ID: 1113812092

View in Genome Browser
Species Human (GRCh38)
Location 13:113149174-113149196
Sequence CACCTCCAGCATCTTGAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113812092 Original CRISPR CACCTCCAGCATCTTGAGCC TGG (reversed) Exonic
900371364 1:2333597-2333619 CAGCAGCAGCACCTTGAGCCAGG - Intronic
902050839 1:13562601-13562623 AACCACCAGCTTCATGAGCCAGG + Intergenic
902409650 1:16205538-16205560 CTCCACCAACATCTTGAGGCGGG + Exonic
903764833 1:25727515-25727537 CACCCCCAGCCTCTGGAGCCTGG - Intronic
904286526 1:29456237-29456259 CACCTGCAGCAGCTCCAGCCAGG - Intergenic
907333196 1:53684652-53684674 CACATCCAGGCTCTTCAGCCTGG + Intronic
907777928 1:57536910-57536932 CATCCCCAGCATCTGGTGCCAGG - Intronic
908910898 1:69071657-69071679 CAACTCCAGCAACTCCAGCCAGG - Intergenic
909583494 1:77263616-77263638 CACCTCCACCATCAACAGCCTGG + Intergenic
909724976 1:78823756-78823778 CCCCTCCAGCATCTTATTCCTGG + Intergenic
910382503 1:86644029-86644051 CACCATCAGCTTCTTGAGGCAGG - Intergenic
912008717 1:104933675-104933697 CACCTGCAGCATGGTGAGCGGGG - Intergenic
913578101 1:120197331-120197353 CAGCTCCTGCCTCTGGAGCCCGG + Intergenic
913630069 1:120701021-120701043 CAGCTCCTGCCTCTGGAGCCCGG - Intergenic
914560019 1:148808751-148808773 CAGCTCCTGCCTCTGGAGCCCGG + Intronic
914612814 1:149321464-149321486 CAGCTCCTGCCTCTGGAGCCCGG - Intergenic
914947594 1:152080355-152080377 CACCTCCATCTTCGGGAGCCTGG + Intergenic
915559310 1:156677172-156677194 CTCCTCCAGCGCCTTGACCCGGG + Exonic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
916201335 1:162274264-162274286 CTCCTCCGGCCTCTTGAACCTGG - Intronic
917028373 1:170665024-170665046 CAGCTCCAGCGTCTGGGGCCGGG - Intronic
918247375 1:182671846-182671868 CACCTCCCACCACTTGAGCCAGG + Intronic
922344014 1:224681154-224681176 CTCCTCCACAACCTTGAGCCAGG - Intronic
924445778 1:244128884-244128906 CAGATCCAGCTTCTTGAGACTGG + Intergenic
924801223 1:247331007-247331029 CGGCTCCGGCATCTGGAGCCCGG + Intronic
1062925923 10:1315234-1315256 CACCTGCAGCACCTGGTGCCTGG - Intronic
1063594784 10:7424460-7424482 CCACTGCAGCGTCTTGAGCCAGG - Intergenic
1068862771 10:61864818-61864840 CATCTTCAGCATCCTGATCCAGG - Intergenic
1069556226 10:69400315-69400337 CACCACAAGCATCTTCAGCCTGG + Intronic
1070933248 10:80275235-80275257 CCCCTCCAGCATCTAGGGGCTGG - Intronic
1071524318 10:86349335-86349357 TACCGCCAGCACCTGGAGCCCGG + Intronic
1074070089 10:110059040-110059062 CACCTCCATTACCTTGGGCCTGG + Intronic
1076063963 10:127434014-127434036 CACCTCCAGGGTGTTGTGCCCGG + Intronic
1076572848 10:131443938-131443960 CTTCTCCAGCCTCTTGAACCTGG - Intergenic
1076605955 10:131689949-131689971 CACCTCCAGGAGCTGGACCCTGG + Intergenic
1076783879 10:132739464-132739486 CACCCCCAGCCTGTCGAGCCTGG + Intronic
1076876759 10:133220045-133220067 CACATCCAGCAGCTGGAGACAGG + Exonic
