ID: 1113806152

View in Genome Browser
Species Human (GRCh38)
Location 13:113110802-113110824
Sequence GTGCTCCTTCGAGGAGGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113806146_1113806152 5 Left 1113806146 13:113110774-113110796 CCCTGGAGAGGGAGTGCAAGGAG 0: 1
1: 1
2: 2
3: 33
4: 335
Right 1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 139
1113806147_1113806152 4 Left 1113806147 13:113110775-113110797 CCTGGAGAGGGAGTGCAAGGAGG 0: 1
1: 0
2: 4
3: 47
4: 403
Right 1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 139
1113806144_1113806152 12 Left 1113806144 13:113110767-113110789 CCGGGCTCCCTGGAGAGGGAGTG 0: 1
1: 3
2: 4
3: 38
4: 338
Right 1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 139
1113806140_1113806152 28 Left 1113806140 13:113110751-113110773 CCTGGAGGAGCTGCGGCCGGGCT 0: 1
1: 0
2: 1
3: 31
4: 327
Right 1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113806152 Original CRISPR GTGCTCCTTCGAGGAGGCCC GGG Exonic
901809861 1:11761599-11761621 ATGCTCATTGGAGGAGGTCCAGG + Intergenic
903259575 1:22124087-22124109 CTGCTCGCTCGAGGAGGACCTGG + Intronic
903969516 1:27109681-27109703 GAGCTTCTTCGTGGTGGCCCTGG - Exonic
904772074 1:32886270-32886292 GTGCTCCCTCGAGGGGGACCGGG + Intronic
905907793 1:41631153-41631175 GTGCTCTTTGGAGGATGCTCTGG + Intronic
909110223 1:71466351-71466373 GTCCTCCTTGCTGGAGGCCCTGG + Intronic
909662155 1:78096153-78096175 GTGCTCCCTCCAGGAGGTACTGG - Intronic
914334927 1:146705525-146705547 GGGTTCCTTGGAGGAAGCCCAGG - Intergenic
917674899 1:177309718-177309740 GTGCTCCTTCTGGGAGGGCTAGG - Intergenic
920316162 1:205076974-205076996 TTCCTCATTCCAGGAGGCCCTGG + Exonic
920877113 1:209846744-209846766 CTGCCCCTTGGAAGAGGCCCTGG + Intronic
923821979 1:237454955-237454977 GTGCTCCTTGGAAATGGCCCAGG + Intronic
924385325 1:243494016-243494038 GTGGTCCTTCCAGGAGCCCTGGG + Intronic
924942973 1:248825244-248825266 GTGCTCCTCCTAGCAGGCCTCGG - Exonic
1062828541 10:589122-589144 GTGCTCCATCGAGAAGGACGGGG - Intronic
1063860795 10:10305795-10305817 GTGCTCCCTCTGGAAGGCCCAGG + Intergenic
1065603501 10:27393138-27393160 CTACCCCTTCCAGGAGGCCCAGG + Intergenic
1067279732 10:44862185-44862207 GGGCTTCTTAGAGGAAGCCCTGG - Intergenic
1067766060 10:49088330-49088352 GAGCTCCTTCCTGGAGGTCCAGG - Intronic
1067787983 10:49264833-49264855 GTGCTCCTTTTTGGAGGCTCTGG + Intergenic
1068072248 10:52209782-52209804 CTGTTCCTTCTAGGAGTCCCTGG + Intronic
1068711626 10:60141307-60141329 GTGCTCCTTCGAGAGGTCCCTGG + Intronic
1069158179 10:65054378-65054400 GGGCTCCTGGGAGGAGGACCTGG - Intergenic
1074188480 10:111116340-111116362 GGGCTCCTTGCAGGGGGCCCGGG - Intergenic
1076804236 10:132847211-132847233 GTGCTCCTCCGGGGCTGCCCTGG + Exonic
1077377231 11:2210774-2210796 GGGCTCCTTCGTGCAGGTCCAGG + Intergenic
1077391779 11:2303663-2303685 GTCCTCCTCCAGGGAGGCCCTGG - Intronic
1077440540 11:2566824-2566846 GTGCCCCTCAGAGAAGGCCCTGG + Intronic
1082989349 11:59194022-59194044 GTGCTGCCTGGAGGAGGGCCTGG - Intronic
