ID: 1113801658

View in Genome Browser
Species Human (GRCh38)
Location 13:113089763-113089785
Sequence GCCTCACACGGAGCTGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113801642_1113801658 30 Left 1113801642 13:113089710-113089732 CCCCCCGAAAAGGGCAAAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141
1113801648_1113801658 26 Left 1113801648 13:113089714-113089736 CCGAAAAGGGCAAAGGTGGGTAT 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141
1113801655_1113801658 -6 Left 1113801655 13:113089746-113089768 CCGGGCCTCACACGGAGGCCTCA 0: 1
1: 0
2: 1
3: 25
4: 183
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141
1113801646_1113801658 28 Left 1113801646 13:113089712-113089734 CCCCGAAAAGGGCAAAGGTGGGT 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141
1113801647_1113801658 27 Left 1113801647 13:113089713-113089735 CCCGAAAAGGGCAAAGGTGGGTA 0: 1
1: 0
2: 2
3: 19
4: 173
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141
1113801644_1113801658 29 Left 1113801644 13:113089711-113089733 CCCCCGAAAAGGGCAAAGGTGGG 0: 1
1: 1
2: 1
3: 10
4: 98
Right 1113801658 13:113089763-113089785 GCCTCACACGGAGCTGCTCACGG 0: 1
1: 0
2: 3
3: 3
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113801658 Original CRISPR GCCTCACACGGAGCTGCTCA CGG Intronic