1077065091 11:637511-637533 CAACTCCTTCATCGTGAGCCTGG + Exonic
1078753828 11:14190123-14190145 CAGCTCCAACATCTGGACCCAGG + Intronic
1081061041 11:38477912-38477934 CACCTCCAGCTGTTTCAGCCTGG - Intergenic
1081648687 11:44808294-44808316 TTCCTCCAGCATCTTGAGGGTGG + Intronic
1081747908 11:45485905-45485927 CACCTCCAGCAGCCTGGGCCTGG + Intergenic
1081782477 11:45722753-45722775 CACTTCCAGGATCCAGAGCCAGG + Intergenic
1081855014 11:46297390-46297412 CTCCACCAGTATCATGAGCCAGG + Intronic
1081910234 11:46695664-46695686 CACCTCCACGATCTGGTGCCGGG + Exonic
1081967890 11:47180455-47180477 CTCCTTCAGCCTCTTCAGCCAGG + Exonic
1083631364 11:64097164-64097186 CCTCTGCAGCATCCTGAGCCTGG + Intronic
1083687648 11:64386314-64386336 CACCTCCAGCAAAGAGAGCCCGG - Intergenic
1084218226 11:67663091-67663113 CAGCTCCAGCAACCTGAGGCTGG + Exonic
1085076516 11:73597380-73597402 CACCTCCATCATCCTGCCCCAGG + Intronic
1085388044 11:76168351-76168373 CACTTCCAGTAGCTGGAGCCTGG + Intergenic
1086663543 11:89451950-89451972 GACCTCTAGCTTCTAGAGCCAGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089086228 11:115819205-115819227 CATCTCCAGCAACTTGACTCAGG - Intergenic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1092505171 12:9091335-9091357 CAAGTCCAGCATCTTCAGACAGG + Exonic
1093053628 12:14532855-14532877 CCCCTCCAGCATCCTGAGACTGG - Intronic
1094488345 12:30942369-30942391 CACCTACAGCAGTTTGACCCTGG - Intronic
1100583390 12:95956869-95956891 CACGCGCAGCATCTTGAGCTCGG - Exonic
1100772907 12:97943006-97943028 CCCATGCAGCATCTTTAGCCAGG + Intergenic
1101695612 12:107122825-107122847 CACCTCCAGCAGCTTGCAGCCGG - Intergenic
1102010519 12:109615773-109615795 CCCCTCCAGAATCCTCAGCCAGG - Intergenic
1103512232 12:121483309-121483331 CTCCACTAGCATCTTGAGACTGG - Intronic
1103723842 12:122988314-122988336 CAACTCCAGCATCTTGGAGCTGG - Exonic
1105989444 13:25603591-25603613 CACCCCCATCATCTTCTGCCTGG - Intronic
1106379621 13:29223715-29223737 CACCTCCAACATGGTGAGCAAGG - Intronic
1106797173 13:33218488-33218510 CTCCTTCAGCCTCTTGAACCTGG + Intronic
1112798064 13:103078906-103078928 CTCCTCCAGAAACTTGAGCCTGG - Intergenic
1113008079 13:105730362-105730384 AAGCTCCACCATCTTGAGCTTGG - Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1120902652 14:89589434-89589456 CACCACCAGTTCCTTGAGCCTGG + Intronic
1121174540 14:91881226-91881248 CACCTCCAACCTCCTGAGCCAGG + Intronic
1122307609 14:100775802-100775824 CAGCTCCAGGGTCTTGACCCTGG - Intergenic
1123501430 15:20886594-20886616 AACCTCCAGAATCTCTAGCCTGG - Intergenic
1123558682 15:21460293-21460315 AACCTCCAGAATCTCTAGCCTGG - Intergenic
1123594912 15:21897574-21897596 AACCTCCAGAATCTCTAGCCTGG - Intergenic
1123718919 15:23047045-23047067 CACCTCCAGCACCTCTGGCCGGG - Intergenic
1124588809 15:31035566-31035588 CATCTCCTACATCGTGAGCCTGG - Exonic
