG - Intergenic
1148441581 17:47714286-47714308 TAGCTGGGAAGGGGCGGGCAAGG + Intergenic
1148561671 17:48610112-48610134 TAGCTGGGAAGGGGGGAGAAGGG + Intronic
1148860343 17:50601276-50601298 CAGCAGGGAACGAGGGGGCCAGG + Intronic
1148889888 17:50799921-50799943 TAGCAGGGAGGGAGGGAGCCAGG + Intergenic
1149581612 17:57754575-57754597 TAGCAGTTAAGGAGAGTGCATGG + Intergenic
1152891043 17:82881925-82881947 TAGGAGGGAGGGAGGGAGGAAGG - Intronic
1156367310 18:36440923-36440945 TAGCAGGGCAGGAGGGTGGCGGG - Intronic
1156375524 18:36511884-36511906 AAGCATGGAAGCAGGGTGCAGGG - Intronic
1156453706 18:37281050-37281072 TATCAGGGAAGGATGGGGCTCGG + Intronic
1156761803 18:40601049-40601071 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1157386369 18:47262232-47262254 TATGAGAGAAGGAGGGAGCAGGG - Intergenic
1158307668 18:56124726-56124748 TAGAGGGGAAGGGGGGCACATGG + Intergenic
1160560268 18:79751347-79751369 CAGGAGGGAAGGAGGGAGCGGGG + Intronic
1161399455 19:4060893-4060915 GAGCAGGGAAGGAGGCCAAAGGG + Intronic
1161545769 19:4878898-4878920 CAGCTGGCAAGGAGGGGGCAGGG + Intergenic
1162840604 19:13353807-13353829 GAGCAGAGAAGGAGGGAGCCAGG - Intronic
1162964542 19:14149671-14149693 GAGCAGGAAAGGAGGGTGCCAGG + Exonic
1163329532 19:16627832-16627854 GAGCTGGGACGGAGGCCGCATGG - Intronic
1164004342 19:21134967-21134989 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1164305623 19:24002518-24002540 GAGCAGGGAAGGGGAGAGCAGGG + Intergenic
1164441679 19:28284416-28284438 AAGAAGGGAAGGAGGGTGGAAGG + Intergenic
1164441921 19:28285207-28285229 TAGAGGGGAAGAAGGGTGCAGGG + Intergenic
1164522251 19:28988465-28988487 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1164782245 19:30902322-30902344 TAGCGGGGAAGGAGGACACTGGG - Intergenic
1164998734 19:32743389-32743411 GAGCAGGGGAGGAGAGCGGAGGG - Intronic
1165085799 19:33346146-33346168 TATCAGAGAAGCAGGGGGCAGGG + Intergenic
1165166258 19:33859306-33859328 TAGCAGAGAAGAAAGACGCAGGG - Intergenic
1165330973 19:35141097-35141119 GAGCAGGGAAGGTGAGGGCAGGG - Intronic
1165331392 19:35142795-35142817 TGGGAGGGAAGGAGGGAGGAAGG + Intronic
1165402360 19:35609956-35609978 TAGCAGGAAAGGAAGTCACAGGG + Intergenic
1166071895 19:40392877-40392899 TGGCAGGGATGGATGGCCCATGG + Intergenic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166688807 19:44810870-44810892 GAGAAGGGATGGAGGGCGAAAGG + Intronic
1167017492 19:46850598-46850620 GGGCCGGGAAGGAGGGCACAGGG - Intronic
1167281480 19:48571779-48571801 GAGCAGGGGAAGAGGGTGCAGGG + Intronic
1168126312 19:54285506-54285528 TAGCAGGGAGGGAGGAGGCCAGG + Intergenic
1168175580 19:54625358-54625380 TAGCAGGGAGGGAGGAGGCCAGG - Intronic
925436869 2:3846110-3846132 GAGGAGGGAAGGAGGGAGAAAGG - Intronic
925609335 2:5691388-5691410 GAGAAGGGAAGGAGGGCGCCGGG + Intergenic
925684629 2:6458587-6458609 GAGCAGGGGTGGAGGGCTCACGG + Intergenic
