ID: 1113810105

View in Genome Browser
Species Human (GRCh38)
Location 13:113135629-113135651
Sequence AAATTTTAACATATGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 666}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113810099_1113810105 16 Left 1113810099 13:113135590-113135612 CCTAAAGATCTCACCCTTAATAC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG 0: 1
1: 0
2: 4
3: 63
4: 666
1113810098_1113810105 19 Left 1113810098 13:113135587-113135609 CCTCCTAAAGATCTCACCCTTAA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG 0: 1
1: 0
2: 4
3: 63
4: 666
1113810097_1113810105 27 Left 1113810097 13:113135579-113135601 CCTAATCACCTCCTAAAGATCTC 0: 1
1: 15
2: 173
3: 796
4: 2322
Right 1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG 0: 1
1: 0
2: 4
3: 63
4: 666
1113810101_1113810105 2 Left 1113810101 13:113135604-113135626 CCTTAATACTATTACATTGTCGA 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG 0: 1
1: 0
2: 4
3: 63
4: 666
1113810100_1113810105 3 Left 1113810100 13:113135603-113135625 CCCTTAATACTATTACATTGTCG 0: 1
1: 0
2: 2
3: 16
4: 140
Right 1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG 0: 1
1: 0
2: 4
3: 63
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113810105 Original CRISPR AAATTTTAACATATGTATGG GGG Intronic
901142900 1:7046742-7046764 GAATTTAAACATATTTATTGAGG - Intronic
901505161 1:9680322-9680344 AAATTTTAAGCTGTGCATGGTGG + Intronic
902706879 1:18211776-18211798 AAAATTTAAAATATGGATGATGG - Intronic
902907786 1:19571705-19571727 AAGTTTCAACATATGAATTGAGG - Intergenic
904076665 1:27848100-27848122 AAATTTAAAGATAAGTATGTTGG + Intronic
904283066 1:29434948-29434970 AAATTTTAACATGAGTTTTGAGG - Intergenic
905046865 1:35011128-35011150 AAATTTTAAAAAATGTTTGTGGG - Intronic
905234477 1:36536449-36536471 AAATTTCAACATGAGTATGGAGG - Intergenic
905440270 1:37991709-37991731 TAAATTTAAAATATGTAAGGAGG + Intergenic
906550134 1:46658596-46658618 AAATTTGAACATAAGTACTGTGG - Intronic
906957898 1:50391399-50391421 AAATGATAACATGTATATGGAGG - Intergenic
906972002 1:50525184-50525206 AACTTTTAAAATACATATGGGGG - Intronic
907323936 1:53624046-53624068 ATATTTTCACATATGTATTTTGG - Intronic
907626929 1:56039713-56039735 AAATTCTAACATATGAATTCTGG + Intergenic
907938175 1:59061360-59061382 AAGTTTTAACATATGAATTTTGG - Intergenic
908469223 1:64425995-64426017 GAGTTTTAAAATATTTATGGTGG + Intergenic
909005502 1:70271553-70271575 TAACTTTAATTTATGTATGGAGG - Intronic
909067459 1:70952608-70952630 AAATTTTTTCATATGCATGCTGG - Exonic
909233549 1:73121827-73121849 AAATTTCAACATATGAATTTTGG + Intergenic
910062415 1:83109957-83109979 CAACTTTAGCATATGAATGGTGG - Intergenic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
911105431 1:94127182-94127204 ATATTTTAAAATATCTTTGGAGG + Intergenic
911171530 1:94775378-94775400 CAAACTTAAGATATGTATGGAGG - Intergenic
911526714 1:98996546-98996568 ATATTTTAACATATGTGAAGTGG - Intronic
911779189 1:101854124-101854146 AAATTTTATCATATTTATTGAGG - Intronic
912573629 1:110643781-110643803 ATATCTAAAAATATGTATGGAGG + Intergenic
912991545 1:114492322-114492344 ATATTTTAACATTTTTATTGTGG + Intronic
913050262 1:115111520-115111542 CGATTTTAACATATGAATGGGGG - Intergenic
914697978 1:150103000-150103022 AATTTTTAACTTAAGTTTGGGGG - Intronic
915574141 1:156764203-156764225 AAATTTTTAACTATGTACGGTGG - Intronic
916689445 1:167176558-167176580 GAATTTCAACATATGTATTCTGG + Intergenic
916766098 1:167862196-167862218 AGAATTTAACATATGAATTGTGG - Intronic
916946987 1:169738851-169738873 AAATTCTAACATTTGTCTTGGGG - Intronic
917757508 1:178117521-178117543 AACTTTCAACATATGAATTGGGG - Intronic
918253335 1:182724502-182724524 AAACTTAAAAATATGTAAGGAGG + Intergenic
918392897 1:184084839-184084861 AAATTTCAACATGGGTCTGGAGG + Intergenic
918630524 1:186712145-186712167 AAGTTTTAACATATGAATTTTGG + Intergenic
918634416 1:186757754-186757776 AAATCTTCACAAATGTATTGTGG - Intergenic
918727429 1:187943419-187943441 AGATTTTAACATATGAATGTGGG - Intergenic
918974411 1:191463500-191463522 AAATTCTTACATATTTTTGGTGG + Intergenic
918998282 1:191791698-191791720 AAATTTCAACATAGTTTTGGTGG + Intergenic
919350346 1:196444192-196444214 AAATATTTACATGTGCATGGAGG - Intronic
919968006 1:202548642-202548664 TAATTTTAAAATAGGTGTGGTGG + Intronic
920762258 1:208796148-208796170 AAATTTTACCATCTGTAGTGTGG - Intergenic
921622910 1:217346128-217346150 AATTTTTTACATGTTTATGGTGG - Intergenic
921911581 1:220554860-220554882 AAATTTTAAACTTTTTATGGTGG + Intronic
922199728 1:223391880-223391902 GAATTTTAACATATGAATTTGGG + Intergenic
922885740 1:229019152-229019174 AAATTTCAAAATATGAATGTTGG + Intergenic
923068070 1:230538395-230538417 AAATTTTAACATATGGATTTGGG + Intergenic
923082118 1:230667912-230667934 ACATTTTATAATATGTTTGGGGG + Intronic
923443852 1:234049227-234049249 AATTATTTACATATGTATTGGGG - Intronic
923889100 1:238191528-238191550 AAGTTTTAACATATGAATTTTGG - Intergenic
924526263 1:244853159-244853181 AACTTTTAACATATTTAATGAGG - Intronic
924642160 1:245844399-245844421 AAATCATAACATATATCTGGGGG - Intronic
924715569 1:246570131-246570153 AAAGATTAACTTGTGTATGGTGG + Intronic
924895562 1:248334642-248334664 GAATTTCAACATATGAATGGGGG + Intergenic
1063276934 10:4579634-4579656 GAATTTTCACATATGTATGCTGG - Intergenic
1063316709 10:5013794-5013816 AAATTGTAATATATGTATACTGG - Intronic
1063787890 10:9406824-9406846 GATTTTTAACATATTTATGGAGG + Intergenic
1064912425 10:20416985-20417007 AAATTTCAACATATGAATGGGGG - Intergenic
1065438520 10:25725801-25725823 CAATTTAAATATATGTATAGAGG - Intergenic
1065447320 10:25816434-25816456 AAATTGTCACAAATGTAAGGAGG + Intergenic
1066073722 10:31849477-31849499 AAATTTTAATATCTGCATGGGGG + Intronic
1066977319 10:42381061-42381083 CAAGTTTCACATATATATGGTGG + Intergenic
1067968275 10:50939907-50939929 AAATTTCAACATATGAATTTGGG - Intergenic
1068258601 10:54546845-54546867 AAATTTCAAAATATGAATTGAGG - Intronic
1068265397 10:54642038-54642060 ATATTTTAACATATGAATTATGG - Intronic
1068282228 10:54888658-54888680 AAATTCTAATAGATGTGTGGTGG + Intronic
1068338214 10:55666019-55666041 AAATTTCATCATTTGTATGGTGG - Intergenic
1068386264 10:56331503-56331525 AAGTTTTAACATAAATTTGGAGG + Intergenic
1068414655 10:56703576-56703598 AAATGTTAACATTTTTATGGTGG - Intergenic
1069151885 10:64972586-64972608 AATTGTTCACATATATATGGAGG + Intergenic
1069183557 10:65393539-65393561 ATATTTTAACATATGAATTTTGG + Intergenic
1069536103 10:69254442-69254464 AAAGTTTAAGAGATGGATGGTGG - Intronic
1070525180 10:77290095-77290117 GAATTTTCACAAATGTATGGAGG - Intronic
1070562554 10:77578810-77578832 ACATTTTAACAAATATATAGGGG - Intronic
