ID: 1113798145

View in Genome Browser
Species Human (GRCh38)
Location 13:113070775-113070797
Sequence GGCTCACTCATTGTGTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113798140_1113798145 -8 Left 1113798140 13:113070760-113070782 CCCCCAGGTGCCGGTGGCTCACT 0: 1
1: 0
2: 1
3: 8
4: 162
Right 1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 124
1113798142_1113798145 -10 Left 1113798142 13:113070762-113070784 CCCAGGTGCCGGTGGCTCACTCA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 124
1113798141_1113798145 -9 Left 1113798141 13:113070761-113070783 CCCCAGGTGCCGGTGGCTCACTC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113798145 Original CRISPR GGCTCACTCATTGTGTTCCC CGG Intronic
900156183 1:1204201-1204223 GGGTTTCTCACTGTGTTCCCTGG - Intronic
902113469 1:14102308-14102330 GGATCACCCATTTTTTTCCCAGG - Intergenic
903269868 1:22181122-22181144 GTCTCACTCACTCTGTTGCCCGG + Intergenic
904206051 1:28855932-28855954 GACTCACTCATTGTCCTCCAGGG - Intronic
907512379 1:54971304-54971326 AGCTCACTCACTTTCTTCCCTGG - Intergenic
908044830 1:60157375-60157397 GGCTCACTCAGTGTGGTGCTGGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915308258 1:154993455-154993477 GGCTGACTCAGCCTGTTCCCAGG + Intergenic
917790376 1:178495591-178495613 GCCTCATTCATTATATTCCCAGG + Intergenic
921146571 1:212363673-212363695 GTCTCACTCACTCTGTTGCCAGG - Intergenic
924186177 1:241493822-241493844 GTCTCACTCATTCTGTTGCCTGG + Intergenic
1063634354 10:7767588-7767610 GGCTCACACCTTGTAATCCCAGG + Intronic
1067797232 10:49329427-49329449 GACTCTCTGCTTGTGTTCCCTGG - Intergenic
1070524576 10:77284296-77284318 TGCTCTGTCATTTTGTTCCCTGG + Intronic
1071146516 10:82580434-82580456 TGCTCACTCTTTGTGTTCTTTGG + Intronic
1074664943 10:115711410-115711432 CTCTTACTCATTGTGTTCCAAGG - Intronic
1080064337 11:27992780-27992802 GGCTCACTCACTATGTTGTCCGG - Intergenic
1080787182 11:35486149-35486171 TGCGGAATCATTGTGTTCCCTGG + Intronic
1081427331 11:42939847-42939869 GGAACACTCACTGTATTCCCGGG + Intergenic
1084700542 11:70783938-70783960 GGCTCACACAGTGGGTGCCCAGG - Intronic
1085220444 11:74869896-74869918 ACCTCACTCTTTGTGTGCCCAGG + Intronic
1090421041 11:126575127-126575149 GGCTCCCTCACTGTGTCCTCTGG - Intronic
1090737275 11:129621054-129621076 GGCTCCCTGAGTGTGGTCCCAGG + Intergenic
1090852869 11:130585706-130585728 GGTTCAGTCATTGAGTTCTCTGG - Intergenic
1097952168 12:65443610-65443632 AGCTCACTGATTCAGTTCCCGGG + Intronic
1098028482 12:66230637-66230659 GGCTCCCTCCTTGGGTTCCAGGG - Intronic
1100841354 12:98615256-98615278 GTCTCACTCACTCTGTACCCAGG + Intronic
1101888674 12:108691866-108691888 GACTCACTGAATGTGTGCCCTGG - Intronic
1102194824 12:111017676-111017698 AGCCCACTCATTGTGTCCACTGG + Intergenic
1103184270 12:118942872-118942894 GGTTAATCCATTGTGTTCCCTGG - Intergenic
1103661316 12:122520787-122520809 GGCTCATTCTTTGTCTTCTCAGG + Intronic
1108712275 13:53045184-53045206 GGCTCACTTGTTTTCTTCCCTGG - Intronic
1111189844 13:84792573-84792595 GGCTAACTCCATATGTTCCCAGG - Intergenic
1111869080 13:93807605-93807627 GGCTCTCAAAGTGTGTTCCCTGG - Intronic
1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG + Intronic
1116794580 14:49376019-49376041 GTCTCACTCACTCTGTTGCCTGG - Intergenic
1118230255 14:63941252-63941274 GGCTCATTCATTGTGTATCTAGG - Intronic
1119794992 14:77388189-77388211 GGTTCACAGATTGTATTCCCAGG - Intronic
