ID: 1113809472

View in Genome Browser
Species Human (GRCh38)
Location 13:113129630-113129652
Sequence TGAGCTCCTTACCAACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113809472_1113809474 -3 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809474 13:113129650-113129672 TCAGGCCACAGCGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 16
4: 142
1113809472_1113809486 27 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809486 13:113129680-113129702 GCTCCGTCCATCCAGGGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 93
1113809472_1113809481 21 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809481 13:113129674-113129696 CCCGCTGCTCCGTCCATCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 136
1113809472_1113809483 22 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809483 13:113129675-113129697 CCGCTGCTCCGTCCATCCAGGGG 0: 1
1: 0
2: 2
3: 6
4: 104
1113809472_1113809484 23 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809484 13:113129676-113129698 CGCTGCTCCGTCCATCCAGGGGG 0: 1
1: 0
2: 4
3: 52
4: 198
1113809472_1113809479 20 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809479 13:113129673-113129695 CCCCGCTGCTCCGTCCATCCAGG 0: 1
1: 0
2: 1
3: 12
4: 153
1113809472_1113809485 24 Left 1113809472 13:113129630-113129652 CCTGGCTGTTGGTAAGGAGCTCA 0: 1
1: 0
2: 2
3: 6
4: 123
Right 1113809485 13:113129677-113129699 GCTGCTCCGTCCATCCAGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113809472 Original CRISPR TGAGCTCCTTACCAACAGCC AGG (reversed) Intronic
901942013 1:12669761-12669783 TCAGCTGCTTACCAAGTGCCAGG - Intergenic
903994819 1:27299116-27299138 TGAGCTCTTAGCCTACAGCCTGG - Intronic
907457684 1:54585935-54585957 TGGGCTCCCTCCCATCAGCCTGG + Intronic
910604016 1:89063589-89063611 TGAATTCCTTACATACAGCCAGG - Intronic
912580874 1:110719822-110719844 TCAGTTCCTCACCAACACCCAGG - Intergenic
916853648 1:168728051-168728073 TGAGCTCCTGACCAAGCACCTGG + Intronic
917485105 1:175448532-175448554 TGAGCTGCTGACCACCAGACTGG - Intronic
922851017 1:228734383-228734405 TGAGCTTCTAACCAAAATCCTGG - Intergenic
923034879 1:230278864-230278886 AGGGCTGCTTTCCAACAGCCAGG + Intronic
923669081 1:236024815-236024837 TCAGCTCCTTCCCGACAGCTGGG + Intronic
1065572068 10:27081289-27081311 TGATCTCTTTTCCAAAAGCCCGG + Intronic
1066981505 10:42420402-42420424 TGTGCTCCTTACAAAGAGACTGG + Intergenic
1068980272 10:63055626-63055648 TAAGTTCCTTAACAGCAGCCTGG + Intergenic
1069244564 10:66187589-66187611 TGAGCTCCTCAGCAAAAGCTGGG + Intronic
1069905443 10:71729546-71729568 TGGGCTGGTTTCCAACAGCCCGG + Intronic
1070579594 10:77709937-77709959 TGGGCTCTTTACCCACAGCAGGG - Intergenic
1071495898 10:86167472-86167494 TGAGGTCCTTGGGAACAGCCAGG - Intronic
1072818134 10:98530041-98530063 TTGGATCCTTACCAACTGCCAGG + Intronic
1073318723 10:102600803-102600825 TGAGCTCTTTGGCAAAAGCCTGG + Intronic
1076439596 10:130471980-130472002 TGGGCTGCTTAACAACAGCCTGG + Intergenic
1077470657 11:2758843-2758865 TGATCTCCATCCCTACAGCCTGG - Intronic
1078240781 11:9529432-9529454 GGAGCTCCTGGCCAGCAGCCAGG - Intergenic
1078479727 11:11665217-11665239 TCTGCTCCTTACCTCCAGCCAGG + Intergenic
1080421566 11:32115745-32115767 TGAGATCCTTCCCAGGAGCCAGG + Intergenic
1083194754 11:61079181-61079203 CGAACTCCTGACCAACAGCCAGG + Intergenic
1083287130 11:61667301-61667323 CTACCTCCTTGCCAACAGCCAGG + Intergenic
1084807867 11:71591457-71591479 TGAGCTCGTTGCTAACATCCAGG - Intronic
1085642211 11:78199664-78199686 TGAACTTCTTAACAGCAGCCAGG - Exonic
1089441001 11:118516845-118516867 TGAGCTCCTTAAGAACAGACGGG + Intronic