1070654326 10:78260993-78261015 AAGTTTCCACATATGTAAGGTGG + Intergenic
1071224634 10:83514387-83514409 TATTTTTTACATATGTAAGGAGG - Intergenic
1071361857 10:84854793-84854815 AAATCTTAACAGAAGCATGGTGG - Intergenic
1071894003 10:90044331-90044353 TAAATTTAAAATATGTAAGGAGG + Intergenic
1071908662 10:90204795-90204817 GAATTTGAAAATATGTAAGGAGG - Intergenic
1072991933 10:100204151-100204173 GAATTTCAACATATGTATTTTGG + Intronic
1073640750 10:105250256-105250278 AAGTTTTGACAGATGAATGGGGG + Intronic
1073721478 10:106177679-106177701 TTATTTTAAAATATTTATGGAGG - Intergenic
1073782552 10:106855512-106855534 AAAGTGTAATATATGTATAGTGG - Intronic
1074298423 10:112211886-112211908 AAAGATTAACAGATGTATGAGGG + Intronic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1074682983 10:115928757-115928779 ATATTTTATCATATGTATACTGG - Intronic
1076493029 10:130876615-130876637 AAACTTCAACATATTTTTGGGGG + Intergenic
1078381645 11:10847638-10847660 AAATTTTATCATTTGGTTGGTGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079647632 11:22886013-22886035 GGATTTCAACATATGAATGGTGG + Intergenic
1079676852 11:23238997-23239019 AATTTTTAACATTTGTTTGATGG + Intergenic
1079713515 11:23716664-23716686 AGATTTTAACATATGAATTTGGG - Intergenic
1079743774 11:24099478-24099500 ACATTTTAAGAAGTGTATGGAGG + Intergenic
1080695011 11:34595922-34595944 AAATGTCAACATATGAATGAGGG - Intergenic
1081066627 11:38549373-38549395 AAATTTTAAAATATGACTGTAGG - Intergenic
1081337065 11:41879913-41879935 AAGTTTTAACATATAAATTGGGG - Intergenic
1081628017 11:44666931-44666953 ACATTTTACCATATGGAAGGTGG + Intergenic
1082122876 11:48398304-48398326 AAGTTTTAACATATGAATTTTGG + Intergenic
1082556574 11:54569580-54569602 AAGTTTTAACATATGAATTTTGG + Intergenic
1083103195 11:60331729-60331751 GAATTTTAACATATGAATTTCGG - Intergenic
1084596084 11:70117823-70117845 AGATTTAAAAACATGTATGGGGG - Intronic
1085113379 11:73908555-73908577 AAAATTTAATTTAGGTATGGTGG - Intronic
1085189981 11:74611363-74611385 AAATTATAACATATGTTTTAAGG + Intronic
1085857643 11:80193566-80193588 TAATTTTATCATCTGTAAGGTGG + Intergenic
1085952949 11:81354851-81354873 ATAGATAAACATATGTATGGAGG + Intergenic
1086268617 11:85032101-85032123 ATTTTTTGAAATATGTATGGTGG - Intronic
1086352909 11:85961066-85961088 GAATTTTAATGTGTGTATGGGGG + Intronic
1086590253 11:88507610-88507632 AAATATTAAAATATGCATTGGGG - Intronic
1086892960 11:92279571-92279593 AATATTTTACATATTTATGGGGG + Intergenic
1087003726 11:93447221-93447243 AATGATTAACTTATGTATGGTGG - Intergenic
1087215470 11:95488490-95488512 ATATTTTGACATACGTATTGGGG - Intergenic
1088119510 11:106351556-106351578 ACATTTTAACATATGAATTTTGG + Intergenic
1088312351 11:108473355-108473377 AAATTTTAAAATATGTACTCTGG - Exonic
1089952280 11:122539880-122539902 AAATCTTAACAAATGTAAGAAGG + Intergenic
1089962040 11:122624946-122624968 AAATTTCACCCTCTGTATGGAGG + Intergenic
1090992806 11:131835164-131835186 AAGATTTAACATATGTATTTGGG + Intronic
1091580481 12:1785003-1785025 TCATTTTAACATTGGTATGGAGG + Intronic
1092116071 12:6007336-6007358 AAATCTTAACAAATTTAAGGAGG + Intronic
1092175726 12:6404915-6404937 AAATTTTAACTTTTTTTTGGAGG + Intergenic
1092917204 12:13199659-13199681 AAATTTTAAGATCTGTAGGATGG - Intronic
1093309224 12:17558759-17558781 ACATTTCAAAATATGTATGTAGG - Intergenic
1094237606 12:28186626-28186648 TAAGTTTAACATATGAATTGTGG - Intronic
1095370519 12:41461620-41461642 AAATTTTAATATTTGTATTTGGG - Intronic
1095529989 12:43175664-43175686 AAATTTTATCACAGGGATGGGGG + Intergenic
1096282978 12:50272693-50272715 AAATTTTATCACTTGTGTGGCGG - Intronic
1097409814 12:59237946-59237968 AGATTTTAACATATGAATTGAGG - Intergenic
1097591531 12:61581411-61581433 AAATTTTCACTTAAGAATGGGGG - Intergenic
1097738902 12:63215361-63215383 AGGTTTTAACATATGAATGGAGG - Intergenic
1098248296 12:68542781-68542803 AAATTTTAACATATTAATGTAGG - Intergenic
1098714951 12:73818665-73818687 AAATTTTAACATATGAATTCAGG - Intergenic
1098738376 12:74137324-74137346 ACATTTTTACATATGTCTGTTGG + Intergenic
1098832893 12:75384854-75384876 AAATTTTAACATGAATTTGGAGG - Intronic
1099070574 12:78041558-78041580 AAAATGTAAAATATTTATGGGGG - Intronic
1099090410 12:78299830-78299852 AATTTTTAACATGTTTATGGAGG - Intergenic
1099122865 12:78713532-78713554 ATATTTTAACAGCTGTATTGAGG - Intergenic
1099125983 12:78758908-78758930 AAATTTTGACACAAGTTTGGTGG + Intergenic
1099319429 12:81126562-81126584 AAATTTTAACATAAGTATCAAGG + Intronic
1099333162 12:81317765-81317787 AATTTTTAACATATAGATGCTGG - Intronic
1099390354 12:82071644-82071666 AGATTTTAACATATGGATTTGGG - Intergenic
1099582423 12:84467182-84467204 AAATTTAAAAATAAGTATGATGG - Intergenic
1099976723 12:89553334-89553356 ATATTTTAACATATGCTTGATGG + Intergenic
1100138157 12:91581674-91581696 ATATGTTAACATATGTAAAGTGG - Intergenic
1100217023 12:92461621-92461643 AAATTTCAACATATGAATTTTGG + Intergenic
1100345122 12:93722464-93722486 AAGGTTTAACATAGGTATAGTGG - Intronic
1100476522 12:94940432-94940454 AAATTTCAACATATGAATTCTGG - Intronic
1100598378 12:96091011-96091033 AAATTTCAACATATGAATTTTGG - Intergenic
1100647387 12:96545664-96545686 AAATTTCAACATGAGTTTGGAGG + Intronic
1101196632 12:102390165-102390187 AAATTTTTACATCTGCATTGTGG + Intergenic
1101207700 12:102505250-102505272 AAATTTCAACATGAGTTTGGCGG - Intergenic
1103449403 12:121017707-121017729 CAATTTTAACATATGAATTTTGG - Intergenic
1103537377 12:121642116-121642138 AAATTTTAAGCCAGGTATGGTGG + Intronic
1104184169 12:126412886-126412908 AATGTATAATATATGTATGGTGG - Intergenic
1105073473 12:133252866-133252888 AAATTTCAACATAGATTTGGTGG - Intergenic
1105383854 13:19912248-19912270 AAATTATAACATAGGACTGGAGG - Intergenic
1105995475 13:25667269-25667291 AAATTTCAACATGTGTGTGTCGG - Intronic
1106884480 13:34169230-34169252 AAATTTCAACATAGTTTTGGAGG - Intergenic
1106884766 13:34172813-34172835 AACTTTTAACATATGATTTGGGG - Intergenic
1106977709 13:35241272-35241294 TAATGTTACCATATGTATGTGGG - Intronic
1107026611 13:35808413-35808435 ACATTTTTACACATTTATGGGGG - Intronic
1107238598 13:38203197-38203219 AAATTTTAATACAATTATGGGGG + Intergenic
1107563162 13:41575550-41575572 AAATTTTAAATTTTATATGGTGG + Intronic
1107805110 13:44146316-44146338 CAATTTCAACATGTGTTTGGTGG + Intronic
1108105874 13:47008525-47008547 AAATTTTAACAGCTGTGTGTGGG + Intergenic
1109008251 13:56906398-56906420 AAAATTTAATAAATGTATAGGGG + Intergenic
1109646020 13:65257797-65257819 AAAATTTAGTAGATGTATGGTGG - Intergenic
1109691703 13:65901465-65901487 GAAATTTAAAATATGTATGTAGG - Intergenic
1109924979 13:69125057-69125079 CTATTTTAATATGTGTATGGTGG - Intergenic