1088716996 11:112557293-112557315 GTGTTCCTCCGAGCAGGTCCAGG - Intergenic
1090562544 11:127948035-127948057 GGGCTCCTTCCAGGATTCCCAGG - Intergenic
1093466775 12:19457474-19457496 GGGCTCCTTCAAGTAGGCCTGGG - Intronic
1099349309 12:81545383-81545405 CTACTGCTTAGAGGAGGCCCAGG - Intronic
1102998847 12:117369914-117369936 GTCCTCCTTCGGGGAGCCCCTGG + Intronic
1103917272 12:124382365-124382387 GTGCTCCTTCAAGGTCGGCCAGG + Intronic
1104637490 12:130447330-130447352 GTGCTCCTGCGTGTGGGCCCTGG + Intronic
1110735931 13:78936643-78936665 ATGCTCCTACTGGGAGGCCCTGG - Intergenic
1113334194 13:109362689-109362711 GTCCACCTTCCGGGAGGCCCAGG + Intergenic
1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG + Exonic
1113837521 13:113338135-113338157 CTCCTCCTCTGAGGAGGCCCGGG + Intronic
1114452032 14:22833503-22833525 GTTCTCCTTCCAGGTAGCCCTGG - Intronic
1115910940 14:38255778-38255800 GCGCTCCTGCGGGCAGGCCCAGG - Exonic
1119265754 14:73262550-73262572 GTGCTCCTTCCAGAAGCCCCAGG - Exonic
1119540503 14:75435126-75435148 GTTCTCCTTAGAGGAGGCCAGGG + Intronic
1121342523 14:93114289-93114311 GTGCTCCTTGGCGGAGTCTCCGG - Intronic
1121448870 14:93995475-93995497 GTGCTCCTCCATGGAGGCTCAGG - Intergenic
1121644621 14:95509320-95509342 ATGGTCCTTGGAGGTGGCCCAGG + Intergenic
1129149332 15:73677845-73677867 CTGCTCCTTGGAGGAGGCTTAGG + Intergenic
1129228778 15:74184901-74184923 GTGGGCCTGCGGGGAGGCCCTGG - Intronic
1129241997 15:74257425-74257447 CTCCTCCTTTGAGGAGTCCCTGG + Intronic
1129458352 15:75687637-75687659 GTGGTCCCTCAAGGAGGCCAGGG - Exonic
1129725432 15:77899228-77899250 GTGGTCCCTCAAGGAGGCCAGGG + Intergenic
1133120868 16:3606522-3606544 GTGCTCCCTCGAGGCTGCGCGGG - Exonic
1133201536 16:4207109-4207131 GGGCGCCTCCGAGGAGGCCACGG - Intronic
1133283689 16:4680883-4680905 GTGCTCCTTTCGGGAGACCCCGG - Intronic
1135040980 16:19116042-19116064 GTTCACCTTCAAGGAAGCCCTGG - Exonic
1135121188 16:19767768-19767790 GTGCTCCGTAGAGGAGGGCGTGG - Intronic
1139290948 16:65857395-65857417 GTGCTCCTGGCAGGAGGCACAGG - Intergenic
1139998696 16:71005711-71005733 GGGTTCCTTGGAGGAAGCCCAGG + Intronic
1141550594 16:84804316-84804338 GTGTTCCTTCCATGAGGCACTGG - Intergenic
1141765083 16:86052909-86052931 GTGCTCCTCAGGGGAGCCCCCGG - Intergenic
1142076350 16:88120284-88120306 GGGGTCCTTGCAGGAGGCCCAGG + Intergenic
1142246322 16:88971759-88971781 GTGCTCCTCCGAGGAGACGTCGG - Intronic
1142594393 17:1022484-1022506 CTCCTCCCTCGAGGAGGCGCCGG + Intronic
1142888071 17:2925690-2925712 GAGCTCCTTCAAGGATGGCCTGG - Intronic
1143667126 17:8369520-8369542 TTGCTCCTTCCAGGGAGCCCTGG + Exonic
1145265809 17:21379066-21379088 GTCCTGCTTCAAGGAGACCCAGG - Intronic
1146123901 17:30217370-30217392 CTGCTCCTTTGAGGGTGCCCGGG + Intronic
1146371353 17:32266865-32266887 TTGCTCCTAGAAGGAGGCCCGGG + Intronic
1149864143 17:60141124-60141146 GTGCTCCTGCGCGGTGTCCCAGG + Intergenic
1151274138 17:73021208-73021230 GTGCTCCATAGAGCAGGTCCTGG - Intronic