1094142355 12:27194197-27194219 TTAGCTCCATACCAGGAGCCAGG - Intergenic
1095219733 12:39595870-39595892 TGAGCTCCTTAGCTAGAGACTGG + Intronic
1101846593 12:108367896-108367918 TCAGCCCCTTACCAACATGCAGG + Intergenic
1103599306 12:122044019-122044041 GGTGCTCCTTCCCATCAGCCTGG - Exonic
1105716029 13:23065784-23065806 TAAGCTCCATAGCAACAGACAGG - Intergenic
1113809472 13:113129630-113129652 TGAGCTCCTTACCAACAGCCAGG - Intronic
1117978965 14:61322751-61322773 GGAGCTCCTTACCCAAAGACTGG - Intronic
1120857741 14:89227342-89227364 GGATCTCCTTCCCAACAGCTTGG + Intronic
1122067224 14:99182197-99182219 TGAAATCCTTACCACCTGCCAGG + Intronic
1124704828 15:31954828-31954850 CCAGCTCCTTAACAACAGGCAGG + Intergenic
1124858458 15:33413660-33413682 TGAGGTCCTTACCCAGTGCCTGG + Intronic
1126448900 15:48783141-48783163 TGAGCTACTTACCAGCAAACAGG + Intronic
1127682139 15:61308210-61308232 TGAGCTACTTTTAAACAGCCTGG + Intergenic
1130878483 15:88034222-88034244 TGATCTCCATACCAGCAGCTGGG + Intronic
1131809421 15:96157306-96157328 TGAGCTCATGATCCACAGCCTGG + Intergenic
1132180469 15:99749179-99749201 TGAGCTCCTTAACAGAACCCAGG + Intergenic
1134204202 16:12223832-12223854 TGAAATGCTTGCCAACAGCCTGG - Intronic
1134216536 16:12321060-12321082 GGAGGTCCTTACCACCATCCCGG + Intronic
1136188034 16:28599567-28599589 TGGGCTCTTAGCCAACAGCCAGG + Intergenic
1136190506 16:28612561-28612583 TGGGCTCTTAGCCAACAGCCAGG + Intronic
1140029748 16:71326124-71326146 TGATCTCTTTACCAAGTGCCAGG + Intergenic
1140176561 16:72666125-72666147 TGAGCACTTTTCCAACAGCTTGG + Intergenic
1140192856 16:72833115-72833137 CAAGCTGCTTACCAAGAGCCAGG + Intronic
1140970099 16:80004456-80004478 TGAGCTCCTAGCCCCCAGCCAGG + Intergenic
1146979967 17:37151300-37151322 TGAGATCATTACCATCAGCCTGG - Exonic
1149125802 17:53230375-53230397 TGACCTCCTTACCTAAAGCAAGG - Intergenic
1149346133 17:55738179-55738201 AAAGCGCCTGACCAACAGCCTGG - Intergenic
1152395313 17:80029358-80029380 TCAGCTCCAACCCAACAGCCTGG - Intronic
1152684944 17:81689308-81689330 TGAACTCCAGCCCAACAGCCTGG - Intronic
1158931070 18:62325417-62325439 GGCGCTCCTTACCTGCAGCCGGG - Exonic
1159692301 18:71504363-71504385 TGAGGTCCTGACCAGCAACCAGG + Intergenic
1163013025 19:14437130-14437152 TCACCTCCTTACCCACAGTCAGG + Intronic
1165110995 19:33502073-33502095 TTATCTCCTGACCAAGAGCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168402127 19:56091524-56091546 TGAGCTCTTTACCTAGAACCAGG + Intronic
927102555 2:19799270-19799292 TGAGCTTCTGACCAGCATCCAGG - Intergenic
927637440 2:24826305-24826327 TGGGCTCCTCTCCAACAGCCAGG + Intronic
927919298 2:26959685-26959707 TCAGCTCTTTATCAAGAGCCAGG - Intergenic
928403833 2:30999009-30999031 TGAGCTTATTCCTAACAGCCAGG + Intronic
931894349 2:66712608-66712630 TGACCTTCTTACCATCTGCCAGG - Intergenic
932717068 2:74108824-74108846 TGAAGTCCTTATCAACAGCTGGG - Intergenic
933710292 2:85320307-85320329 TGAGCTCCTTTCCAAGAAGCTGG + Intronic
937017396 2:118618632-118618654 GGAACTCCTCACCACCAGCCTGG - Intergenic
940487487 2:154314560-154314582 TGAGCCCCTTATCAGAAGCCAGG - Intronic
1169792573 20:9427311-9427333 TGGGCTGCTTAGAAACAGCCAGG - Intronic
1169879175 20:10328317-10328339 GAAGCTCTCTACCAACAGCCAGG + Intergenic
1171367269 20:24633805-24633827 GGGGCTCCTAACCAAGAGCCTGG - Intronic
1171465001 20:25321266-25321288 TGGGCTCCTGACAAAGAGCCAGG + Intronic
1174279030 20:49425005-49425027 TGTGCTCATTCCCACCAGCCAGG - Intronic
1174321169 20:49742811-49742833 TGCACTCCTGAGCAACAGCCTGG - Intergenic
1175349230 20:58306903-58306925 TGAAGTCCTGGCCAACAGCCAGG + Intergenic
1175458071 20:59130142-59130164 TCAGCTTCTTACCAAGTGCCAGG - Intergenic