925704669 2:6673079-6673101 TAGGAAGGAAGGAGGCCACAGGG + Intergenic
926363675 2:12113701-12113723 TGGCAGGAAAGGTGGCCGCATGG + Intergenic
927287505 2:21371686-21371708 AAGGAGGGAAGGAGGGAGAAAGG + Intergenic
928417337 2:31106879-31106901 GAGGATGGAAGGAGGGCCCAGGG + Intronic
929795969 2:45058626-45058648 TATCAGGGAAGGATGGGGCAGGG - Intergenic
929968499 2:46553230-46553252 TGGTAGGGAGGGAGGGGGCAGGG - Intronic
930136264 2:47906186-47906208 GAGAAGGGAGGGAGGGAGCAGGG + Intergenic
930424963 2:51201626-51201648 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
931867068 2:66425037-66425059 GAGCAGGGAAGGAGGAAGGATGG + Intergenic
932595016 2:73088256-73088278 TGGCAGAGAAGGAGGGAGCCCGG - Exonic
933858586 2:86441934-86441956 CAGCAGGGAGGGCGGGCGGAGGG - Intronic
935086861 2:99855779-99855801 TAGCATGGAAGGAGGGAAAAAGG + Intronic
935157801 2:100498744-100498766 GAAGAGGGAAGGAGGGGGCAAGG - Intergenic
935832130 2:107011285-107011307 TAGAAGGGAAGGAGGCAGGAAGG - Intergenic
937324430 2:120981829-120981851 AAGGAGGAAAGGAGGGAGCAAGG - Intronic
937373514 2:121319311-121319333 TGGCAGGGAGGGAGGGATCATGG + Intergenic
937814939 2:126240912-126240934 GAGCAAGGAAGGAGGGGGCGCGG - Intergenic
938058248 2:128233073-128233095 GAGCAGGGAGGTAGAGCGCAAGG - Intergenic
938463101 2:131510546-131510568 GAGCAGGGAGGGAAGGAGCAGGG - Intergenic
938934786 2:136118253-136118275 ACGCGAGGAAGGAGGGCGCAGGG + Intergenic
939121956 2:138127641-138127663 AAGAAGGGAAGGAGGGAGAAAGG - Intergenic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
940418745 2:153454118-153454140 TAGTAGGGAAGGATGGAGAAGGG + Intergenic
942332929 2:174847592-174847614 TAGCAGGGAAGGTGGGGGGAAGG + Intronic
942394481 2:175532914-175532936 TACCGGGGAAGGAGGGGGCAAGG + Intergenic
943470864 2:188292287-188292309 TGCCCGGGAAGGAGGGCGCGGGG + Intronic
943684605 2:190805226-190805248 AAGCAGGGAGGGAGGGAGGAAGG + Intergenic
946010021 2:216557206-216557228 TAGCTGGGAAGGATGGAGCCTGG + Intronic
947473165 2:230415987-230416009 GACCAGGGAAGGAGGGCCCAGGG - Intronic
948261587 2:236607916-236607938 TAGCAGGGATGGGGTGCTCAGGG + Intergenic
948279150 2:236733200-236733222 TGGCAGGGGAGGAGGGAGTAAGG - Intergenic
948304690 2:236937863-236937885 TAGCCGGGCATGATGGCGCATGG - Intergenic
948560613 2:238848872-238848894 TAGCAAGGAAGGCGGGCGGGCGG + Intronic
948787938 2:240362825-240362847 TTGCAGAGCAGGAGGGGGCAGGG - Intergenic
948995475 2:241576158-241576180 CTGCAGGGAAGGAGGGTGGAGGG - Intergenic
949045972 2:241872815-241872837 CAGCAGGGAAGGGGAGGGCAAGG - Exonic
1168892910 20:1306249-1306271 GAGCAGGGAAGGGGGACCCAAGG + Exonic
1168960061 20:1862887-1862909 GAGGAGGGAAGGAGGGAACATGG - Intergenic
1170481092 20:16765742-16765764 TTGCTGGGAAGGAGGGCGGCTGG - Intronic
1170843085 20:19939748-19939770 TAGAAGAAAAGGAGGGCTCAAGG - Intronic
1171262341 20:23745926-23745948 TAGGAGGGGAGCAGGGGGCAGGG - Intergenic