1109956429 13:69573145-69573167 TAATTTAAAAATATGTACGGAGG + Intergenic
1110183986 13:72651546-72651568 AATTTTTAATAAATGTGTGGAGG - Intergenic
1110413385 13:75227069-75227091 AAATTTTAACAGTTGGCTGGAGG + Intergenic
1110453342 13:75662077-75662099 AAAGTTTAACATATGACTGAAGG - Intronic
1110508329 13:76316213-76316235 ATATTTGAACATATTTATGGGGG - Intergenic
1110624415 13:77636285-77636307 AAATTTGCACATATTTATGGAGG - Intronic
1111545640 13:89731857-89731879 ACATTTTAAAACATGTATGTAGG + Intergenic
1111641172 13:90972491-90972513 AAAATTTAACCTAGGCATGGTGG + Intergenic
1112102757 13:96208162-96208184 AAATTTTTAAAAATATATGGAGG - Intronic
1112240490 13:97676762-97676784 AGATTTTAACATATGAATTTTGG + Intergenic
1112531148 13:100204694-100204716 AAATTTTAATAGAAGAATGGGGG - Intronic
1112715446 13:102179676-102179698 AAATTTAAACACCTGTATGTTGG + Intronic
1113148766 13:107238920-107238942 TCATTTTAACAGCTGTATGGGGG + Intronic
1113213595 13:108011896-108011918 GTATTTTAACATATCTATGTAGG + Intergenic
1113273478 13:108701287-108701309 AAATTTTAACATGAGTTTGCAGG - Intronic
1113374411 13:109750894-109750916 AAATTTTAATATAGGAGTGGTGG - Intergenic
1113712005 13:112471726-112471748 TAATTTTAACATATGGAATGAGG - Intergenic
1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG + Intronic
1114739131 14:25076718-25076740 AAATTGTCACATATGGCTGGTGG - Intergenic
1114766891 14:25382754-25382776 AAATTTCAACATATGTGTTTTGG + Intergenic
1114856885 14:26458059-26458081 ACATTTTTTCATATGTATGTTGG - Intronic
1114909532 14:27172790-27172812 AAATTTTAAAAAATGTTTGTGGG + Intergenic
1114910584 14:27190888-27190910 AGATTTTAACATATGGATTTTGG - Intergenic
1114960759 14:27885574-27885596 AAATTTTATCATAGGTATGTAGG - Intergenic
1115019654 14:28660812-28660834 ATATATTTACATATATATGGAGG - Intergenic
1115099311 14:29678776-29678798 GCATTTTAACATATATATGCAGG + Intronic
1115218783 14:31038692-31038714 AAATTTTCACATCTGTAAAGTGG + Intronic
1116435177 14:44887906-44887928 GGATTTCAACATATGAATGGAGG + Intergenic
1116737556 14:48711978-48712000 ATATTTTAAGATATATATGTTGG - Intergenic
1117028082 14:51642000-51642022 AAATTTTGGCATCTGTAAGGTGG - Intronic
1117032828 14:51692322-51692344 AAATATTCACATATGTAAGTAGG - Intronic
1117429161 14:55635291-55635313 GAATTTTATCATATATATGGGGG + Intronic
1117569577 14:57033251-57033273 AAACTTTAATACATATATGGAGG + Intergenic
1117651950 14:57916605-57916627 AAGTTGTAACATATGCATGATGG - Intronic
1117692494 14:58322387-58322409 AAATTATAAAATAAGTATGAAGG - Intronic
1117765812 14:59081516-59081538 AATTTTTAAAAAATGTCTGGTGG - Intergenic
1118020780 14:61711741-61711763 AAATGTTAACAAATGAATCGTGG - Intronic
1119861767 14:77941108-77941130 AAAATAAAACATATTTATGGAGG - Intergenic
1120585455 14:86306868-86306890 ATATTTCAACATATGAATGTAGG - Intergenic
1120819491 14:88899018-88899040 AAAATACAAAATATGTATGGTGG + Intergenic
1121060379 14:90902494-90902516 AAATTTTTAAATATGAATAGAGG + Intronic
1121069203 14:91000994-91001016 AAATTTTAATTTCTGTATTGGGG + Intronic
1121281162 14:92699603-92699625 AAATTTTAAAAAATGGATGTTGG + Intergenic
1121484389 14:94303418-94303440 CAAATTTAAAATATGTAAGGAGG - Intergenic
1121631693 14:95425807-95425829 AAATTTTAAAATATGGACTGTGG + Intronic
1121886566 14:97548378-97548400 AAATTTCAACATATGAATTTTGG + Intergenic
1122026002 14:98876813-98876835 TAATTTTTATATATGTATGAAGG - Intergenic
1122562435 14:102625684-102625706 AAATATTAACATCTGTTTGAAGG - Intronic
1122709102 14:103642334-103642356 GAATTTTAACATGTGAATTGGGG + Intronic
1122728735 14:103779121-103779143 TAATTTTAAAATATTTATTGTGG - Intronic
1123726314 15:23105840-23105862 TAAATTTAACATATGATTGGGGG + Intergenic
1124001512 15:25764373-25764395 AGGTTTTAACATATACATGGGGG - Intronic
1125111644 15:36040901-36040923 AATTTTTAATATCTGTATGTGGG - Intergenic
1125223914 15:37372500-37372522 CAATTTTCACATCTGTCTGGTGG + Intergenic
1125252615 15:37723186-37723208 AAATTTTAACATGAGAGTGGAGG + Intergenic
1125397569 15:39266400-39266422 ATATTTCAACAAATGTATGTGGG - Intergenic
1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG + Intergenic
1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG + Intergenic
1126064813 15:44818627-44818649 ATATTCAAACATATGTATGTAGG + Intergenic
1126095023 15:45081966-45081988 ATATTCAAACATATGTATGTAGG - Intergenic
1126277162 15:46896941-46896963 CAATTTTAAAATATAAATGGTGG + Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1126898767 15:53289170-53289192 AAATTTTTTCATGTGTGTGGTGG + Intergenic
1127137548 15:55940404-55940426 AAATTTTAACTGATTTATTGGGG - Intronic
1127205529 15:56713146-56713168 CAATTAAAACATTTGTATGGTGG - Intronic
1127482430 15:59390019-59390041 AAATTTTACCATATGTTATGAGG - Intronic
1129091592 15:73156947-73156969 AAGTCTTAACATGGGTATGGAGG + Intronic
1129580491 15:76803803-76803825 AAATTTCAACATATGAATTTTGG + Intronic
1129827545 15:78644273-78644295 AAATTTTAACAAATGTGTTTTGG - Intronic
1129913912 15:79251034-79251056 CAATTTTAACATATGAAAGTTGG - Intergenic
1130114872 15:80998015-80998037 AAGTTTTAACATATGAATTTGGG + Intergenic
1130339654 15:82988432-82988454 AAATATTTGCATATGTTTGGAGG + Intronic
1131605385 15:93898320-93898342 ATATTTGCACATATTTATGGGGG - Intergenic
1131627968 15:94144419-94144441 AAATTTTAACATGAGGTTGGAGG - Intergenic
1132082852 15:98882315-98882337 CATTTTTAATATGTGTATGGAGG + Intronic
1132200744 15:99953113-99953135 AAGGTTCAACATATGAATGGGGG - Intergenic
1202974417 15_KI270727v1_random:274938-274960 AATTTTTAAAAAATGTTTGGTGG + Intergenic
1133061311 16:3176136-3176158 GAACTTCAACATATGGATGGTGG + Intergenic
1133697567 16:8279572-8279594 AAATTTTAACATATAGATACTGG + Intergenic
1133834794 16:9358263-9358285 AAACTTTAAAATCTGTATGTGGG - Intergenic
1134278549 16:12798186-12798208 AACTTTTTACATATGTGTGCTGG + Intronic
1134415090 16:14036453-14036475 ATATTTCAACATATATATGGTGG - Intergenic
1134415092 16:14036483-14036505 ATATTTCAACATATATATGATGG - Intergenic
1134415093 16:14036513-14036535 TAATTTCAACATATATATGATGG - Intergenic
1134415095 16:14036572-14036594 ATATTTCAACATATATATGATGG - Intergenic
1134415096 16:14036602-14036624 ATATTTCAACATATATATGATGG - Intergenic
1134415097 16:14036632-14036654 ATATTTCAACATATATATGATGG - Intergenic
1135309856 16:21396902-21396924 AAGTTTTAACATATGAATCTTGG + Intergenic
1135337531 16:21615964-21615986 AATTTTTAGCATTTCTATGGGGG + Intronic
1135362749 16:21829002-21829024 AAGTTTTAACATATGAATCTTGG + Intergenic
1135568139 16:23527905-23527927 AAATTTCAACATATGAATTTAGG - Intronic
1135835096 16:25818177-25818199 AAATTTCAACATATGGATTTTGG - Intronic
1135836751 16:25832776-25832798 AAATTTTAAAATATGGATAAAGG - Intronic
1136149437 16:28337224-28337246 AAGTTTTAACATATGAATCTTGG + Intergenic
