ID: 1113810889

View in Genome Browser
Species Human (GRCh38)
Location 13:113141726-113141748
Sequence CGCCTAGGCCCCGCCTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113810889_1113810893 23 Left 1113810889 13:113141726-113141748 CCCTCGAAGGCGGGGCCTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1113810893 13:113141772-113141794 ACCCCACTCCCACTCATAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113810889 Original CRISPR CGCCTAGGCCCCGCCTTCGA GGG (reversed) Intronic
915117413 1:153609396-153609418 CGCCCAAGCCACGCCTCCGAAGG + Intronic
1063067564 10:2624497-2624519 GGCCCAGGCCCTGCCTTCCAGGG + Intergenic
1075039325 10:119095349-119095371 CACCTGTGCCCCGCCTTAGAAGG + Intergenic
1083171124 11:60924606-60924628 CGCCTCGTCCCCGCCTTCTGTGG + Exonic
1097894001 12:64806162-64806184 AGCCTAGCCCCAGCCTTCCATGG - Intronic
1112532770 13:100220954-100220976 CTCCTAGGCCCAGACTTCCATGG + Intronic
1113810889 13:113141726-113141748 CGCCTAGGCCCCGCCTTCGAGGG - Intronic
1124109380 15:26772680-26772702 CGCCTAAGACCCGACTTCGGGGG - Exonic
1128841493 15:70854290-70854312 CTCCGAGGCCCCGCCTGCGCGGG - Intronic
1137585251 16:49660461-49660483 CTCCTAGGCCCCACCTTACAGGG - Intronic
1152714481 17:81891893-81891915 CGCGTAGGCTCCGCCTCCAACGG - Intronic
1153399053 18:4662497-4662519 AGCCTAGGCCCGGCCTTGCACGG + Intergenic
1154299718 18:13182490-13182512 AGCCGAGGCCCCACCCTCGAAGG + Intergenic
1160720378 19:594571-594593 CCCCTGGGCCCCGCCTCAGATGG + Intronic
1160900368 19:1424846-1424868 CGCCTGGGCCCCGCCTCGGGAGG + Intronic
1162439489 19:10683698-10683720 CGCCTCTTCCCCGCCCTCGAAGG - Exonic
1167193001 19:48004780-48004802 GGCATAGGCCCTGCCTTCGTGGG - Intronic
940224989 2:151391757-151391779 CGCCTAGACCCAGCCTTCTGAGG - Intergenic
946770654 2:223085358-223085380 GGCCCAGGCCCCGCCATTGATGG + Intronic
1180184439 21:46132559-46132581 CGCCCGGGCCCCGCAGTCGAGGG + Exonic
1182122596 22:27797442-27797464 CGACTTGGCCCCGCCGTCCAGGG + Exonic
1183328049 22:37205003-37205025 AGTCTAGGCCCAGCCTTGGATGG + Exonic
954932462 3:54296058-54296080 CGCCTTTGCCCAGCCTTGGAAGG + Intronic
958779332 3:98522689-98522711 CGACCAGGCCCCGCCCTAGAGGG + Intronic
968864006 4:3196066-3196088 CGCCTGGTCCCCTCCTTCCAAGG - Intronic
985931159 5:3058774-3058796 CACCCAGGACCCGCATTCGAGGG + Intergenic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1002133562 5:177095432-177095454 CGCCTCGGCCCCACCTTCCTGGG - Exonic
1006305779 6:33217652-33217674 GGCATAGCCCCTGCCTTCGAAGG + Intergenic
1013048558 6:106510832-106510854 CACCTGGGCCCCGCCTTAGCCGG - Intergenic
1014272542 6:119349857-119349879 CGCCTCGGCCCCGCCCCCGCGGG - Intergenic
1018742549 6:166741688-166741710 CTCCAGGGCCCCGCCTTCAAGGG + Intronic
1019650715 7:2156435-2156457 CCCCTAAGCCCCGCCTTCAGGGG - Intronic
1031096516 7:117427283-117427305 AGGCTGGGCCTCGCCTTCGAGGG + Intronic
1039843623 8:41310262-41310284 CGCCTTCGCCTCGCCTTCCAGGG - Intergenic
1049614277 8:143569323-143569345 CGCCCAGGCCCCGCCCTCTCAGG - Intronic
1053488236 9:38478345-38478367 GGCCTAGGCCCAGCCTGCGGTGG + Intergenic
1062313983 9:135956402-135956424 CGCCTAGCCCCCGTGTTCAAAGG - Intronic
1195217077 X:102712833-102712855 CGCCCGCGCCCCGCCCTCGACGG + Intronic
1195221211 X:102746445-102746467 CGCCGGCGCCCCGCCCTCGACGG + Intronic
1198705977 X:139448370-139448392 TGCCTTTGCCCCGCCTTAGAAGG - Intergenic