1171335740 20:24383935-24383957 AAGCGGGGGAGGAGGGCGCCTGG - Intergenic
1172094655 20:32454759-32454781 TAGCAGGTAAGGCAGGCTCAGGG + Intronic
1172337118 20:34126304-34126326 TAGGAGGTGAGGAGGGGGCAGGG + Intergenic
1172693975 20:36809066-36809088 TAGCAGGGAGGGGTGACGCATGG + Intronic
1172909454 20:38395901-38395923 TAGAAGGCAAGGAGGAAGCAAGG + Intergenic
1173132968 20:40411783-40411805 GAGCAGGGAAGGAGGCTGCATGG - Intergenic
1173252247 20:41370177-41370199 TTGCAGTGAAAGAGGGAGCATGG - Intergenic
1173294143 20:41740687-41740709 GGGCAGGGAGGGAGGGGGCAGGG - Intergenic
1174137572 20:48391085-48391107 AGGAAGGGAAGGAGGGGGCAGGG + Intergenic
1174797399 20:53533737-53533759 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1175232669 20:57483783-57483805 GAGCAGAGCAGGAGGGGGCATGG + Intergenic
1175248320 20:57594408-57594430 TCGCAGGGCAGGAGGGCGCGGGG - Intergenic
1175440796 20:58989827-58989849 TTGCAGGGAGAGAGGGGGCAGGG - Intronic
1176117031 20:63437249-63437271 TTCGAGGGAAGCAGGGCGCATGG + Intronic
1176275346 20:64262952-64262974 TAGCAGGGGAGGAGGACACAGGG - Intronic
1176424674 21:6540901-6540923 AAGCAGGGAAGGAGGGTGGCAGG - Intergenic
1177859403 21:26435371-26435393 TAGCTGGGAGTGATGGCGCATGG - Intergenic
1179388926 21:40969826-40969848 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179600469 21:42474317-42474339 TAGCTGGGAGGGAGGTGGCAAGG - Intronic
1179700163 21:43149210-43149232 AAGCAGGGAAGGAGGGTGGCAGG - Intergenic
1180015815 21:45082913-45082935 CAGCAGGAAAGAAGGCCGCAGGG - Intronic
1180056504 21:45361767-45361789 CAGCAGGGAGGGAGGCCGCTGGG - Intergenic
1180231306 21:46428327-46428349 CAGCAGGGAAGGCCGGGGCATGG + Intronic
1180256229 21:46629925-46629947 TAGCTGGGAAGGGTGGCACACGG + Intergenic
1181459429 22:23077601-23077623 CAGCAAGGGAGGAGGGGGCAAGG + Intronic
1181523182 22:23460822-23460844 TAGCAGGGTAGGCGGGAGGAGGG + Intergenic
1182162921 22:28141222-28141244 TGGCAGGGAAGGAGGGAGCCAGG - Intronic
1182827779 22:33280702-33280724 TAGCAGGGAAGGAGGCTACCTGG - Intronic
1182860669 22:33556613-33556635 AAGGAGGGAAGGAGGGAGAAAGG + Intronic
1183198702 22:36371125-36371147 TAACAGGGAAGAAGGGAGTAGGG - Intronic
1183362072 22:37387951-37387973 AAGCAGGGGAGGAGGGGGAAGGG - Intronic
1183432431 22:37773818-37773840 CAGGAGGGAAGGAGGGCGGCTGG - Exonic
1183492443 22:38123711-38123733 AAGCAGGGGAGGAGGGGGCAGGG + Intronic
1183503589 22:38195989-38196011 AAGAAGGGGAGGAGGGCACAAGG + Intronic
1183924719 22:41197572-41197594 TGGCCGGGAAGGCGGGCGCGCGG - Intergenic
1184426682 22:44412729-44412751 AAGCAGGAACGGAGGGCGCTGGG - Intergenic
1184830109 22:46980000-46980022 AAGCAGAGAAGGAGTGCGCCGGG + Intronic
1184896208 22:47408398-47408420 TAGCAAGGAAGGAGAGCCCTAGG + Intergenic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185309209 22:50144383-50144405 TAGCGGTGAGGGAGGGCCCATGG - Intronic
1185415079 22:50705345-50705367 ACGCCGGGAAGGAGGGGGCAGGG - Intergenic