1129912396 15:79239553-79239575 CACCTGCTGCCTCTGGAGCCGGG + Intergenic
1130112571 15:80977784-80977806 TTCCTCCTGCATCTTGAACCTGG - Exonic
1130409734 15:83635278-83635300 CACAGGCAGCATCTTTAGCCTGG + Intergenic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1202967031 15_KI270727v1_random:187452-187474 AACCTCCAGAATCTCTAGCCTGG - Intergenic
1136396027 16:29992951-29992973 CACCTCCTGTATTTTGGGCCAGG - Exonic
1137751248 16:50862671-50862693 CACCCCCAGCTTCTTGAGATGGG - Intergenic
1139677779 16:68537062-68537084 CACCTTCAGTTTCTTCAGCCTGG + Intronic
1141067749 16:80927611-80927633 CACCTCTGGCATCTGTAGCCAGG - Intergenic
1142553114 17:752843-752865 CACCTCCAGCTTCTAGCACCAGG + Intronic
1143188048 17:5022405-5022427 CAGCTCCCGCATCTTGAGGGCGG - Exonic
1144960241 17:19040511-19040533 CACCTCCAGCTTCCTGTGCTGGG - Intronic
1144974919 17:19134013-19134035 CACCTCCAGCTTCCTGTGCTGGG + Intronic
1146519076 17:33512270-33512292 CACCTCCAGAGGCTAGAGCCTGG + Intronic
1147787609 17:42991013-42991035 CACCTCCAGCCTCTTCAGCAAGG - Exonic
1147874314 17:43610198-43610220 CCCATCCAGAAACTTGAGCCTGG - Intergenic
1148871947 17:50663540-50663562 CCCCTCCAACCTCTTGGGCCAGG - Intronic
1149641267 17:58204447-58204469 CACCTCCAGCACCCTGGGCTGGG + Intronic
1149809659 17:59655905-59655927 CACCTCTATGATCTTGAGACTGG + Exonic
1152381358 17:79943977-79943999 CACGTCCAGCAGGCTGAGCCAGG + Intronic
1154111129 18:11569385-11569407 CATCTCCAGCATCTTTGGACAGG + Intergenic
1155212795 18:23617588-23617610 CACCTGCAGCTTCTTGATGCTGG - Intronic
1160663031 19:310141-310163 CACCTCCAACATCTCCACCCGGG + Intronic
1160672325 19:371675-371697 CACCCCCATCATCAAGAGCCTGG + Intronic
1160701065 19:507658-507680 CGCCTCCAGCACCTTCAGCAGGG - Exonic
1161115010 19:2491882-2491904 CACCTCCAGAAGCCAGAGCCTGG + Intergenic
1161507514 19:4651875-4651897 CACCTTCAGCACCAAGAGCCTGG + Exonic
1161847358 19:6719369-6719391 CACCCCCAACATCTTGCGGCTGG - Exonic
1163239598 19:16052334-16052356 CACGTCCAGCATCTTGGGGATGG - Intergenic
1165121388 19:33561104-33561126 CCCCTCCAGCTCCTTCAGCCTGG - Intergenic
1165935111 19:39384340-39384362 CACCTCCAACCTCTTCATCCGGG - Exonic
1166718653 19:44985151-44985173 CACCTGCAGCCTCCAGAGCCCGG - Intronic
1168487569 19:56777435-56777457 AGCCTCCATCATCTTTAGCCTGG + Intronic
926911083 2:17852891-17852913 GACCTCCAGGATATTGAGGCAGG - Intergenic
930384827 2:50680902-50680924 AACCTCCTGCATCTTAAGGCAGG - Intronic
933409573 2:81908859-81908881 CACTTCCAGCTTATTGTGCCTGG + Intergenic
935270399 2:101429614-101429636 CACCTCTGGCATCTTGAGAATGG - Intronic
937041948 2:118829403-118829425 CAGCCCCAGCTTCTTCAGCCAGG + Intergenic
938143805 2:128817682-128817704 CTGCTCCAGCTTCTAGAGCCCGG + Intergenic
938200090 2:129365838-129365860 CATCTCCATCATCTTGTCCCAGG + Intergenic
938673519 2:133607266-133607288 CACCTCCACTATCTAGAGCATGG - Intergenic
