ID: 1113807360

View in Genome Browser
Species Human (GRCh38)
Location 13:113117655-113117677
Sequence CACCCACCCAGCACCGCGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 4, 1: 1, 2: 0, 3: 8, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113807360_1113807365 7 Left 1113807360 13:113117655-113117677 CCGACCGCGGTGCTGGGTGGGTG 0: 4
1: 1
2: 0
3: 8
4: 111
Right 1113807365 13:113117685-113117707 CCCCTGTCCGACCGCGGTGCTGG 0: 3
1: 2
2: 1
3: 0
4: 42
1113807360_1113807367 8 Left 1113807360 13:113117655-113117677 CCGACCGCGGTGCTGGGTGGGTG 0: 4
1: 1
2: 0
3: 8
4: 111
Right 1113807367 13:113117686-113117708 CCCTGTCCGACCGCGGTGCTGGG 0: 4
1: 1
2: 0
3: 1
4: 40
1113807360_1113807363 1 Left 1113807360 13:113117655-113117677 CCGACCGCGGTGCTGGGTGGGTG 0: 4
1: 1
2: 0
3: 8
4: 111
Right 1113807363 13:113117679-113117701 CACTCTCCCCTGTCCGACCGCGG 0: 3
1: 2
2: 0
3: 5
4: 62
1113807360_1113807369 11 Left 1113807360 13:113117655-113117677 CCGACCGCGGTGCTGGGTGGGTG 0: 4
1: 1
2: 0
3: 8
4: 111
Right 1113807369 13:113117689-113117711 TGTCCGACCGCGGTGCTGGGTGG 0: 5
1: 0
2: 0
3: 1
4: 51
1113807360_1113807370 12 Left 1113807360 13:113117655-113117677 CCGACCGCGGTGCTGGGTGGGTG 0: 4
1: 1
2: 0
3: 8
4: 111
Right 1113807370 13:113117690-113117712 GTCCGACCGCGGTGCTGGGTGGG 0: 5
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113807360 Original CRISPR CACCCACCCAGCACCGCGGT CGG (reversed) Intronic
900630548 1:3632851-3632873 CACACACCGAGCCCCGGGGTGGG + Intronic
901917509 1:12511284-12511306 CTCCCACCCAGCCCCGCCCTAGG - Exonic
905967869 1:42114429-42114451 CACCCACCCTGCTCCAGGGTGGG - Intergenic
906091884 1:43186466-43186488 CAGCCGCCCACCACCGCGCTTGG - Intronic
908650276 1:66325426-66325448 CACCCACCCAGCAGCAGGCTTGG + Intronic
915517133 1:156420176-156420198 CACCCCCCCAGCACCCCAGTCGG - Intronic
915553578 1:156648748-156648770 CACCCAGCCAGCGCTGTGGTGGG + Exonic
921327261 1:213998159-213998181 CACCCGCCCAGCACCGCCGAAGG + Exonic
922750000 1:228065808-228065830 CACCCACCAAGCCCCGCCCTGGG - Intergenic
922800934 1:228364477-228364499 CACCCAGCCAGCCCCGTGATAGG - Intronic
1063993641 10:11594991-11595013 CACCCACACAGCACTCCAGTTGG - Intronic
1064893437 10:20206881-20206903 CACACACACAGCACCTCAGTGGG + Intronic
1064991987 10:21264290-21264312 CACTGTCCCAGCACCGTGGTAGG - Intergenic
1067478739 10:46582223-46582245 CACCTTCCCAGCAACGCGGAGGG - Intronic
1067616000 10:47759578-47759600 CACCTTCCCAGCAACGCGGAGGG + Intergenic
1070152232 10:73811878-73811900 CATCCACTCAGCCCCGCGGAGGG + Intergenic
1070190551 10:74108165-74108187 CACCCACCAAGCACCCAGCTGGG - Intronic
1070764485 10:79048573-79048595 CACACCCCCAGCTCAGCGGTTGG - Intergenic
1070871797 10:79761112-79761134 CAGGCACCCACCACCGTGGTTGG - Intergenic
1071638718 10:87283279-87283301 CAGGCACCCACCACCGTGGTTGG - Intergenic
1071656522 10:87454673-87454695 CAGGCACCCACCACCGTGGTTGG + Intergenic
1075539341 10:123299381-123299403 CTCCAACCCAGCCCCGGGGTGGG + Intergenic
1076922845 10:133464636-133464658 CAGCCACCCAGCACAGCAGCAGG - Intergenic
1089413757 11:118269419-118269441 CACGTACCCAGCACTGTGGTAGG + Intergenic
1089563177 11:119356136-119356158 CGCCCACCTAGCACCACGGAGGG + Exonic
1090780495 11:130002558-130002580 CCCCCACCCGGGTCCGCGGTCGG + Intronic
1091799736 12:3317300-3317322 CAGCCACCCAGCCCCACGGTGGG - Intergenic
1094492405 12:30969315-30969337 CAGCCACCCAGCTCCAAGGTGGG + Intronic