949634424 3:5967490-5967512 AAGGAGGGAAGGAGGGATCAAGG - Intergenic
950017115 3:9762055-9762077 TAGCAGGGAAGCAGTGAGGATGG - Intronic
950570333 3:13795948-13795970 GAGCAGGGCAGGAGGGGGCTGGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951894088 3:27594597-27594619 AAGCAGGAAAGGAGGGAGTAAGG + Intergenic
952184468 3:30953804-30953826 GAGCAGGGAAGGATGGCACAGGG + Intergenic
952659653 3:35830146-35830168 TAAGAGGGAAGGAGGGAGCAAGG - Intergenic
952970788 3:38649276-38649298 GGGAAGGGAAGGGGGGCGCACGG + Intronic
953134524 3:40171208-40171230 TAGCAAGGCAGGAGGGGACACGG + Intronic
953578775 3:44134722-44134744 TAGCTGGGAAGGTGTGAGCAGGG + Intergenic
955798291 3:62660661-62660683 CAGCAGGGAGGGTGGGCACAGGG - Intronic
956141528 3:66151325-66151347 TACGAGGGAAGCAGGGGGCAGGG + Intronic
956481113 3:69674844-69674866 AGGCAAGGAAGGAGGGTGCATGG + Intergenic
956796022 3:72719412-72719434 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
956864723 3:73357574-73357596 TACTAGGGAAAGAGGGGGCAGGG + Intergenic
959122726 3:102252291-102252313 TAGCAGGGAAGTACGGTGCAAGG + Intronic
959637756 3:108594413-108594435 GAGCAGGGAGGGAGGGGGGAGGG - Intronic
961056957 3:123797530-123797552 TGGCAGAGGAGGAGGGCACAGGG - Intronic
961136949 3:124520176-124520198 CAGGAGGGAATGAGGGAGCAGGG + Intronic
961163424 3:124748619-124748641 TCCCAGGGAAGGAGGGAGGAAGG + Intergenic
961468557 3:127096876-127096898 TAGCAGAGAAGGAGCCTGCAGGG - Intergenic
963854207 3:150237526-150237548 AAGGAGAGAAGGAGGGGGCATGG + Intergenic
964260655 3:154832317-154832339 TAGCAGGGAAGGAAAGAGTATGG - Intergenic
966896562 3:184449403-184449425 TGGCAGGGATGGAGGATGCATGG - Intronic
968196741 3:196712783-196712805 CGGGAGGGAAGGAGGGCACACGG - Intronic
968942944 4:3648541-3648563 AAGCGGGGAAGGAGGGAGCCCGG - Intergenic
969436925 4:7193808-7193830 TAGCCGGGAAGGTGGGGGGAGGG - Intronic
972053707 4:34773544-34773566 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
972285341 4:37642775-37642797 GAGCAGGGGAGGACGGGGCAGGG + Intronic
972594028 4:40514526-40514548 AAGCAGGGAAAGAGAGCGCCAGG - Exonic
973772862 4:54222699-54222721 AAGCAGGGAAGGAGGGAGGGAGG - Intronic
974366533 4:60956910-60956932 TAGCAGATGAGGAGGGAGCAGGG + Intergenic
976929668 4:90550101-90550123 AAGCAGGGAAGGGGGTCCCAGGG + Intronic
978407368 4:108394737-108394759 CAGCTGGGAAGGATGGGGCATGG - Intergenic
979994319 4:127412156-127412178 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
980807148 4:137828332-137828354 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
981288974 4:143051947-143051969 AAGCGGGGAAGGAGGGAGAAAGG + Intergenic
981413335 4:144458747-144458769 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
981413373 4:144458875-144458897 AAGAAGGGAAGGAGGGAGGAAGG + Intergenic
981611918 4:146602236-146602258 TGGAAGGGAAGGAGGGTGGAAGG - Intergenic