939701765 2:145401012-145401034 CACCTCCTGCCTCTTGAGATAGG + Intergenic
940539408 2:154992058-154992080 AAACTGCAGCATATTGAGCCTGG - Intergenic
941151473 2:161919782-161919804 CACCTGCAACATGGTGAGCCAGG - Intronic
941395032 2:164963781-164963803 CTCCTCCAGCTTCTGGAGCCAGG - Intergenic
944556290 2:200890795-200890817 CCCCTCCCACCTCTTGAGCCTGG + Intronic
947197099 2:227579123-227579145 AACCACCAGCCTCTTGATCCTGG - Intergenic
948894002 2:240919865-240919887 CAGGTCCAGCAGCTGGAGCCTGG + Intronic
1171185574 20:23121874-23121896 CACCCCCACCATCCTGTGCCTGG - Intergenic
1173253088 20:41374922-41374944 CATCTCCAGCATCTCTTGCCTGG - Intergenic
1174873985 20:54208185-54208207 CACCCCCAGCATCCCGCGCCCGG - Intronic
1175618767 20:60425287-60425309 CATCTTCAGCATCCTTAGCCAGG + Intergenic
1176144888 20:63561166-63561188 CACGTCCAGGATTTTGAGGCTGG + Exonic
1176378659 21:6100674-6100696 CACTGCCAGCCTCTTGTGCCAGG + Intergenic
1177191628 21:17858118-17858140 CAACTCCAACATCATGAGGCAGG - Intergenic
1177316728 21:19471812-19471834 GACATCCAGGAGCTTGAGCCTGG + Intergenic
1177629928 21:23713478-23713500 CTCTTCCAGTGTCTTGAGCCTGG + Intergenic
1179744816 21:43437563-43437585 CACTGCCAGCCTCTTGTGCCAGG - Intergenic
1181021850 22:20107682-20107704 CACCTTCAGCATCTCCTGCCTGG - Intronic
1182249304 22:28987318-28987340 CACCTCATGCAACTTCAGCCGGG - Intronic
1182752571 22:32653625-32653647 CACCTCCTGCATCTTCTGACTGG - Intronic
1182831012 22:33304489-33304511 GGCCTCCAGCATCTGGAGCCTGG + Exonic
1183950594 22:41350483-41350505 CACCTCCAGCATCACCACCCTGG - Intronic
1184660609 22:45963945-45963967 CACCTCCAGGAGCTGCAGCCTGG + Intronic
949583899 3:5418339-5418361 CTCCTCAAGGATCTAGAGCCAGG + Intergenic
953432422 3:42851013-42851035 CACCTTCAGCTTCTTCATCCTGG - Intronic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
954624238 3:52013833-52013855 CACCTCCAGGATCCAGAGCTGGG - Intergenic
955524842 3:59809423-59809445 GACATCCAGCATCTTGAACTGGG + Intronic
956464878 3:69509466-69509488 CACTTCCAGCACCTTGAGAAAGG - Intronic
957186872 3:76952777-76952799 CTCCTCCAGCATGTTCAGCAGGG + Intronic
957595506 3:82259928-82259950 CACCTCCAGCATCAGGAGTAGGG - Intergenic
961794654 3:129401089-129401111 CACCTCCAGCCTCTTGTCCTGGG - Intergenic
961794682 3:129401186-129401208 CACCTCCAGCCTCTTGTCCCGGG - Intergenic
964830671 3:160880780-160880802 GACTTTCAGCATCTTGAGCAGGG + Intronic
965389636 3:168089703-168089725 CATCTCCAGCGTCTGGTGCCTGG - Intronic
968663307 4:1807706-1807728 CATGTCCAGCACCTTGTGCCTGG + Exonic
970167895 4:13259256-13259278 CACCTCCTGCTTCTTGAGATCGG + Intergenic
973225260 4:47776377-47776399 CACACGCAGCAACTTGAGCCTGG - Intronic
973630074 4:52811977-52811999 CACCTCCAATATCTGGAGACTGG + Intergenic
976285090 4:83363577-83363599 CACCTCCACAACCTTGATCCAGG + Intergenic
978746605 4:112201904-112201926 CTTCTTCAGCTTCTTGAGCCTGG - Intergenic