1177459750 21:21395296-21395318 TGAACTCCTGGCCCACAGCCGGG + Intronic
1178820095 21:35967060-35967082 TGAGCTGCTTTATAACAGCCTGG + Intronic
1179716048 21:43289111-43289133 GGAGCTCCTTCCCACCAGACAGG - Intergenic
1182337691 22:29595718-29595740 TGAGCTTCTTACCAGCAGGAAGG + Intergenic
1184092014 22:42297814-42297836 TCATCTCCTCACCATCAGCCAGG - Intronic
1184326286 22:43789534-43789556 TGTCCTGCTTACCATCAGCCAGG + Intronic
950660071 3:14461763-14461785 GAAGCCCCTCACCAACAGCCAGG + Intronic
954141436 3:48608895-48608917 TGGGCTCCTTAACAAAAGGCTGG + Intronic
955928560 3:64032310-64032332 AGTGCTCCTTACCCCCAGCCTGG + Intergenic
957380500 3:79422321-79422343 TCAGCTCCTTGCCACCTGCCTGG + Intronic
968970619 4:3791664-3791686 GGAGGTCGTTCCCAACAGCCAGG - Intergenic
974152596 4:58028566-58028588 TGACCTCATTAACAAAAGCCTGG - Intergenic
976822970 4:89227738-89227760 TGCCATTCTTACCAACAGCCAGG + Intergenic
977119540 4:93080955-93080977 TGGGCTCCTTATCAAAAGACAGG - Intronic
977300043 4:95257191-95257213 TGAAGTCCTTACAACCAGCCTGG + Intronic
980311486 4:131136299-131136321 TGAGCTTCCTACAAACATCCTGG - Intergenic
985429947 4:189869633-189869655 TGAGCTCCTTTGAAACAGACTGG - Intergenic
988549328 5:32185940-32185962 TGAGGTCCTCACCAAAAGTCCGG + Intergenic
997627880 5:135343294-135343316 TCAGCTTCTTATCATCAGCCAGG + Exonic
1001664376 5:173420535-173420557 TGAGTTCCTGCCCAACAGCTTGG - Intergenic
1003642757 6:7889130-7889152 TGAGCTGCTGACCATCGGCCAGG + Intronic
1004017353 6:11744235-11744257 TGAGGTCCTCACCAGAAGCCAGG + Intronic
1004963892 6:20824809-20824831 TGAGCCTCTTAACAACAGACTGG - Intronic
1007108891 6:39301662-39301684 TGAGCGCCTTGCCAGCTGCCAGG - Intronic
1007485518 6:42178408-42178430 TGAGCTGCTCACCATCATCCAGG + Exonic
1008603275 6:53116484-53116506 AGAGCTCCTGACCAACTGCAGGG - Intergenic
1014715604 6:124861402-124861424 TAAGGTCCTTGCCAATAGCCAGG + Intergenic
1015014397 6:128393382-128393404 TAAGGTCCTTATGAACAGCCGGG - Intronic
1016466513 6:144330781-144330803 TGAGTTCCTCCCCAACTGCCCGG - Intronic
1016866164 6:148769152-148769174 TGAGCTCCTCAACAACAGCCTGG + Intronic
1022666498 7:32416111-32416133 TGAGCTCATGACCAACTCCCAGG - Intergenic
1026279081 7:68905606-68905628 TGAGATTCTTTCCAACACCCTGG + Intergenic
1026635597 7:72079063-72079085 TGAGGTCCTTACGAAATGCCAGG + Intronic
1036495395 8:9265703-9265725 TGCGCGCCTTTCCAACAGGCAGG - Intergenic
1037427380 8:18770855-18770877 TGAGCTCTTTACCAGCATCCAGG + Intronic
1037455240 8:19056909-19056931 TGAGCTCATCACCCACAGCTTGG - Intronic
1045415044 8:101957839-101957861 GGGGCTCCATTCCAACAGCCTGG - Intronic
1047032331 8:120896220-120896242 TGTGCCCCTTACCAACAGCCCGG - Intergenic
1048744606 8:137599939-137599961 TGTGCTTGATACCAACAGCCTGG + Intergenic
1050146400 9:2572663-2572685 TGAGCTCCTTGAGAACAGGCTGG + Intergenic
1051830187 9:21267347-21267369 TGTGTTCCTTACCTCCAGCCTGG - Intergenic
1054757459 9:68973739-68973761 AGAGCTCCTGAACACCAGCCAGG + Intronic
1059440714 9:114305327-114305349 TGAGCCCCTTACCATCTGTCCGG + Intronic
1059759005 9:117320741-117320763 TGATTTCCTTACCTACAGTCAGG + Intronic
1060481509 9:124018948-124018970 GGAGCTCATTAACAGCAGCCAGG + Intronic
1061046703 9:128169206-128169228 TGAGCTCCTTGCCTACTCCCTGG - Intronic
1061105516 9:128527261-128527283 TGAGGGCCTGACCAACAGCAAGG + Exonic
1061787700 9:133040310-133040332 TGAGCTGGTTCCCAACACCCAGG - Intronic
1186915490 X:14215061-14215083 GCAGCTTCTTCCCAACAGCCGGG - Intergenic
1187429538 X:19209616-19209638 TGAACTCCCAGCCAACAGCCAGG - Intergenic
1198652156 X:138874743-138874765 GGAGCTCCTTACCAAATTCCTGG + Intronic