982558628 4:156900886-156900908 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
984261495 4:177448494-177448516 TAGGAGGGAAGGAGGGGGTGAGG - Intergenic
984554414 4:181197141-181197163 TAGCAGGGAAGGGGAGCAGATGG - Intergenic
986106996 5:4669200-4669222 AAACAGGGAAGGAGGGAGAATGG - Intergenic
986720457 5:10557391-10557413 TCCCAGGGAAGGAGGGCTCAGGG + Intergenic
987258458 5:16180077-16180099 GAGCTGGGAAGTAGGGGGCAGGG + Intronic
988029519 5:25745129-25745151 TAGGAGGGAAAAAGGGCACACGG + Intergenic
988262980 5:28912694-28912716 TAGCAGGGATGCAGGGAGCAGGG - Intergenic
988612172 5:32737103-32737125 TAGGAGGGGAGGAGGGTGGAAGG - Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989795422 5:45465338-45465360 TAACAGGGTAAGAGGGCTCAGGG + Intronic
992202690 5:74399816-74399838 TATCAGGGAAGGAGTTTGCATGG + Intergenic
992703424 5:79363310-79363332 TAGCAAGGAAGGAGAGTGGAAGG - Intergenic
992945118 5:81802337-81802359 TAGAAGGGGAAGAGGGCCCACGG + Intergenic
993836200 5:92823085-92823107 CAGGAGGGAAGGAGGGGACAAGG + Intergenic
994274887 5:97823439-97823461 AAGGAGGGAGGGAGGGAGCAAGG - Intergenic
994815105 5:104576174-104576196 GAGAAAGGAAGGAGGGGGCAGGG - Intergenic
994918983 5:106017693-106017715 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995567510 5:113446799-113446821 TGGCAGGGAGGGAGAGGGCAAGG + Intronic
995758995 5:115544437-115544459 TGGGCGGGAAGGAGGGCGCCGGG - Intronic
996852882 5:127972427-127972449 TATCAGAGAAGGAGGGAGAATGG - Intergenic
997804949 5:136907583-136907605 TCGCAGGCAAGGAGTGAGCAAGG - Intergenic
997903896 5:137795029-137795051 TAGCCGGGAGGGAGGGGCCAGGG + Intergenic
998152146 5:139763627-139763649 GAGCAGGGAAGGTGTGAGCAAGG - Intergenic
998264807 5:140659903-140659925 GGGCAGGGTAGGAGGGAGCAGGG - Intronic
998499654 5:142621379-142621401 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1000205048 5:159050733-159050755 TGGCGGGGAAGGAGGGCTCCTGG - Intronic
1000571820 5:162924199-162924221 GTGGAGGGAAGGAGGGCCCAGGG + Intergenic
1001575896 5:172763649-172763671 TGGGAGGGAAGGAGGGCCCAGGG + Intergenic
1002427732 5:179185949-179185971 TACCAGGGAGGGAGGGCTGAGGG - Intronic
1002522643 5:179800129-179800151 TCGCAGGGCAGGGCGGCGCAGGG + Intronic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1002917724 6:1542206-1542228 AGGCAGGGAAGGAGGGAGGAGGG + Intergenic
1004596208 6:17102137-17102159 TAGCAGGGGCGTAGGGCGCAGGG + Intergenic
1004614645 6:17279090-17279112 TATCAGGGAAGGAGGGTGTCTGG - Intergenic
1005000470 6:21235174-21235196 AAGGAAGGAAGGAGGGGGCAGGG - Intergenic
1005203587 6:23375348-23375370 GAGGAGGGAGGGAGGGAGCAGGG - Intergenic
1005441892 6:25878943-25878965 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1006903259 6:37516487-37516509 GAGCAGGCAAGCAGGGCACATGG - Intergenic
1007086276 6:39148416-39148438 TAGCTGGGAGTGATGGCGCATGG - Intergenic
1007557999 6:42782752-42782774 GAGCCGGGAAGGAGGGAGCAGGG + Intronic