1136306601 16:29376026-29376048 AAGTTTTAACATATGAATCTTGG + Intergenic
1136681313 16:31965066-31965088 AAATTTAAACATATATAATGTGG + Intergenic
1137541642 16:49366683-49366705 AAAACTTAAAATATGTAAGGAGG - Intergenic
1137699343 16:50485242-50485264 AGATTTTAACATATGAATTTTGG - Intergenic
1137732530 16:50699325-50699347 CAATTTTCACATCTATATGGTGG + Intronic
1138018895 16:53458578-53458600 AAATTTGAATATTTGGATGGTGG + Intronic
1138310499 16:56019472-56019494 AAATTCTGGCATATGCATGGGGG - Intergenic
1138362507 16:56443535-56443557 AAATTTCAACATGAGTTTGGGGG - Intronic
1138488047 16:57359271-57359293 ACATTTTAAAAAATGGATGGTGG - Intronic
1139797966 16:69498331-69498353 AAATGCTAACATAAGGATGGGGG + Intergenic
1140213769 16:72991270-72991292 AAATTTTATCATAGGCATGTAGG + Intronic
1140625058 16:76783549-76783571 AATTTAAAAAATATGTATGGTGG - Intergenic
1141270249 16:82533096-82533118 AAATTTCAACATAATTATGTTGG - Intergenic
1141315363 16:82957494-82957516 AAATTTTATCATTTGTAAAGAGG - Intronic
1141511170 16:84513123-84513145 AAATTTTAAAATCCCTATGGCGG + Intronic
1142825691 17:2508724-2508746 AAATGTTCACATTTGCATGGGGG - Intronic
1144009230 17:11130167-11130189 AAATTTTAACAGCTTTATTGAGG - Intergenic
1144499682 17:15774896-15774918 AAATATTGACATATGTATGTTGG + Intergenic
1144523975 17:15974268-15974290 CAAATTTAAAATATGTAAGGAGG + Intronic
1144602976 17:16635207-16635229 ACATTTTATCATTTGTATTGTGG + Intronic
1148981681 17:51581824-51581846 AGATTTCAACATATGAATGTTGG - Intergenic
1149330529 17:55576682-55576704 AAAATTCAAGACATGTATGGAGG - Intergenic
1149894126 17:60415805-60415827 TAATTTTAAGATATGCTTGGTGG + Intronic
1150892696 17:69172262-69172284 AAATTTAAACATATATATTTTGG - Intronic
1150907330 17:69351842-69351864 AGATTTTAACATATGAATTTTGG - Intergenic
1151006999 17:70449197-70449219 AAGTTTCAACATATGAATGTTGG + Intergenic
1152345652 17:79749064-79749086 CAATTTTAATATATTTATGCTGG + Intergenic
1154029001 18:10733926-10733948 AAATTTTACCATATATATCAGGG + Intronic
1155619942 18:27767227-27767249 AGATTTTAACATATATATTTGGG + Intergenic
1156140405 18:34101792-34101814 ATATTTTAACATAATGATGGGGG - Intronic
1156425315 18:37004881-37004903 AAATTGTGATATATGTATGATGG + Intronic
1156909260 18:42391437-42391459 TCATTTGATCATATGTATGGAGG + Intergenic
1156952959 18:42926764-42926786 AAATTTTAAAGTATGTATGCTGG - Intronic
1157052825 18:44188301-44188323 AAATTTTAAGATGTTTATTGAGG + Intergenic
1157493653 18:48140449-48140471 CAATTTTATCATATGTCAGGCGG - Intronic
1157773591 18:50373122-50373144 ACAACTTAAAATATGTATGGAGG + Intergenic
1158429811 18:57375303-57375325 AGATTTCAACATATGCATTGGGG - Intergenic
1158501437 18:58005683-58005705 AAATTATACCATATGCCTGGAGG - Intergenic
1158950928 18:62494073-62494095 AACTTTTATCATAGGTATGTAGG + Intergenic
1159457789 18:68683942-68683964 AAACTTTATCATAAGTATGTAGG + Intronic
1159993449 18:74938508-74938530 AAATTTTAAAAAATGGTTGGAGG - Intronic
1164297914 19:23931519-23931541 AAATTTTATGATATTTTTGGTGG + Intronic
1166264100 19:41666400-41666422 AAATTTTAAGAATTGTTTGGTGG + Intronic
1166796991 19:45432540-45432562 AAAATTTAAAAAATGTATTGAGG - Intronic
925496063 2:4450751-4450773 AAATTTCAACATAAATTTGGAGG - Intergenic
925708227 2:6711212-6711234 AATATTTTAAATATGTATGGGGG + Intergenic
925857277 2:8141679-8141701 AACTTTTAAAATATGTTGGGTGG + Intergenic
926396424 2:12447258-12447280 AGGTTTCAACATATGAATGGGGG - Intergenic
927919384 2:26960486-26960508 ACATTTTAAGATAAGGATGGTGG - Intergenic
928564265 2:32527691-32527713 TATTTTTTACATATGTAAGGAGG - Intronic
928613095 2:33009998-33010020 AAATTTTGACATTTGGAGGGTGG + Intronic
929005942 2:37392849-37392871 AAATTTTACCATATGTTAGAGGG - Intergenic
929336543 2:40754236-40754258 ACATTATATCATATGTTTGGAGG - Intergenic
930040577 2:47119893-47119915 AAATTGTAAATTATATATGGAGG + Intronic
930472174 2:51830773-51830795 AAATTTTATCATTTCTCTGGAGG - Intergenic
931110268 2:59103004-59103026 AAATTTCAACATATGAATTTTGG - Intergenic
931703823 2:64930320-64930342 ACATTGTAACATATGCATAGTGG + Intergenic
931985368 2:67736511-67736533 AGACTTTAACATATAGATGGGGG + Intergenic
932473818 2:71986993-71987015 AAATTTTAACACATCTCTGTTGG + Intergenic
933324133 2:80814778-80814800 AAATCTTAAAATATTTAGGGAGG + Intergenic
933417977 2:82011488-82011510 CAATTTTCACATAGGTATGTGGG - Intergenic
933658904 2:84910468-84910490 GTATTATAACATATATATGGTGG + Intergenic
933827389 2:86175241-86175263 CAGTTTTAACATTTATATGGAGG - Intronic
934785595 2:97003336-97003358 AAATGTTAACAAAGATATGGGGG - Intronic
935090089 2:99886824-99886846 AATTTTTACCATATGTATTTAGG + Intronic
935708313 2:105875496-105875518 GGATTTCAACATATGAATGGGGG - Intronic
937379603 2:121364642-121364664 AACTCTTAACATATGTAGGGGGG + Intronic
937958781 2:127438838-127438860 TAATTTTAAATTATGTATGTGGG + Intronic
939169090 2:138673392-138673414 AATATTTTACATATTTATGGGGG + Intronic
939326278 2:140693605-140693627 AAATTTTAAAATGTTTATGAAGG - Intronic
939565149 2:143778444-143778466 GAATTTTAACATAGGTTTCGTGG + Intergenic
939576184 2:143898088-143898110 AAAATTTAACATATATATGCTGG + Intergenic
940163871 2:150746122-150746144 AAATTTTAATAGATGTATAATGG - Intergenic
941039307 2:160602467-160602489 AAATTTTAAGATAGATGTGGAGG + Intergenic
941311522 2:163938228-163938250 CAAATTTAAAATATGTAAGGAGG + Intergenic
941574670 2:167215352-167215374 ATATTTCAAAATATGTGTGGTGG - Intronic
941756438 2:169191509-169191531 AATTTTTAATATTTTTATGGAGG - Intronic
942850873 2:180484002-180484024 AAATTTTAACATGAGTTTGGAGG + Intergenic
943126379 2:183797650-183797672 GAATTTTAACATATGAATTTTGG - Intergenic
943143174 2:184008684-184008706 AACTTTTATCAAATGTATTGTGG - Intergenic
943400943 2:187410242-187410264 ACATTTTAAAATATTAATGGGGG + Intronic
943537125 2:189166611-189166633 TAATTTTAACATTTGGATTGTGG + Intronic
943926206 2:193783746-193783768 AAGTTGTAACATATGTATAATGG + Intergenic
943930433 2:193844204-193844226 CAATTTTTGCAAATGTATGGTGG - Intergenic
943933115 2:193880392-193880414 AAATTTTAATATAATTATGGAGG + Intergenic
944489438 2:200242951-200242973 TAATTTTAACATATGTTTATTGG + Intergenic
945447967 2:209960518-209960540 AAATTTTAACGTATCTATAAAGG + Intronic
945593625 2:211765395-211765417 ACTTTTTAAAATATGTAAGGAGG - Intronic
945890230 2:215422985-215423007 AACATTTAATATATGTATGACGG - Intronic
945956487 2:216091169-216091191 AAATTTCAACATATGGATTTGGG - Intronic
946550416 2:220795211-220795233 AAGTTTTAACACATGTATTTTGG - Intergenic
946730926 2:222708517-222708539 ACCTTTTAAAATATGTATAGAGG + Intronic
946741504 2:222806981-222807003 AAAATGTAACATTTGTATGCTGG + Intergenic
947015040 2:225610065-225610087 AAATTTGAAGAAATGAATGGAGG - Intronic