1151596119 17:75078860-75078882 GGGCTCCTCTGAGGAAGCCCTGG + Intergenic
1153271527 18:3327198-3327220 GTTCTCATTCCAAGAGGCCCAGG - Intergenic
1153769794 18:8406120-8406142 GTTCTGCTACGAGGTGGCCCTGG + Exonic
1153975393 18:10264222-10264244 GCTCTCCTTGGAGGAGCCCCTGG - Intergenic
1156505274 18:37586699-37586721 CTGCTCATTCTTGGAGGCCCAGG + Intergenic
1160100684 18:75916847-75916869 CTGCACCTGCGCGGAGGCCCAGG + Intergenic
1160375130 18:78405888-78405910 GGGCTCCTACCTGGAGGCCCCGG + Intergenic
1160720731 19:595924-595946 GGGCTCCTGCGGGGAGGGCCTGG + Intronic
1160968710 19:1757970-1757992 GTTCTCCTTGGAGGAGGCCTGGG - Intronic
1161001305 19:1912503-1912525 GGGCCAGTTCGAGGAGGCCCGGG + Exonic
1161963109 19:7533755-7533777 ATGCTCCTCCGAGGGGTCCCTGG - Exonic
1163823063 19:19507388-19507410 GTGCTCCTTCTGGGAGGAGCTGG - Exonic
1164727757 19:30478053-30478075 GAGCTCCTTCAAGGACGCCGAGG - Intronic
1168115623 19:54220196-54220218 GTGCTCCTTCCAGGACACTCTGG - Exonic
1168118610 19:54239942-54239964 GTGCTCCTTCCAGGACACTCTGG - Exonic
925171851 2:1754894-1754916 GTGCTCTTTCTAGGTGGCTCTGG - Intergenic
925371429 2:3348502-3348524 GTTCTCCTTTGAGGAGGAGCTGG - Intronic
932422912 2:71611997-71612019 GAGCTCCTTTGAGGGGGCCCAGG - Intronic
932599216 2:73112540-73112562 GTGCTCCTTCGAGCTGCCGCCGG - Exonic
932738460 2:74272885-74272907 GTTCTCCTTCAAGGAGGATCTGG + Intronic
934501248 2:94861806-94861828 GAGCTCCTCCGAGGAGGACACGG + Intergenic
934756220 2:96826714-96826736 CTGCTCCATCGAGGACCCCCTGG + Intronic
934803346 2:97191256-97191278 GTGCAGCTTCGACGAGCCCCAGG - Intronic
935386870 2:102509172-102509194 GCGCTCCTTTCTGGAGGCCCTGG + Intronic
944437102 2:199702124-199702146 CTCCACCTTCGAGCAGGCCCCGG - Intergenic
946322663 2:218962663-218962685 GGGCTGCTTCGACGATGCCCAGG + Intergenic
947610732 2:231523678-231523700 GTCCTCCTGAGAGGAAGCCCTGG - Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948787926 2:240362732-240362754 GTGCTCCTTCCTGGACTCCCTGG - Intergenic
1172752605 20:37261454-37261476 GTGCTCCTTCGAGGATGCGTGGG - Intronic
1173165379 20:40683733-40683755 CAGCTCCTTGGAGGAGGCCCGGG - Intergenic
1173176746 20:40770776-40770798 CTGCTCCATGGAGGAAGCCCAGG + Intergenic
1175178572 20:57128791-57128813 GAGCTCCTTCCTGGAGGCTCTGG + Intergenic
1175936359 20:62515960-62515982 GTGCTCCCTCAAGGCAGCCCTGG + Intergenic
1179303340 21:40132658-40132680 TTGCTCCTCCGAGCAGCCCCAGG - Intronic
1179568072 21:42261480-42261502 GTGCCCCTTCGACCAGGCCAGGG - Intronic
1182149741 22:28019679-28019701 GTGCTGCCTTGAGGAGCCCCCGG - Intronic
1183253032 22:36743838-36743860 GTGGTCATTCTAGGGGGCCCTGG + Intergenic
951362641 3:21742670-21742692 CTGCTCCTGCCAGGAGGCCCTGG + Intronic
954432500 3:50478332-50478354 GTGCTCCTGCGATGGAGCCCTGG + Intronic
956479803 3:69662181-69662203 GTGCTCATTGGCAGAGGCCCGGG + Intergenic
960938654 3:122919371-122919393 GTGCTCCCACGAGGAGGAGCTGG - Intronic
961245306 3:125446449-125446471 CTGCCCCTTCAAGGAGGCCCTGG + Intergenic