1008057466 6:46959873-46959895 AAGCAAGGAAGGAGGGAGAAAGG + Intergenic
1010604490 6:77871543-77871565 TAGCAGGGAGAGAGGGAGGAGGG + Intronic
1011855762 6:91688565-91688587 TAGAAAGCAAGGAGGGCGAAGGG - Intergenic
1012223174 6:96675883-96675905 TAGCAGGGGAGGAGTGAGAAAGG - Intergenic
1013459767 6:110363992-110364014 TGGCAGGGAAAGAGAGCACAAGG + Intergenic
1013536908 6:111071377-111071399 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1013658992 6:112275440-112275462 TAGCAAGAAAGGAGGGAGAATGG + Intergenic
1015085574 6:129287088-129287110 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1015774074 6:136795901-136795923 CGGGAGGGAAGGAGGGAGCAAGG - Intergenic
1016784553 6:147995771-147995793 GAGCAAGGAAGGAGGGAGAAGGG + Intergenic
1017297228 6:152812049-152812071 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1018539421 6:164862549-164862571 AAGCAGGTAAGGAGGCAGCAGGG + Intergenic
1019148122 6:169987430-169987452 TCGGAGGGAAGGAAGGCTCAGGG + Intergenic
1019179290 6:170176693-170176715 GGGCCGGGAAGGAGGGCGCGGGG + Intergenic
1019266803 7:121659-121681 GAGCAGGGAAGGAGAGAGGACGG + Intergenic
1019549225 7:1593944-1593966 AAGCAGGGAAGGAGGGAGGAAGG - Intergenic
1021112450 7:16710656-16710678 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1021995857 7:26177595-26177617 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1022802512 7:33789694-33789716 TAGAAGGCAAGGAAGGCACAAGG - Intergenic
1022975041 7:35549020-35549042 GAGCAAGGGAGGAGGGCTCAAGG + Intergenic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023133167 7:37024064-37024086 AAGGAGGGAAGGAGGGAGAAAGG - Intronic
1023254820 7:38302431-38302453 TGGCAGGGATGGAGTGTGCAGGG - Intergenic
1023320473 7:38991920-38991942 GAGAAGGGAAGGAGGGGGTATGG - Intronic
1023848148 7:44134821-44134843 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1024311608 7:47974662-47974684 GAGCAGGATAGGAGGGAGCAGGG + Intronic
1024616862 7:51122831-51122853 TAGCAGGGCATGGTGGCGCATGG + Intronic
1024991230 7:55235731-55235753 TAGGTGGGAAGAAGGGGGCAGGG - Intronic
1025086713 7:56029308-56029330 TAACAGGGAGGGAGAGGGCAGGG + Intronic
1026540544 7:71276215-71276237 TAGCAGGGCAGGTGGCTGCAGGG + Intronic
1026595747 7:71733022-71733044 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1026595764 7:71733070-71733092 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1026662810 7:72317142-72317164 AGGCAGGGAAGAAGGGAGCAGGG + Intronic
1027421703 7:78023363-78023385 AAGGAGGGAAGGAGGAGGCAGGG - Intronic
1028064194 7:86361063-86361085 CATCAGGGAAGGAGGGAACAAGG + Intergenic
1029204891 7:98863671-98863693 AAGCAGGGAAGGAGGAAGGAAGG - Intronic
1029625413 7:101717716-101717738 TTGCAGGGAGGGAGGGGGCTCGG - Intergenic
1029972557 7:104803523-104803545 TAGGATGGAAGGAGTGAGCATGG - Intronic
1030084616 7:105805833-105805855 TAGCAGGGAATGAGGATGCTGGG + Intronic