947121735 2:226822715-226822737 AAATTTCAACATATGAATTTTGG - Intergenic
948392798 2:237624979-237625001 AGGTTTTGACATATGAATGGGGG - Intergenic
948971832 2:241434549-241434571 TAACTTTAAAATATGTATGTGGG + Intronic
1168906016 20:1404453-1404475 AAATTTCAACATATGAATTTGGG + Intergenic
1168915317 20:1480591-1480613 AAATTTAAACATACGCATGCAGG + Intronic
1169215646 20:3793155-3793177 ATATTTTAAATTATGTATGTGGG + Intronic
1169787722 20:9378241-9378263 AAATTTAAAAATATGTTTGTTGG - Intronic
1170148448 20:13202948-13202970 AGAACTTAACATATGTAAGGAGG + Intergenic
1170194801 20:13679037-13679059 AAATGTTAACAGATCTATGGAGG - Intergenic
1170576285 20:17664039-17664061 AAATTTCATCATAGGTATGTAGG - Intronic
1171137014 20:22703966-22703988 AAATTTTAATAGGTGTGTGGTGG + Intergenic
1172285235 20:33735612-33735634 AAATTTAAACAAATGCAGGGTGG - Intronic
1172480011 20:35265718-35265740 TAATTTTAATATATTTTTGGGGG - Intronic
1174530452 20:51208654-51208676 AAATGTTAACAGATGCATGAAGG + Intergenic
1175561791 20:59936885-59936907 ACATATTAAAATATGTTTGGGGG + Exonic
1177283061 21:19010120-19010142 ACATTTTAACAGCTGTATAGGGG - Intergenic
1177323708 21:19556237-19556259 AAAATTTATCATGTATATGGGGG + Intergenic
1177783359 21:25643089-25643111 AGATTTCAACATATGAATGTGGG + Intronic
1177828488 21:26109737-26109759 ATGTTTTCACATTTGTATGGTGG - Intronic
1178221233 21:30662361-30662383 AAATTTTAATATATGAATTTTGG - Intergenic
1178326728 21:31652352-31652374 AAACTTTAACATATGTATTTGGG + Intergenic
1178733653 21:35129501-35129523 GAATTTTAACATATGAATGGGGG + Intronic
1178786775 21:35661060-35661082 AAATTTAAAAATATATATGAAGG - Intronic
1179583336 21:42358992-42359014 CAAATTTAAAATATGTAAGGGGG - Intergenic
1182676833 22:32045672-32045694 AAATTCTAAAATATGATTGGAGG - Intronic
1182767804 22:32771302-32771324 GAATTTTAACATCTCCATGGTGG - Intronic
1184196056 22:42929312-42929334 AAATTTTAGCCTCTGTATGTGGG - Intronic
1184815660 22:46867431-46867453 TATTTTTTACATATGTAAGGAGG - Intronic
1184912001 22:47541610-47541632 AAAATTTAAAATGAGTATGGTGG + Intergenic
950955149 3:17045346-17045368 ATTTTTTAACATGTGTTTGGGGG - Intronic
951061672 3:18215688-18215710 AGATTTTAACATATGAATTTGGG - Intronic
951424188 3:22523733-22523755 TAATTTTAAAAAATGTATTGTGG + Intergenic
952236808 3:31488441-31488463 AAGTTTCAACATATGAATTGGGG - Intergenic
952547294 3:34433893-34433915 TAATTTTAACAAATGAATGTAGG + Intergenic
952769323 3:36983420-36983442 GCATTTCAACATATGAATGGGGG - Intergenic
953050139 3:39333668-39333690 ATATTTTTGCATATGTAAGGAGG - Intergenic
953060401 3:39423494-39423516 AAATTTTAAAACGGGTATGGAGG + Intergenic
953299492 3:41757972-41757994 TAAGTTTAACATATGAATGGGGG - Intronic
953670787 3:44960136-44960158 AAATTTGAACATATCTATTGAGG - Intronic
953747708 3:45587729-45587751 GGATTTTAACATATGAATGTTGG - Intronic
954063082 3:48085470-48085492 AAATTTTAACAAAGGGATGCTGG + Intronic
955100156 3:55841051-55841073 ATATTTTGACATATGGATGCAGG - Intronic
955105383 3:55892899-55892921 AGATTTCAACATATGAATTGTGG - Intronic
955965294 3:64382871-64382893 AAGTTTCAACATATGAATTGGGG - Intronic
956959792 3:74385770-74385792 ATATTATAAAATATGTATGCAGG + Intronic
956964349 3:74441677-74441699 AAATCTAAACATATGTCTGTTGG + Intronic
957318050 3:78593306-78593328 GAATTTTAACATATGAATTCAGG + Intergenic
957432724 3:80133481-80133503 GAATTTCAACATATGAATGTTGG + Intergenic
957688975 3:83542819-83542841 AAATTCTAATATTTGTGTGGAGG - Intergenic
957932630 3:86901159-86901181 AAATTTTATTGTATATATGGGGG + Intergenic
957988421 3:87599753-87599775 AAATTTTAACATATTTGTCATGG - Intergenic
958455171 3:94322101-94322123 AATTTTTAACATAGATATTGAGG - Intergenic
958483090 3:94669449-94669471 AAATATCAACATAGGTTTGGAGG - Intergenic
958701102 3:97591360-97591382 AAATTTTAACTTATTTTTGGTGG + Intronic
958891309 3:99786262-99786284 ATATTTTAACATATGAATTTGGG - Intronic
959248427 3:103906065-103906087 AAATTTTAGTATTTCTATGGGGG + Intergenic
959519136 3:107305978-107306000 GAATTTCAATATATGAATGGCGG + Intergenic
959805221 3:110543308-110543330 AAATATTAACATCAGAATGGTGG - Intergenic
959848921 3:111065462-111065484 GAAATTTTACATATGGATGGAGG - Intergenic
959874713 3:111368984-111369006 GAGTTTTAACATATGAATTGGGG + Intronic
960032015 3:113063582-113063604 AGATTTCAACATATGAATGTGGG + Intergenic
960695639 3:120393705-120393727 CAATTTTAACATATGAATTTTGG - Exonic
960932358 3:122866374-122866396 AAATTTAAATACATGTAGGGAGG - Intronic
963265641 3:143237782-143237804 AAATCTTAACTAATGTGTGGTGG - Intergenic
963425783 3:145121151-145121173 AAATTATCAAATATGTATGAAGG + Intergenic
964033743 3:152170053-152170075 AGATTTTAACATATGAATTTTGG + Intergenic
965013815 3:163130639-163130661 GAATTTTTTCATATGTTTGGTGG - Intergenic
965156257 3:165060899-165060921 AACTTTTTACATATGTATCATGG - Intronic
965292097 3:166895976-166895998 AAATTTTTGCATATTTCTGGAGG - Intergenic
965434459 3:168631897-168631919 GAATTTTAAAATATGTAGTGTGG - Intergenic
965468155 3:169058276-169058298 CAAATTTAACATTTGTGTGGAGG - Intergenic
965817015 3:172647419-172647441 AAATGTTAACATGTGTATTAAGG + Intronic
965842997 3:172928812-172928834 AAATTTAACCATATGTATATAGG - Intronic
966105479 3:176327770-176327792 AATATTTTACATATTTATGGGGG - Intergenic
966116674 3:176471920-176471942 AAATTTTAAGATAATTATGCTGG - Intergenic
966367837 3:179209826-179209848 AAATTTTAATAAATGTATCATGG + Intronic
966684329 3:182677417-182677439 AAATTTTAACAACTTTCTGGTGG + Intergenic
967129014 3:186453480-186453502 AAATTTCAACACATGAATTGGGG - Intergenic
968786009 4:2622867-2622889 AAATTTCAACTTATGAACGGGGG + Intronic
969941839 4:10739949-10739971 AATTTTTAAAATGTGTATGTAGG - Intergenic
969953909 4:10868335-10868357 AATTTTTAAAATATGTTTGTTGG + Intergenic
969962463 4:10959143-10959165 ACAATTTAAAATATGTAAGGGGG + Intergenic
970763572 4:19519213-19519235 AGATTTTAACATATTTATTTTGG + Intergenic
971566758 4:28153709-28153731 AAATTTTACCAAATGTATTTAGG + Intergenic
971670530 4:29549755-29549777 AGATTTTGACAAATGTATGCTGG + Intergenic
971813083 4:31452932-31452954 AAATTTAAAAATAGGTGTGGTGG - Intergenic
971862447 4:32125444-32125466 AAATTGTAACAGAAGGATGGGGG + Intergenic
971987222 4:33841743-33841765 TAAATTTAACCTATTTATGGGGG + Intergenic
972074627 4:35070577-35070599 AATTATCAACATATGTATGCAGG - Intergenic
972131840 4:35846414-35846436 AAATTTTTACATATATTTGTTGG + Intergenic
972207326 4:36791411-36791433 AATTTTTAAAATATTTTTGGGGG + Intergenic
972257374 4:37371756-37371778 AAATGTTAAAATATGTATTCAGG + Intronic
972339940 4:38143393-38143415 ATATTTGAACACATGAATGGAGG - Intergenic
972662169 4:41126950-41126972 ACATTTTAACATATGAATTTTGG + Intronic
972933803 4:44106303-44106325 AAATTGTAACATATGTGTAATGG - Intergenic