966734618 3:183179226-183179248 GGGCTCCTCGGAGGAGGCCCTGG + Exonic
968548946 4:1212730-1212752 AGGCTCCTTCCAAGAGGCCCTGG + Intronic
969652819 4:8477912-8477934 GTGCCCCTTCCAGGAGGCGGCGG - Intronic
969701428 4:8769850-8769872 GTGCTCCTTGAATGAGGACCTGG + Intergenic
973997526 4:56474285-56474307 GTGTGCCTTCTTGGAGGCCCAGG - Exonic
975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG + Intronic
978155435 4:105484844-105484866 GTGCTCCTTCAAGTATGCCTGGG + Intergenic
980392961 4:132169840-132169862 GAGCTCCTTAGAGGAGGGGCAGG - Intergenic
981237520 4:142435947-142435969 GAGCTCCTTGGAGGAGGGGCAGG + Intronic
985718996 5:1479463-1479485 GGGCTCCTTCGAGGAGCCTCTGG - Intronic
988468360 5:31512926-31512948 GTGCTCCTTTATGGAGGCTCTGG - Intronic
990581881 5:57173763-57173785 GCGGGGCTTCGAGGAGGCCCCGG - Intergenic
995644844 5:114299781-114299803 GTGCTCCTTTGAGGAGGCCATGG + Intergenic
1003221253 6:4162957-4162979 GTGCTCTTTCCGGGATGCCCGGG - Intergenic
1003889128 6:10548335-10548357 GTGCCCTTTCTGGGAGGCCCAGG - Intronic
1014941670 6:127447501-127447523 GTGCTTCTTGGAGGAGGAACTGG + Exonic
1015487487 6:133789184-133789206 GTGCTTATTAGAGAAGGCCCTGG - Intergenic
1016917578 6:149259036-149259058 GTGTTCCTTTCTGGAGGCCCTGG - Intronic
1020733745 7:11918457-11918479 GAGATCCTCCGAGGAGGCCAAGG - Intergenic
1021717559 7:23473704-23473726 AAGCACCTCCGAGGAGGCCCAGG - Intergenic
1022101018 7:27169256-27169278 CTGCTCCTTCGCGGACGCCGGGG - Intronic
1022410451 7:30135434-30135456 GTGCTCCGCCGGGGAAGCCCCGG + Intronic
1022819748 7:33947822-33947844 GTGCTGCTTCGAGAATGACCTGG + Intronic
1024291516 7:47807706-47807728 GGGCTCCTACCAGGAGGACCAGG - Intronic
1032541308 7:132705416-132705438 GTGATCCTTGGAGTAGGACCTGG + Intronic
1034981979 7:155484875-155484897 TGGCTCCGTCGCGGAGGCCCGGG + Intronic
1035019733 7:155793880-155793902 CTGCTCCTTGGTGGAGGCCAAGG + Intergenic
1038508191 8:28104678-28104700 GTGCTGCTTCTATGAGGCACGGG - Intronic
1042229431 8:66541604-66541626 GTGCTCTCTCCAGAAGGCCCTGG - Intergenic
1047748925 8:127865638-127865660 GTGTTCCTTCCTGGAGGCTCTGG - Intergenic
1049525934 8:143127018-143127040 GGGCTCCTGGGTGGAGGCCCAGG + Intergenic
1049642643 8:143722378-143722400 CTGCTCCCCCGAGGAGACCCGGG - Exonic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1051374387 9:16388913-16388935 GTGCTCCCTGGAGGAGGGCAGGG - Intergenic
1060656337 9:125374983-125375005 GGGCGCCTTCGAGGATGCCCAGG + Intergenic
1060912747 9:127363675-127363697 GTGCTCCTGTGAGGAGGTCAGGG + Intronic
1062076869 9:134594426-134594448 GTGCTCCTTGCAGGAGTCCAGGG + Intergenic
1062624643 9:137437232-137437254 GGGCTGCTTGGAGGAGGCGCTGG - Exonic
1189309179 X:40008193-40008215 GGGTTCCTCCTAGGAGGCCCAGG + Intergenic
1190726473 X:53193548-53193570 GAGCTCCTCCAAGGGGGCCCGGG + Exonic
1192264835 X:69531030-69531052 GTTCTCCTTCATGGAGGCCTGGG - Exonic
1200124888 X:153808520-153808542 GCGCTCCTCCAAGGAGCCCCTGG - Exonic
1200235226 X:154464832-154464854 GTGCTCCTTCCAGGAGGGCAGGG + Exonic