1032275741 7:130453741-130453763 AAGGAGGGAAGGAGGGGGCAAGG - Intergenic
1033288346 7:140061479-140061501 AAGCAAGAAAGGAGGGAGCAGGG + Intronic
1034109620 7:148523633-148523655 TAGCAGAGAAGGAGAGAGGAAGG + Intergenic
1034609189 7:152349626-152349648 TAGCAAGGAGGGAGGGAGCAAGG + Intronic
1035162419 7:156960937-156960959 ATGAAGGGAAGGAGGGCTCAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036207252 8:6814460-6814482 CAGGAGGGAAGGAGGTGGCAGGG + Intronic
1036218736 8:6902745-6902767 AAACAGGGAGGGCGGGCGCAGGG - Intergenic
1036709448 8:11068817-11068839 TAGCAGGCACCGAGGGGGCAGGG - Intronic
1037773702 8:21818748-21818770 TAGCAGGGAAAGAGAGAGCCAGG + Intergenic
1041453791 8:58035862-58035884 AAGCAGGGAAGGAGGGCAGAAGG - Intronic
1041802317 8:61813488-61813510 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1043960956 8:86417864-86417886 CAGCAGGGCAGGAGAGCTCAAGG + Intronic
1045036593 8:98180952-98180974 GAGTAGGGAAGGATGGAGCAAGG + Intergenic
1045089624 8:98728066-98728088 TAGGAGAGGAGGAGGGGGCAGGG - Intronic
1045174829 8:99711222-99711244 TAGCAGACAAGGAAGGCACATGG + Intronic
1045487120 8:102640410-102640432 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045622753 8:104001523-104001545 TAACAGGCAAGGAGAGTGCAGGG - Intronic
1045642980 8:104272355-104272377 TAGCAGGGAAGCAGGGAGGTGGG + Intergenic
1045936128 8:107681568-107681590 GGGAAGGGAAGGAGGGGGCAAGG - Intergenic
1046198699 8:110893909-110893931 CAGCTGGGAAGATGGGCGCAGGG + Intergenic
1047431904 8:124800045-124800067 AAGCAGGGAAGGAGGGTGCTGGG - Intergenic
1047700091 8:127440885-127440907 GGGTAGGGAAGGAGGGAGCATGG + Intergenic
1048964396 8:139604804-139604826 AAGCAGGGAAAGAGGAGGCATGG + Intronic
1049081325 8:140445524-140445546 GAGCAGGGGAGGAGGGAGCCCGG + Intronic
1049156939 8:141073075-141073097 AAGCAGGGCAGGAGGGTGAAGGG - Intergenic
1049216275 8:141409806-141409828 AAGCAGGGCAGGAGGGGGCCTGG - Intronic
1049236751 8:141515965-141515987 TCTCAGGGAAGGAGGGTGCAAGG - Intronic
1049406731 8:142454962-142454984 ATGCAGGGAAGGAGGGAGGAGGG - Intronic
1049582675 8:143420021-143420043 GAGCAGGGAAGGAGCAGGCATGG - Intronic
1049854249 8:144851627-144851649 TGGCAGAGAAGTAGGGGGCAGGG + Intronic
1050175092 9:2861680-2861702 GAGCATAGAAGGAGTGCGCAAGG - Intergenic
1050974975 9:11926471-11926493 GAGCAGGGAAGGTGGGAGGAGGG + Intergenic
1051328570 9:15999361-15999383 AAGCAGGGAGGGAGGGAGGAAGG + Intronic
1051408512 9:16764898-16764920 AAGGAGGGAAGGAGGGAGGAGGG + Intronic
1052283795 9:26761947-26761969 TAGGAAGGAGGGAGGGAGCAGGG + Intergenic
1052821107 9:33138457-33138479 GGGCAGGGAAGGTGGGAGCAAGG - Intronic
1052925894 9:34016116-34016138 CAGCAGGGAAGGAGGAGGAAGGG + Intronic
1056577800 9:87869279-87869301 GAGCTGGGAAGGAGGGCACCTGG - Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1057255961 9:93547306-93547328 TAACAGGGATGGAGGGCATAAGG + Intronic
1057810811 9:98255527-98255549 TGGCAGCGATGGAGGGCGCTGGG - Exonic