1104904243 12:132204988-132205010 CACCTTCTCAGCACCGCGGAGGG - Intronic
1108209323 13:48122452-48122474 CACCCACCCAGCACTTTGGGAGG + Intergenic
1109784360 13:67154957-67154979 CACCCACCCACCACTCAGGTGGG - Intronic
1113807350 13:113117618-113117640 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807360 13:113117655-113117677 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807371 13:113117692-113117714 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807382 13:113117729-113117751 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807391 13:113117766-113117788 TACCCACCCAGCACCGCGGTCGG - Intronic
1115401747 14:32969315-32969337 CACCCACACCGCACCAGGGTTGG - Intronic
1120216263 14:81683525-81683547 CACCCACCCCACCCCGCGGGGGG - Intergenic
1129841896 15:78748733-78748755 CAAGCACCCAGCACCGCGCCTGG - Intergenic
1131119516 15:89813978-89814000 CCCCCCCCCAGCAGTGCGGTGGG - Intronic
1132257331 15:100387163-100387185 CACCCTCCCAGCACCTTGATGGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134024666 16:10944726-10944748 CGCCCACCCAGCTCCGCGAGCGG - Exonic
1134121134 16:11586139-11586161 CACCTACCCAGCACCGGCGGTGG + Intronic
1134693066 16:16203700-16203722 CACCCACCCATCTCCACTGTTGG - Intronic
1134976922 16:18577923-18577945 CACCCACCCAGCCTCGGAGTAGG + Intergenic
1134978781 16:18590995-18591017 CACCCACCCATCTCCACTGTTGG + Intergenic
1135296920 16:21287715-21287737 CACCCTCCCAGCACACCGATGGG - Intronic
1135508244 16:23058391-23058413 CAGCCACCCAGCACTGCTTTCGG + Intergenic
1136116976 16:28100854-28100876 CACCCGTGCAGCACCTCGGTGGG - Intronic
1137618062 16:49858387-49858409 CACCCACGCACCCCCGCGGCTGG + Intergenic
1139591340 16:67934945-67934967 CACACACCCATCACCGCAGCTGG - Exonic
1141657745 16:85425071-85425093 CACTCACCCAGGACTCCGGTCGG + Intergenic
1142252091 16:88996670-88996692 CACCCCTCCAGCACCGCAGAAGG - Intergenic
1142323913 16:89401947-89401969 CACCCCTCCAGCACCGCAGAAGG + Intronic
1142672065 17:1491875-1491897 CACGCCCCCAGCAGCGCGGCGGG - Intronic
1144687738 17:17237200-17237222 CCACCACCCAACACTGCGGTGGG + Intergenic
1146482352 17:33214808-33214830 CACCCACCTAGCACAGCAGCTGG - Intronic
1146797929 17:35795687-35795709 CACCCACCCCGCGCCGCTGCTGG + Intronic
1146965382 17:37024170-37024192 CTCCCACACAGCACCTCAGTCGG - Intronic
1147018746 17:37513681-37513703 CACCGGCCCAGCACCGGGGACGG - Intergenic
1151530089 17:74698544-74698566 CACCCACCCAGCAGCAGGGGAGG + Intronic
1152362418 17:79838929-79838951 CACCCCCCCAGCAGCTCGGCGGG + Intronic
1152855768 17:82663978-82664000 CACCCTCCCACCACCACCGTCGG - Intronic
1152855901 17:82664340-82664362 CACCCTCCCACCACCACCGTCGG - Intronic
1154969996 18:21398360-21398382 CACCCACCCAGCACAGTGCTTGG + Intronic
1160863827 19:1248784-1248806 CTCCCACCCCGCACCCCGGGGGG - Intronic
1164902504 19:31940037-31940059 CACCCACCCACCACCATGTTAGG + Intergenic
1167079629 19:47270442-47270464 CACCCACTCACCATAGCGGTGGG - Exonic
1167740720 19:51323584-51323606 CTCCCACCCACCCCCTCGGTGGG + Intronic
1168137925 19:54364228-54364250 CTCCCACCCAGCACTGCCCTTGG + Intronic
1168160005 19:54503780-54503802 CTCCCACCCAGCACTGCCTTTGG - Intronic
1168319475 19:55500520-55500542 CAGCCGGCCAGCACAGCGGTTGG - Exonic
926355304 2:12035881-12035903 CACCAACCCAGCACTGTGGAAGG + Intergenic
934712941 2:96527582-96527604 CCCCCACCGAGGACCGCGCTGGG - Intergenic
934896138 2:98121742-98121764 CACCCACCGAGCACCGAGAAGGG + Intronic