1122289925 14:100675070-100675092 GTCACACTCATTTTGCTCCCTGG - Intergenic
1123000689 14:105292659-105292681 GGCACACGCTCTGTGTTCCCGGG - Intronic
1124018044 15:25894774-25894796 TGCTCGCTCACTGTGCTCCCGGG + Intergenic
1127790589 15:62395158-62395180 TGCCCACACATTGTGTTCCGAGG + Intronic
1128659246 15:69485813-69485835 GGCTCAGTCATTGCTCTCCCTGG - Intergenic
1129173220 15:73820762-73820784 GGCCCACGCATTGGGTTCACTGG + Intergenic
1129994912 15:79996216-79996238 GGCCCACACTTTGGGTTCCCAGG - Intergenic
1133655294 16:7856425-7856447 GGTTCACTCAATGTGTTGCTAGG + Intergenic
1135568777 16:23532241-23532263 TGCTCACTCACTGTGTTGGCTGG + Intronic
1136122441 16:28147623-28147645 GGCTTATTCATTGTTTTTCCTGG - Intronic
1137454998 16:48611159-48611181 GGCTCACTCATGATCTTCCCTGG + Intronic
1138061590 16:53896977-53896999 GGCCAACTTAATGTGTTCCCGGG - Intronic
1138431019 16:56969323-56969345 GGCTCACTCCTTGGGCTCCCTGG + Intronic
1139260846 16:65592119-65592141 GGGACAATCATTGTGTCCCCTGG - Intergenic
1139737181 16:69001211-69001233 GGCTCACCCTCTATGTTCCCAGG + Intronic
1140027544 16:71304283-71304305 GGCTCACTCACTGTGATTCCCGG + Intergenic
1141216375 16:82028116-82028138 GTCTCCCTCATTGTGTTCTTAGG - Intergenic
1146545657 17:33735733-33735755 GGATCACTCACTGTGCTCCAGGG + Intronic
1152213105 17:79014022-79014044 GGCTAACTCCATATGTTCCCAGG - Intergenic
1152764653 17:82129464-82129486 GGCACACTCATGGTGTGCCTGGG - Intronic
1155224595 18:23718384-23718406 GCCTGACTCATTGTGTTCCAGGG + Intronic
1157473403 18:48006971-48006993 GGCCGACTCCGTGTGTTCCCTGG + Intergenic
1161260221 19:3333618-3333640 GTCTCACTCGTTATGTTGCCCGG + Intergenic
1161426915 19:4208722-4208744 GGGTCAGGCATTCTGTTCCCAGG - Intronic
1162026046 19:7894765-7894787 GGCCCACTCTGTCTGTTCCCAGG - Intronic
1163208527 19:15822411-15822433 GTCTCACTCACTCTGTTGCCAGG + Intergenic
1163775054 19:19212747-19212769 GGGACACCCAGTGTGTTCCCTGG - Intronic
928528758 2:32169242-32169264 GGCTCACTGCTTGACTTCCCGGG + Intronic
930263740 2:49176285-49176307 GCCTCATCCATTGTGTTTCCTGG + Intergenic
931346136 2:61448423-61448445 GCCTCACTCACTCTGTTTCCTGG - Intronic
932718523 2:74120864-74120886 TGATCACTCATTTTGTTCACAGG - Intergenic
933899887 2:86841874-86841896 GGCTCCCTCTTGGTCTTCCCAGG - Intronic
934104571 2:88683771-88683793 GGCTAACTCTGTATGTTCCCAGG - Intergenic
934609562 2:95724642-95724664 GGATCACTCACTGAGCTCCCAGG + Intergenic
935780672 2:106507351-106507373 GGCTCCCTCTTGGTCTTCCCAGG + Intergenic
936542880 2:113366220-113366242 GGATCACTCACTGAGCTCCCAGG + Intergenic
938472806 2:131581324-131581346 GGCACCTTCATTGTGTCCCCTGG + Intergenic
942487871 2:176458168-176458190 GACTCACTCATATTGTTCCTTGG - Intergenic
948162340 2:235835124-235835146 GGTGCCCTCAGTGTGTTCCCCGG + Intronic
948502068 2:238402706-238402728 GTCTCACTCACTATGTTGCCAGG - Intergenic
1168854927 20:1001895-1001917 GGCTCGCTCACTGGGTGCCCTGG + Intronic
1168860419 20:1042458-1042480 TGCTCACTCACTGTGTGACCAGG + Intergenic
1173706396 20:45113497-45113519 GGGGGAGTCATTGTGTTCCCAGG - Intronic
1175104556 20:56605313-56605335 GTCTCACTCACTCTGTTGCCCGG - Intergenic
1175540840 20:59746685-59746707 GGCTGACTCTGTCTGTTCCCCGG + Intronic
1177731109 21:25027310-25027332 GGATCAATTATTGTGTTTCCTGG - Intergenic
1178505365 21:33158306-33158328 GTCTCACTCTTTCTATTCCCAGG - Intergenic
1181119385 22:20655422-20655444 GGCTCACTCCACCTGTTCCCAGG + Intergenic