973220661 4:47722696-47722718 AAATTTTAAGATACGTATTTCGG - Intronic
973290230 4:48463741-48463763 AGATTTTAACATATGAATTTTGG + Intergenic
973677756 4:53283815-53283837 TAATTTTAAAATATGCATGTAGG + Intronic
974278697 4:59760741-59760763 AAATTTTAAAATATTAATAGAGG - Intergenic
974796127 4:66752483-66752505 GGATTTTAACATATGAATTGTGG + Intergenic
974821759 4:67075661-67075683 AAATTTCAACATATGAATTTTGG - Intergenic
974845720 4:67349009-67349031 AAATTTTAACATGAGTTTGGTGG + Intergenic
975074942 4:70194515-70194537 CAAACTTAAAATATGTATGGAGG + Intergenic
976129504 4:81870116-81870138 AGATTTCAACATATGAATGCTGG - Intronic
976668761 4:87628641-87628663 AAATTTCAACAAATGAATGGGGG - Intergenic
976693785 4:87896794-87896816 GAATTTTTACATATCTATGTAGG + Intergenic
976783971 4:88796434-88796456 AAAATTTCACATATGTATATAGG + Intronic
977421284 4:96803180-96803202 AAATTTCAACATATAAATGTTGG - Intergenic
977441277 4:97070861-97070883 GGATTTTAACATATGAATGCAGG - Intergenic
977645040 4:99402527-99402549 GAATTTTAACATATGAGTGCTGG + Intergenic
978134920 4:105245679-105245701 AAATTTTTAAAAATGTATGTAGG + Intronic
978204432 4:106063650-106063672 AGATTTTAACATATGAATTTGGG - Intronic
978246638 4:106580348-106580370 GAATTTTAATATATGAATGTTGG - Intergenic
978334675 4:107653490-107653512 AAATTTAAAGATATGAATGCTGG - Exonic
978648282 4:110968798-110968820 AAATTCTAAAATTTTTATGGAGG + Intergenic
979003921 4:115264291-115264313 AAATTTCAACATATATTTTGTGG - Intergenic
979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG + Intronic
979354649 4:119688826-119688848 ACATTTTAAAACATGTATGTTGG + Intergenic
979538164 4:121848619-121848641 AAATTTTATCATAGGCATGTAGG + Intronic
979727074 4:123974908-123974930 AAGATTTAACATATGAATTGGGG - Intergenic
979731189 4:124024431-124024453 AAATTTTAACATATAAATGCTGG - Intergenic
979983925 4:127292252-127292274 AGATTTTAACATATGAATTTTGG - Intergenic
980001595 4:127496076-127496098 AAATTGTGACATATTTTTGGTGG + Intergenic
980225681 4:129981231-129981253 ATATTCTAACATTTGTTTGGTGG + Intergenic
980567679 4:134565444-134565466 CCATTCTAACATATGTGTGGTGG + Intergenic
980594549 4:134936217-134936239 GGATTTTAACATATGAATGCAGG - Intergenic
980772715 4:137397987-137398009 AAATTTTCACATAGCTTTGGAGG + Intergenic
980785477 4:137548672-137548694 AAAGTGTAACATTTGTATTGTGG - Intergenic
980796669 4:137693335-137693357 AAATTTTATAATATGTAACGAGG - Intergenic
981175250 4:141675336-141675358 AAATGTAAACAAATATATGGAGG + Intronic
981361119 4:143846628-143846650 AGATTTTAAAATATGTTTTGTGG - Intergenic
981371856 4:143967626-143967648 AGATTTTAAAATATGTTTTGTGG - Intergenic
981398962 4:144289243-144289265 AAGTTTAAAAAGATGTATGGTGG + Intergenic
981657047 4:147123817-147123839 TAAGTCTAACATATGTATGTAGG - Intergenic
982237076 4:153261574-153261596 AAATTTTAACATGTGATTTGTGG - Intronic
982345642 4:154354932-154354954 AAATTTTCACTTAGGAATGGGGG - Intronic
982429810 4:155309930-155309952 AAATTTCAACATGAGTTTGGAGG - Intergenic
982791763 4:159600405-159600427 AAATTTTAACATATGGCTTAAGG + Intergenic
983044082 4:162965265-162965287 AATTTTTCACAAGTGTATGGTGG + Intergenic
983732013 4:171007630-171007652 AAACTTTATCATAGGTATGTAGG + Intergenic
984081780 4:175255831-175255853 AAATTTGAAAATATTTTTGGGGG + Intergenic
984232931 4:177121139-177121161 AGTTTTTAACATATGTTTGAGGG + Intergenic
984252856 4:177355198-177355220 AATTTATAACATATAAATGGAGG + Intronic
984605073 4:181775801-181775823 ATATTTGTACATATTTATGGGGG + Intergenic
986022285 5:3815538-3815560 GGATTTCAACATATGAATGGTGG + Intergenic
986324007 5:6658022-6658044 GAATTTTAAAATGTGAATGGAGG + Intronic
986416401 5:7532425-7532447 AAGTTTTAAAATATGTAAAGTGG - Intronic
986694745 5:10341629-10341651 AGATTTTAACATATGAATTTTGG + Intergenic
987021226 5:13874202-13874224 ACATATTCACATATGTATGATGG + Intronic
987478512 5:18422628-18422650 AAAGTGTAACATATGCATGATGG + Intergenic
987898140 5:23976313-23976335 AATTTTTATAATATGTGTGGGGG + Intronic
988069222 5:26266005-26266027 TAATTTTAAAATTTGTATGTGGG + Intergenic
988180813 5:27789313-27789335 CAAATTTAAAATATGTAAGGAGG - Intergenic
988354077 5:30150682-30150704 AAATTTGATCCTCTGTATGGGGG - Intergenic
988405308 5:30816665-30816687 GAATTTTTACATATGTTTGCTGG + Intergenic
988689208 5:33555550-33555572 GAATGTTAAAATTTGTATGGGGG - Intronic
989287882 5:39724067-39724089 AAATTGTAATGTATGTATAGTGG + Intergenic
989291909 5:39777435-39777457 AAATTTCAACATATGAATTTTGG - Intergenic
989548768 5:42707222-42707244 AAAATTTAAAATGTGTTTGGGGG - Intronic
990530778 5:56671331-56671353 AATTTTTAACAAATGTGTTGGGG - Intergenic
990871719 5:60439146-60439168 GAATTTAAACAAATGTTTGGTGG - Intronic
990896745 5:60707808-60707830 AAATTTTAAAAAATGGATAGTGG + Intergenic
991620690 5:68542582-68542604 AACTTTTAACAAATTTATTGAGG - Intergenic
991943274 5:71875759-71875781 AAGTTTTAACATATGAATATTGG - Intergenic
991948253 5:71922572-71922594 AATATTTTACATATTTATGGAGG - Intergenic
992149200 5:73885419-73885441 ATATTTTAACATTTTTTTGGTGG + Intronic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993441861 5:87966903-87966925 CAATTTTATCATATGTAAAGTGG + Intergenic
993822344 5:92634032-92634054 AAATGTAAACATCTTTATGGTGG + Intergenic
994304996 5:98192324-98192346 GAATTTTAACATATGAGTGAGGG + Intergenic
994495703 5:100509902-100509924 AAATTATAAAATATGGATTGAGG + Intergenic
994570487 5:101507449-101507471 ACATTTTATCAGAGGTATGGAGG - Intergenic
994667229 5:102720124-102720146 AAATTCTAACATATGAATGTTGG + Intergenic
994812182 5:104534115-104534137 ATATTTTAACATATTTATTGAGG + Intergenic
994822616 5:104673434-104673456 AACTTTTAAATTATGTATGTTGG - Intergenic
994988850 5:106972583-106972605 AAATACTTACATATGTAGGGAGG - Intergenic
994994103 5:107037489-107037511 ATATTTATACATATGTATGGGGG - Intergenic
995102061 5:108323909-108323931 AATTTTTAACATATGGATCAAGG - Intronic
995568079 5:113452333-113452355 AAGTTTTAACATATGAATTTGGG - Intronic
995836036 5:116400329-116400351 AAATATTCTCATATGTGTGGTGG + Intronic
995957558 5:117796379-117796401 AATTTTTGCCATGTGTATGGAGG - Intergenic
995987714 5:118200019-118200041 TAAGTTTAACATATGAATGGCGG - Intergenic
996210361 5:120801064-120801086 AAATATTAACTAATGTATGTAGG + Intergenic
996643339 5:125785549-125785571 AAGGTATAACATATGTATAGTGG - Intergenic
996761119 5:126986891-126986913 AAATTTCAACAAATTTCTGGAGG + Intronic
997092666 5:130875657-130875679 AAGTTTTAACATATGTTTTGTGG - Intergenic
998439636 5:142146905-142146927 AAATTTAAAACTATGTATGTGGG + Intronic
998666148 5:144299763-144299785 GATTTTTAACATCTTTATGGAGG + Intronic
999235796 5:150092810-150092832 AAACTTTATCATAGGTATGTAGG - Intronic