1058985700 9:110207253-110207275 GAGCAGGGGAGGCGGGCTCAGGG - Intronic
1059474739 9:114536250-114536272 AAGGAGGGAAGGAGGGGGGAAGG + Intergenic
1060312502 9:122475144-122475166 TGGCAGGGAAGGTTGGGGCAGGG + Intergenic
1060400472 9:123345979-123346001 AGGAAGGGAAGGAGGGAGCAAGG + Intergenic
1060720177 9:125971313-125971335 GAGCTGGGAGGGAGGGAGCAGGG + Intergenic
1060868131 9:127016090-127016112 TGGCAGGGAAGGAGGGAGCCTGG - Intronic
1060926727 9:127460533-127460555 CATCAGGGAAGGAGGGAGAAGGG - Intronic
1061203097 9:129148410-129148432 GAGCAGAGAAGCAGGGCCCAGGG - Exonic
1061205960 9:129163651-129163673 TAGCAGGGGTGGAGGGGGCTGGG - Intergenic
1061215896 9:129221936-129221958 TAGCAGGGAAGGGGCGAGGAGGG + Intergenic
1061328267 9:129877110-129877132 TGGCAGGGAGGGAGTGCGCCAGG - Intronic
1061367117 9:130177839-130177861 TGGGAGGGAAGGAGGGCTCAGGG + Intronic
1061405550 9:130391424-130391446 CCACAGGGAAGGAGGGCCCAGGG - Intronic
1061510033 9:131054825-131054847 AAGAAGGGAGGGAGGGAGCAAGG + Intronic
1061998687 9:134204789-134204811 TTGCAGGGAAGGAGGCTGCAGGG - Intergenic
1061998691 9:134204804-134204826 TCGCAGGGAAGGAGGTTGCAGGG - Intergenic
1062459116 9:136655500-136655522 TGGCAGGGCTGGAGGGAGCACGG + Intergenic
1062632936 9:137474469-137474491 GAGCAAGCAAGGAGGGCACAAGG + Intronic
1185701463 X:2233995-2234017 TAGCAGGGAAGGAGAGGAGAAGG + Intronic
1185769926 X:2758134-2758156 TTGCAGGGAAGGAGGGGGCAGGG - Intronic
1186240017 X:7555514-7555536 AAGGAGGGAAGGAGGGAGGATGG + Intergenic
1186868146 X:13741755-13741777 TAGCAGGGGAGGGGGTCCCAAGG + Intronic
1189909832 X:45799389-45799411 AAGCAGGGAAAGAGGGAGGAGGG + Intergenic
1190198062 X:48336682-48336704 AAGCAGGGGAGAAGGGCGAAGGG + Intergenic
1190322727 X:49188059-49188081 GTGGAGGGAGGGAGGGCGCAGGG + Exonic
1192608736 X:72546276-72546298 TAGCAGGGAAGCAGGACAGAGGG + Intronic
1194598603 X:95891213-95891235 TAAGAGGGAAGGAGAGAGCAAGG - Intergenic
1195676852 X:107513165-107513187 TAGCAGGTCAGGAGGGAGCAGGG - Intergenic
1195935744 X:110124248-110124270 AAGCAGGGAGGGAGGGAGAAAGG + Intronic
1196001845 X:110795324-110795346 TAGCAGGGTAGATGGGCGAAAGG - Intronic
1197033806 X:121850919-121850941 TTGCAGGGAAGGAAGGAGGAAGG - Intergenic
1198169228 X:134089449-134089471 GAGGAAGGAAGGAGGGGGCAGGG + Intergenic
1198717979 X:139582590-139582612 TGGCAGGGAAGAAGGGTGTATGG + Intronic
1199944107 X:152652076-152652098 TGGAAGGGAAGATGGGCGCAGGG + Intronic
1200007162 X:153094742-153094764 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1200008106 X:153101224-153101246 TAGCAGGGGAGGGGGTCACAAGG + Intergenic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1201300595 Y:12501498-12501520 TTGCAGGGAAGGAGGGGGCAGGG + Intergenic
1201515205 Y:14812962-14812984 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1201517636 Y:14835316-14835338 AAGAAGGGAAGGAGGGAGGAAGG + Intronic