1182037929 22:27213962-27213984 CGCTGACTCATTGTGTGCCTCGG - Intergenic
1183128780 22:35812235-35812257 GTCTCACTCACTCTGTTGCCCGG - Intronic
1184843402 22:47065898-47065920 CACTCACTCAGTGTATTCCCAGG - Intronic
1185099913 22:48833958-48833980 AGCACACACAGTGTGTTCCCTGG + Intronic
950496214 3:13336007-13336029 GTCTCACTGTTTGTGTTCCATGG + Intronic
953006309 3:38982437-38982459 GGCTCACCCACTGTTTACCCAGG - Intergenic
954871686 3:53772193-53772215 AGCTCACTCCTTTTCTTCCCTGG + Intronic
955362609 3:58288542-58288564 TGCTCACTCACTGTGTACTCTGG - Intronic
955625318 3:60912339-60912361 GGCTTACTCATTGAGTAACCTGG + Intronic
958441561 3:94162103-94162125 GGCTCACTCTTTGTGTGGCTTGG - Intergenic
961664197 3:128486170-128486192 GGCCCACTCTCTGTGTACCCAGG - Exonic
964658548 3:159094967-159094989 TGCTCTCTCAGTGTCTTCCCTGG + Intronic
966470412 3:180282674-180282696 GTGTCACAAATTGTGTTCCCTGG - Intergenic
973119321 4:46499913-46499935 TGCTCACTCACTATGTTTCCTGG - Intergenic
976049950 4:80999545-80999567 GTCTCACTCTTTGTCTCCCCTGG + Intergenic
976286772 4:83378263-83378285 GTCTCACTCACTCTGTTTCCTGG + Intergenic
982861573 4:160457720-160457742 GGCTCACTGATTTTTTTCCTGGG + Intergenic
983645393 4:169985245-169985267 GGTTCACTCATTTTCTTCCCTGG + Intergenic
985733453 5:1564233-1564255 GGCTGACTCAGTGTGGCCCCTGG - Intergenic
985733462 5:1564271-1564293 GGCTGACTCAGTGTGGCCCCTGG - Intergenic
994915592 5:105973453-105973475 GGCTCTCTCATATTGTTTCCTGG + Intergenic
996500726 5:124213368-124213390 CCCTGACTCCTTGTGTTCCCGGG - Intergenic
999640748 5:153670742-153670764 AATTCACTCATTCTGTTCCCCGG - Intronic
1001707356 5:173751126-173751148 CGGTCACTCATTTGGTTCCCCGG - Intergenic
1007966712 6:46010048-46010070 GACTCACTGCTTGTGTTCTCAGG + Intronic
1007981537 6:46164378-46164400 GGCTCTCAAAGTGTGTTCCCTGG - Intronic
1011146255 6:84220429-84220451 GGGTCTCTCACTGTGTTGCCAGG - Intronic
1011309999 6:85971360-85971382 GGCACACTCCTCCTGTTCCCAGG + Intergenic
1013234379 6:108184166-108184188 GTCTCACTCACTCTGTTACCTGG - Intronic
1015817354 6:137224425-137224447 TGCTCCCTCACTGTGCTCCCTGG + Intergenic
1017770925 6:157644135-157644157 GGCTCCCGCATTGTGTTCCCTGG + Intronic
1024636353 7:51293822-51293844 GGATCATGCATAGTGTTCCCAGG + Intronic
1032320404 7:130881142-130881164 GGCTCATTCATTCTCTTTCCAGG + Intergenic
1032736533 7:134697498-134697520 ACCTCACTCACTGTGTGCCCTGG - Intergenic
1035947091 8:3977187-3977209 TGTTCACTGATTGTGATCCCAGG - Intronic
1039135782 8:34321336-34321358 AACTCACTCATTGTGATCCCAGG - Intergenic
1041308043 8:56484094-56484116 GGGTTACTCATTGTGTTTCTTGG + Intergenic
1046346924 8:112941983-112942005 GGTTCACTCTTTGTGTTCTATGG + Intronic
1050375222 9:4964736-4964758 GTCTGACTCACAGTGTTCCCAGG - Intergenic
1059427445 9:114230122-114230144 GACTCACTCATTGTGTGAACTGG - Intronic
1186341491 X:8650691-8650713 GTCTCACTCACTCTGTTGCCTGG - Intronic
1188394622 X:29665688-29665710 GGCTCAGCCATTGTGGTCTCTGG + Intronic
1188680996 X:33004315-33004337 GGCTCACCCACTATGTTCCTTGG + Intronic
1190311002 X:49117019-49117041 GGCTCACTCACTGAGATCCAAGG + Exonic
1193773024 X:85610076-85610098 GGATCAATCATTGTGTTCCTTGG - Intergenic
1199617460 X:149669007-149669029 GGTTCACTCTTTGTGTTGCAAGG - Intergenic
1199625183 X:149734242-149734264 GGTTCACTCTTTGTGTTGCAAGG + Intergenic
1200102966 X:153697290-153697312 GCCCCTCTCATTGTGTTCCGGGG - Intergenic