999652972 5:153785282-153785304 AAGTTTAAACACATTTATGGGGG - Intronic
999909253 5:156179592-156179614 AAATTATAACATATTCATTGGGG - Intronic
999934242 5:156468186-156468208 AAAAATTAAAATATGCATGGTGG + Intronic
1000101568 5:158021980-158022002 AAATGTTAACATATGAAGAGAGG + Intergenic
1000221676 5:159220390-159220412 AGATTTTAACATATGAATTTTGG - Intergenic
1000249533 5:159480936-159480958 AAATTATATACTATGTATGGAGG + Intergenic
1000682933 5:164209190-164209212 AGATTTTGACATAAGGATGGAGG + Intergenic
1000689196 5:164293875-164293897 AAATTTCAACATGAGTTTGGTGG - Intergenic
1001465587 5:171962341-171962363 AAATTATAACAAATGTATCTTGG - Intronic
1001733945 5:173983080-173983102 AAGATTTAACATATGTGTAGTGG + Intronic
1001739610 5:174041325-174041347 ATAATTGTACATATGTATGGAGG + Intergenic
1002558971 5:180067668-180067690 AAATTTTAACATAAATAGGCTGG - Intronic
1005435177 6:25802115-25802137 AATTTTTAATATTTTTATGGGGG - Intronic
1005600400 6:27421169-27421191 AGATTTGAACAAATGTATAGTGG - Intergenic
1007597178 6:43058561-43058583 AATTCTTCACATATGAATGGAGG + Intronic
1008192202 6:48474187-48474209 AAATTTGAACATATTCATGAAGG - Intergenic
1008371981 6:50743152-50743174 CAATTTTAATATCTGTGTGGTGG - Intronic
1008416189 6:51243559-51243581 AAATTTTAAAAAATGGATGTTGG + Intergenic
1008600624 6:53090604-53090626 ACATTTTAACATAAGTTTGAGGG + Intronic
1008977653 6:57446695-57446717 AAATTTCAACACAGGAATGGAGG + Intronic
1009040398 6:58169465-58169487 ATATTTTAATATATATATAGGGG + Intergenic
1009165791 6:60339642-60339664 AAATTTCAACACAGGAATGGAGG + Intergenic
1009216255 6:60924002-60924024 ATATTTTAATATATATATAGGGG + Intergenic
1010260594 6:73811497-73811519 CAGTTTTATCATATGTATGATGG - Intronic
1010588932 6:77689966-77689988 AAATATAAACATACTTATGGAGG - Intergenic
1010729983 6:79380964-79380986 GGATTTCAACATATGAATGGGGG + Intergenic
1011059239 6:83244704-83244726 GAATTTTAAAACATGTATTGAGG + Intronic
1011681176 6:89784806-89784828 AAATTTTAAGAGATGTATGCTGG + Intronic
1011781419 6:90794047-90794069 ACTTTTTAACCAATGTATGGGGG - Intergenic
1011915239 6:92496489-92496511 AAATTTCAACATAAGCTTGGTGG - Intergenic
1011929519 6:92692923-92692945 AAAACTTAAAATTTGTATGGAGG - Intergenic
1012329185 6:97962967-97962989 AAATATTTAAAAATGTATGGAGG - Intergenic
1012843510 6:104360988-104361010 TAAACTTAACATATGTAAGGAGG + Intergenic
1012882729 6:104810575-104810597 ATATTTTTACATATGTGTGTGGG + Intronic
1013160663 6:107541323-107541345 ACATTTCAACATATTTATGAAGG - Intronic
1013777117 6:113690566-113690588 AAGTTTTAAGAAATGTATGATGG + Intergenic
1014644703 6:123958631-123958653 AAATTTCAACATATGAATTTTGG + Intronic
1014713119 6:124832249-124832271 AAATTATAAAATAGGAATGGAGG + Intergenic
1015776385 6:136818986-136819008 AAATTTCAACATATGAATTTGGG + Intergenic
1016526472 6:145007102-145007124 GGATTTTAACATATGAATGGGGG - Intergenic
1016644631 6:146392108-146392130 AAAGTTTAAAATGTGTTTGGTGG + Intronic
1016663045 6:146603130-146603152 AAATTTTAAGATGTGTATTTTGG + Intronic
1017023017 6:150156418-150156440 AAATATTAACAGATGATTGGCGG - Intronic
1017059940 6:150473328-150473350 ACATTTTCTCATATGTATGTTGG + Intergenic
1017413012 6:154189414-154189436 AAATTCTTACATATGTATTTTGG - Intronic
1018449042 6:163888988-163889010 AAATAATAACATATGTATTCAGG + Intergenic
1018466402 6:164050127-164050149 TATTTTTAAAATTTGTATGGTGG + Intergenic
1018519297 6:164628437-164628459 TATTTTTTACATATATATGGTGG + Intergenic
1020366604 7:7387108-7387130 AAATTTCAACATATGAATGTGGG + Intronic
1020876853 7:13707488-13707510 AAGTTTTAAAATTTGTATGGTGG - Intergenic
1020883117 7:13787867-13787889 AAATTTTAGCAAATGTATTTTGG - Intergenic
1021068318 7:16204671-16204693 AAAGTTTGACTTAGGTATGGTGG - Intronic
1021134053 7:16944263-16944285 AAATTCTATCATATGTAAAGAGG - Intergenic
1021251472 7:18332051-18332073 AAATTTAAACATCTGAATGACGG - Intronic
1021298217 7:18936237-18936259 AAACTTTAAAAAATGTCTGGAGG + Intronic
1021436481 7:20623234-20623256 CAATTTTAACAAATGTATTATGG - Intronic
1021489839 7:21207703-21207725 CAGATTTAAAATATGTATGGTGG + Intergenic
1021872993 7:25021927-25021949 AAAATTTAACGTATATCTGGGGG - Intergenic
1022017542 7:26364405-26364427 AAATATAAATATATGTTTGGTGG + Intronic
1022668373 7:32431910-32431932 ATATTTCAACATATGAATGAGGG + Intergenic
1024614074 7:51093259-51093281 ACATTTTTTCATATGTATGTTGG - Intronic
1024711507 7:52019987-52020009 AAATTTTGACTTTTGTTTGGTGG + Intergenic
1025214341 7:57043257-57043279 TAATTTTAGCAGATGCATGGAGG - Intergenic
1025270477 7:57508176-57508198 ATCTTTTAACAAATGTGTGGGGG + Intergenic
1025657612 7:63533556-63533578 TAATTTTAGCAGATGCATGGAGG + Intergenic
1027335992 7:77151262-77151284 AAATTTTAGCATATGAATATTGG + Intronic
1027890950 7:83974142-83974164 AAATCTTAATATATGTGTGCTGG - Intronic
1028134938 7:87215389-87215411 AAATTTTAAACTAGGCATGGTGG - Intronic
1028254612 7:88578495-88578517 AATTTTTAACAGATTTATTGAGG + Intergenic
1028289117 7:89043659-89043681 ACATTTTAACAAATGTACTGTGG + Intronic
1028331460 7:89599940-89599962 AAGTTTTAACATATGAATTTTGG - Intergenic
1028765340 7:94551012-94551034 AAATTTTATCATATGTCTGTAGG + Intronic
1029779794 7:102719834-102719856 AAATTTTAGCATATGAATATTGG - Intergenic
1030413912 7:109215802-109215824 AGACTTCAACATATGAATGGGGG - Intergenic
1030605965 7:111639485-111639507 GGATTTCAACATATGAATGGAGG - Intergenic
1030700530 7:112633916-112633938 ACATTTTTAAAAATGTATGGAGG + Intergenic
1030786951 7:113674240-113674262 AAATTTTAACATATGAATTTTGG - Intergenic
1030898380 7:115090098-115090120 AAATTTTAAAATATGCATCTTGG - Intergenic
1030935406 7:115580030-115580052 AAATTTTGACATAATTTTGGAGG - Intergenic
1031551523 7:123119810-123119832 AAATGTTAATATATGAATGTGGG - Intronic
1031967822 7:128040568-128040590 AAATTTTAGCATCTGTAAAGTGG + Intronic
1032362543 7:131269525-131269547 AAGTTTTAACATATAAATGTGGG + Intronic
1032757151 7:134901959-134901981 AGACTTTAACATATATTTGGAGG + Intronic
1032996842 7:137456243-137456265 AAATTTGAATATAAGTATGCTGG - Intronic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1033596336 7:142862260-142862282 GGATTTCAACATATGAATGGAGG + Intronic
1034071787 7:148193347-148193369 AAATTTTAACATATATGTGTGGG - Intronic
1035819962 8:2580432-2580454 ACATTTTAACATAAGGATTGAGG - Intergenic
1036015896 8:4784047-4784069 AAACTTTAACATATTTTTGAGGG + Intronic
1036559727 8:9891251-9891273 GGATTTCAACATATGAATGGCGG - Intergenic
1038092581 8:24270408-24270430 ACATTTTCTCATATGTCTGGTGG - Intergenic
1039216490 8:35277810-35277832 AAAATTTTGCTTATGTATGGGGG + Intronic
1039485510 8:37906671-37906693 AAATTTAAAAATAGGGATGGGGG - Intergenic
1039604928 8:38872427-38872449 ACATTTTAAAATATGGATGATGG + Intergenic