978940399 4:114429341-114429363 GAACTCCAGCAACTTCAGCCAGG - Intergenic
984758277 4:183343242-183343264 CCCCTCCAGCGTCTTGAGGATGG + Intergenic
985066489 4:186127110-186127132 CAGCTCCAGCACCTTCTGCCTGG - Intronic
985855831 5:2425938-2425960 CACCTCCTTGATCTTGAGCAAGG - Intergenic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
988503364 5:31801381-31801403 TCCCTGCAGCATCTTGAGCCTGG - Intronic
991572828 5:68073725-68073747 CATCTCCAGCACCTAGAGCAGGG + Intergenic
993452881 5:88094386-88094408 CACATGCAGCATCATGAGACAGG - Intergenic
993674754 5:90803541-90803563 CCACCTCAGCATCTTGAGCCAGG - Intronic
995289847 5:110439431-110439453 CCCCTCCAACATCTACAGCCTGG + Intronic
1001403760 5:171461548-171461570 CACCTCCAGCTTCTAGTGCACGG + Intergenic
1002400768 5:178990646-178990668 GACCTCACCCATCTTGAGCCTGG - Exonic
1004797527 6:19104008-19104030 CTCCTCCAGAATCTCTAGCCAGG + Intergenic
1005243185 6:23854640-23854662 CACCTCCATCTTCGGGAGCCTGG - Intergenic
1005268227 6:24135599-24135621 CGCCACCAGCATCTTTTGCCTGG - Intronic
1006154252 6:32005773-32005795 CACCTCCTGCCTCTTGCCCCGGG + Intergenic
1006160556 6:32038507-32038529 CACCTCCCGCCTCTTGCCCCGGG + Exonic
1007005060 6:38353657-38353679 CACCCCCAGCATCTTGGGCTAGG - Intronic
1007118564 6:39361848-39361870 CACCACCAGCTCCTTGAGGCAGG + Intronic
1008615479 6:53221836-53221858 CACCTCAAGCATCTAGAGTTTGG - Intergenic
1010620155 6:78063879-78063901 CTCCCCCAAGATCTTGAGCCAGG + Intergenic
1013540725 6:111105820-111105842 CACTTCCAGCACCTTCAGCTGGG - Intronic
1014045024 6:116875924-116875946 TACCTCCAGCAGCTAGATCCAGG - Intergenic
1014368010 6:120569117-120569139 GTCCTCAATCATCTTGAGCCTGG + Intergenic
1014743585 6:125173460-125173482 CACCTCCTGGCTCTTGGGCCAGG - Intronic
1018013556 6:159693155-159693177 CACTAGCAGCATGTTGAGCCGGG - Exonic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1018648970 6:165975068-165975090 CACCTCCAGGGTCTGGACCCGGG - Intronic
1018700584 6:166423090-166423112 AACCTTCAGTCTCTTGAGCCAGG - Intronic
1022195883 7:28066957-28066979 TACCTCCAGCATCTTGGCACAGG + Intronic
1022686007 7:32597097-32597119 CCCCTCGAGCATCATGTGCCTGG + Intergenic
1022831114 7:34067669-34067691 CTGCTCCAGCATCTGGAGTCGGG + Intronic
1023416380 7:39937027-39937049 CACCTCCAGCAGCCTGTGCACGG + Intergenic
1024242891 7:47448908-47448930 CAGCTGCAGAATCTTGGGCCAGG + Intronic
1025961659 7:66227646-66227668 CACTGCCAGCATCTTGCACCAGG - Intronic
1026565901 7:71489607-71489629 CTCCTTCAGGCTCTTGAGCCTGG - Intronic
1028401893 7:90433520-90433542 CACCTGCAGCTCATTGAGCCAGG + Intronic
1029481930 7:100818585-100818607 CTCACCCAGCAGCTTGAGCCTGG - Exonic
1029493143 7:100883086-100883108 CACCTCCAGGATCTTTACCTTGG - Intronic
1030615627 7:111735135-111735157 CACCCCTAGCAGCTGGAGCCTGG - Exonic
1031923664 7:127619363-127619385 CTCCTCCAGCATCCTCAGACTGG + Intergenic