935755655 2:106274510-106274532 CTCCCTCCCAGCACTGCTGTGGG + Intergenic
938392597 2:130917044-130917066 CAGCCACCCAGGAAGGCGGTAGG + Exonic
942068903 2:172297706-172297728 CACCCACCCAGCAGCTGTGTGGG + Intergenic
948570986 2:238916962-238916984 CACTGTCCCAGCACTGCGGTGGG - Intergenic
948763704 2:240208763-240208785 GACACACCCAGCACCGCTGCTGG + Intergenic
1179411987 21:41168826-41168848 CTCCCGCCCAGCCCCGCGGAGGG - Intronic
1179457183 21:41507881-41507903 CACTCTCCCAGCACCCCGGGAGG + Intronic
1180701106 22:17781829-17781851 CACCCACCCAGCAGCGGGGCTGG - Intergenic
1181512254 22:23394277-23394299 CCCCCACCCAGCACCCTGCTTGG + Intergenic
1183032900 22:35118745-35118767 CACCCAGCCAGTACCCCGGGTGG - Intergenic
1183265043 22:36819607-36819629 CAGACACCCAGCACCACGGTTGG - Intergenic
1184739784 22:46421193-46421215 TACCCCCCCAGCACCTCGGCAGG - Intronic
1185111332 22:48901774-48901796 GAAACTCCCAGCACCGCGGTAGG + Intergenic
1185111578 22:48902994-48903016 GAAACTCCCAGCACCGCGGTAGG - Intergenic
950018435 3:9769842-9769864 CTCCCAGCCAGCCCCGCGGCGGG - Exonic
954379821 3:50213481-50213503 CAGCCACCCAGCACCGCCTCAGG + Intronic
956904177 3:73748859-73748881 AACCCACCCATCACCACTGTGGG + Intergenic
966926755 3:184649303-184649325 CAGCCACCCACCACCACGTTCGG - Intronic
969502107 4:7559460-7559482 CACACACCCACCAACGGGGTCGG - Intronic
975401569 4:73944533-73944555 CACCCACCCACCCCGGGGGTGGG - Intergenic
975689417 4:76949631-76949653 CTCCCGCCCACCACCGCGGCCGG + Intergenic
992719647 5:79547870-79547892 CTCCCACCCAGCACCACTGAGGG - Intergenic
998071094 5:139198444-139198466 CCCCCGCCCCGCACCGAGGTGGG + Intronic
1000283412 5:159803088-159803110 CAGACACCCAGCACCGCGCATGG + Intergenic
1001656232 5:173352574-173352596 CTCCCTCCCAGCACCGAGGGAGG - Intergenic
1007283960 6:40734257-40734279 CCCCCACCCAGCACAGTGCTTGG + Intergenic
1007362618 6:41369705-41369727 CAGGCACCCACCACCACGGTGGG - Intergenic
1007432839 6:41786530-41786552 AACCCACCCCGCGCCGCGGTCGG + Intronic
1009192806 6:60650009-60650031 CACACACCAAGCACAGAGGTGGG - Intergenic
1019480003 7:1261985-1262007 CATCCATCCAGCAGCGCTGTGGG + Intergenic
1020106498 7:5424511-5424533 CTCTCCCCCAGCAGCGCGGTCGG + Intronic
1023972737 7:45003330-45003352 CAGCCACCCAGCACCTTGGGAGG - Intronic
1026888402 7:73967940-73967962 CACCCACCCAGCCTCCAGGTGGG + Intergenic
1035170788 7:157016353-157016375 CACCCACCCAGCAGCCCGCAGGG - Intergenic
1037985680 8:23289179-23289201 CACCCACACACCACCGCTGCAGG - Intronic
1041142855 8:54841661-54841683 CTCCCAACCAACACCGCGGATGG - Intergenic
1044739903 8:95315473-95315495 CACCCAGCCAGCCCCAAGGTTGG - Intergenic
1045575675 8:103417497-103417519 CAGGCACCCAGCACCACGCTGGG - Intronic
1049469990 8:142770935-142770957 CCCCCACCCAGCACCCCTGAGGG - Intronic
1049660710 8:143818614-143818636 CACCCACCCAGCCCTGCTGTGGG + Intronic
1049798844 8:144508649-144508671 CACCCGCGCAGGACCTCGGTGGG + Intergenic
1055611573 9:78030859-78030881 CACACACGCAGCACAGGGGTCGG - Intronic
1057277762 9:93685041-93685063 AAATCACCCAGCACCGCAGTGGG - Intergenic
1060294948 9:122337050-122337072 CGCACCCCCAGCACCGCGGCGGG + Intergenic
1061580126 9:131531233-131531255 CGCCCGCCCAGCGCCGAGGTCGG + Intronic
1062139752 9:134949351-134949373 CACCCACCCAGCCCCGTTCTGGG - Intergenic
1198880989 X:141281019-141281041 CAGGCACCCACCACCGCGCTTGG + Intergenic
1201240896 Y:11955415-11955437 GACCAACCCAGCACCAAGGTCGG + Intergenic