1039639900 8:39207435-39207457 AAATTTTTACGTGTATATGGGGG + Intronic
1039654422 8:39385102-39385124 AAATTTTTATATATTCATGGAGG + Intergenic
1040666816 8:49643377-49643399 GAATTTCAACATATGAATTGAGG + Intergenic
1040778496 8:51076588-51076610 AAATTTTAACATATTAATTTTGG - Intergenic
1040798097 8:51309517-51309539 AAAAGTAAACATATATATGGAGG - Intergenic
1041156518 8:54992627-54992649 ATATTTTAACATATGAATGGCGG + Intergenic
1041627442 8:60046416-60046438 GAAGCTTAACATAGGTATGGAGG + Intergenic
1043127308 8:76415092-76415114 AAACTTTATCATAGGTATGTAGG - Intergenic
1043138533 8:76558416-76558438 AAATTTTAACATATAAATATTGG - Intergenic
1043171907 8:76976368-76976390 AAATTTTTTCATATGTTTGTTGG - Intergenic
1043238658 8:77902327-77902349 AAATTTTAGCCTATGTATCGTGG + Intergenic
1043310617 8:78854613-78854635 AAATTTTAAAACATGTATTCTGG + Intergenic
1043316902 8:78934012-78934034 AAATTTTAACAGCTTTATTGAGG + Intergenic
1043327694 8:79072374-79072396 AAATTTCTTCATATGTTTGGAGG + Intergenic
1043792979 8:84497116-84497138 AAATTCTAAGATATGGATGGAGG - Intronic
1044133490 8:88556582-88556604 GCATTTTAACATATTTATTGTGG - Intergenic
1044152135 8:88794175-88794197 AAATTTCAACATATGAATTTGGG - Intergenic
1044336634 8:90991497-90991519 AAATGTTAACATACGTAAGGTGG + Intergenic
1044341783 8:91054457-91054479 AAATTTTAGCATATGAATTTTGG - Intergenic
1044638673 8:94355307-94355329 AAATTTTAGCCTGGGTATGGTGG + Intergenic
1046176339 8:110580045-110580067 AGGTTTTAACATATGAATGCTGG + Intergenic
1046262579 8:111788356-111788378 AATATTTTACATATTTATGGGGG + Intergenic
1046318632 8:112540696-112540718 AAGTTTTCACTTATATATGGGGG + Intronic
1046568009 8:115925608-115925630 AAAATTAAAAATATGAATGGAGG + Intergenic
1046794775 8:118359097-118359119 ATATTTTAACATATTAATTGGGG - Intronic
1046854763 8:119018566-119018588 AAATCCTAACTTATGTATAGGGG + Intronic
1047131665 8:122027335-122027357 TAATTTTGACTGATGTATGGTGG + Intergenic
1047551900 8:125883184-125883206 AAATTTCAACATATGGATTTTGG - Intergenic
1048087156 8:131195995-131196017 AATTTTTAAAATATGTCTTGAGG - Intergenic
1048893539 8:138968454-138968476 ACATTTTAACATATGTCTCTGGG - Intergenic
1049083760 8:140461980-140462002 AAATTTAAACATATGAATTTGGG + Intergenic
1050445909 9:5722445-5722467 AAATATTTACATGTGCATGGAGG - Intronic
1051157880 9:14170916-14170938 AAATTTTAATATATTGATGTAGG - Intronic
1051224332 9:14883004-14883026 TAATGTTAACATTTGTATGGGGG - Intronic
1051234331 9:14982573-14982595 AAATTTCAACATAAGTTTTGGGG + Intergenic
1051912711 9:22172758-22172780 AAATTTTAAAATTTGTTTGGAGG + Intergenic
1052142765 9:25007562-25007584 TAACTTTACCATATGTATGTGGG - Intergenic
1052471141 9:28899126-28899148 AAATTTTAAAAGATGCATTGAGG + Intergenic
1052891959 9:33709720-33709742 AAATTTTAAAATATGTATTTTGG + Intergenic
1053625285 9:39864404-39864426 AATTTTTAACATAGTAATGGTGG - Intergenic
1054765684 9:69040752-69040774 AGGTTTTAACATATGAATGGTGG - Intronic
1055820806 9:80260675-80260697 AAATTTTAACAAATTTAAGGAGG + Intergenic
1056044041 9:82697648-82697670 AAATTTTAACATTTTTTTGTGGG - Intergenic
1057562284 9:96138132-96138154 AGATTTGAACATATGAATGGGGG - Intergenic
1058098708 9:100893263-100893285 CAAATTTAAAATATGTAAGGAGG - Intergenic
1058921809 9:109624012-109624034 CAATTTTAACAGTTGTATTGTGG - Intergenic
1059098728 9:111448139-111448161 TAATTATACCATATTTATGGGGG - Intronic
1059153921 9:111973322-111973344 AAATTTTTGCAAATGTCTGGGGG - Intergenic
1059577990 9:115512372-115512394 AGGTTTCAACATATGAATGGGGG + Intergenic
1059662235 9:116413363-116413385 AAAGTTTAAGCTAGGTATGGTGG + Intergenic
1061752967 9:132793337-132793359 AGATTTTAACATATGAATTTTGG + Intronic
1185949353 X:4413946-4413968 AAAGTTGAAGATATGTATGAAGG + Intergenic
1186374695 X:8987145-8987167 AAATTGTAACATATGAAGAGTGG + Intergenic
1186995256 X:15114626-15114648 CAGTTTTAAAATATGTATGCAGG - Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187466917 X:19535826-19535848 AAATTTTAGCTTATATATGACGG - Exonic
1187860392 X:23676985-23677007 AAAAATTAAAATAGGTATGGTGG - Intronic
1187892437 X:23948773-23948795 GAATTTCAACATATGAATTGGGG + Intergenic
1188010210 X:25046807-25046829 AAAATTGTACATATTTATGGGGG + Intergenic
1188249236 X:27871878-27871900 CAATTTTAACATATGAATTTTGG + Intergenic
1188274598 X:28184260-28184282 AATTTTTAACATATTTTGGGAGG + Intergenic
1189851291 X:45178702-45178724 AAATTTTTACAAAGTTATGGGGG - Intronic
1190791145 X:53701525-53701547 AAATTTGAACAGATTTATGAAGG + Intergenic
1190791697 X:53706621-53706643 AAATTTGAACAGATTTATGAAGG + Intergenic
1191873858 X:65773928-65773950 AGATTTCAACATATGAATGTTGG - Intergenic
1191876108 X:65798284-65798306 ATATGTCAACATATGAATGGTGG + Intergenic
1192001624 X:67157908-67157930 AAATTTTAACCCATGTATATTGG - Intergenic
1192155397 X:68742468-68742490 AACTTTTAAAATATGTTTGTTGG - Intergenic
1192779055 X:74275934-74275956 AAATTTTAAAACCTGTAGGGAGG + Intergenic
1192861243 X:75074045-75074067 AGATTTTAACAAAAATATGGTGG + Intronic
1193249275 X:79269182-79269204 AAATATAAACATATCTAGGGTGG - Intergenic
1193250429 X:79284186-79284208 GTATTTTAACATACTTATGGGGG + Intergenic
1193754560 X:85391924-85391946 CAAACTTAACATATGTAAGGAGG - Intergenic
1194022268 X:88706031-88706053 CCATTTTAATAGATGTATGGTGG - Intergenic
1194463559 X:94203149-94203171 AAATTTTAACATAAGTTTGGAGG + Intergenic
1194642040 X:96413710-96413732 GGATTTTAACATATGCATTGGGG + Intergenic
1194902796 X:99534990-99535012 AAATTTTACCATAACTATGTAGG - Intergenic
1195199145 X:102530837-102530859 AAAGTTTAACATATGCATAATGG + Intergenic
1195917039 X:109946324-109946346 AGATTGGAACATATCTATGGAGG + Intergenic
1196521185 X:116674176-116674198 AAATTGTGACATATGCATTGTGG - Intergenic
1196666625 X:118324075-118324097 AAATTTTAATATAAGTATGATGG - Intergenic
1197022012 X:121702515-121702537 AATTTTTAAGATTTGTATCGTGG + Intergenic
1198405651 X:136309937-136309959 AATTTTCAACATCTGTATGGTGG + Intronic
1198589516 X:138161589-138161611 AAATTTTAAAATATCTACAGAGG + Intergenic
1198829941 X:140739512-140739534 AAAGTTTCACATGTGGATGGGGG - Intergenic
1198942347 X:141970315-141970337 AAATTTTGACATAAGTATTTTGG - Intergenic
1199441875 X:147877708-147877730 AAATTTTGAAATATATTTGGAGG - Intergenic
1199641237 X:149864176-149864198 AAATTTTTTCATATGTTTGTTGG - Intergenic
1201066179 Y:10096970-10096992 AAATTTTAACAGATGTACAAAGG - Intergenic
1201325991 Y:12759069-12759091 CATTTTTAACATTTGTAGGGGGG + Intronic
1201518250 Y:14841646-14841668 AAATTTAAACATTTTTATGTGGG + Exonic
1201736538 Y:17268891-17268913 AAAGTTGAAGATATGTATGAAGG + Intergenic
1201941393 Y:19464121-19464143 ACATTTTTACATATATATGATGG - Intergenic
1202348492 Y:23961025-23961047 CAATTATAACATGTGTGTGGAGG + Intergenic