1034293719 7:149951972-149951994 CCCCTCCAGCACCTTGACCTTGG - Intergenic
1034812347 7:154144881-154144903 CCCCTCCAGCACCTTGACCTTGG + Intronic
1034898147 7:154890706-154890728 CACCCCATGCATCTGGAGCCAGG + Intronic
1036612203 8:10360078-10360100 CAGCTCCAGCCTCTTCACCCAGG + Intronic
1038373038 8:27011919-27011941 CACCTCCATCTTCAGGAGCCTGG + Intergenic
1041491534 8:58438358-58438380 CGCCACCAGCAACCTGAGCCTGG + Intronic
1041508601 8:58629708-58629730 GGCCTCCAGCATCTCTAGCCAGG - Intronic
1045331049 8:101155898-101155920 CACCTCCAGTAACTTAAACCTGG + Intergenic
1048120747 8:131578849-131578871 CACTTCCACCATCCTGAGCTAGG - Intergenic
1049341979 8:142118088-142118110 CCCTTCCAGCTTCTGGAGCCTGG - Intergenic
1049416448 8:142497689-142497711 CCCCTGCAGCAGCTTGGGCCTGG + Intronic
1049668579 8:143859598-143859620 CAGCTGCAGCATGTAGAGCCCGG + Exonic
1049668995 8:143861200-143861222 CAGCTGCAGCATGTAGAGCCCGG + Exonic
1049669410 8:143862802-143862824 CAGCTGCAGCATGTAGAGCCCGG + Exonic
1049669821 8:143864395-143864417 CAGCTGCAGCATGTAGAGCCCGG + Exonic
1049670237 8:143866003-143866025 CAGCTGCAGCATGTAGAGCCCGG + Exonic
1049766270 8:144356678-144356700 CACCTCCAGGACCTGGAGCTGGG + Exonic
1049784031 8:144442027-144442049 AACCTCCAGCATGGTGAGCCTGG - Exonic
1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG + Intronic
1052413303 9:28148416-28148438 CACCTCCATCTTCGGGAGCCTGG - Intronic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1055335510 9:75229486-75229508 CCTCTTCAGCCTCTTGAGCCTGG + Intergenic
1056020305 9:82432680-82432702 CACCTCCATCTTCGGGAGCCTGG + Intergenic
1056257917 9:84819318-84819340 CACCTCAAGCCCCTTGAGTCGGG + Intronic
1057071592 9:92104631-92104653 CACCTCCATCTTCGGGAGCCTGG - Intronic
1057251571 9:93507592-93507614 CACCTCCTGCATCTGGCCCCAGG - Intronic
1057435959 9:95040692-95040714 CACCTCCAGGAGCTTGGGCCAGG - Intronic
1059626084 9:116067992-116068014 AACCGCCAGCATCTAGACCCTGG + Intergenic
1059715401 9:116908499-116908521 CACCACCACCATCATTAGCCTGG + Intronic
1060934391 9:127506975-127506997 CCCCTCCAGCATCTCCTGCCTGG - Exonic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1060999546 9:127895437-127895459 CACCTGCAGCACCTGGAGGCTGG + Intronic
1061899921 9:133667734-133667756 CACCTCCTGCATCCTCAGCCTGG + Intronic
1062453545 9:136625428-136625450 CAGCTGCAGCAACTTGACCCAGG + Intergenic
1062576230 9:137209688-137209710 CACCTACAGCATCCTCAGCAAGG - Intronic
1185523672 X:760792-760814 CACGTCCAGCACCTGGAGGCTGG - Intergenic
1185556991 X:1029374-1029396 CACCTCCTGCAAGATGAGCCGGG + Intergenic
1186369417 X:8931156-8931178 CTTCTCAAGCATCTTAAGCCAGG - Intergenic
1190374624 X:49776714-49776736 CAACCCCAGAATCTTGACCCAGG + Intergenic
1192191870 X:68995964-68995986 GACCTCCACCTTCTGGAGCCAGG - Intergenic
1194583437 X:95704798-95704820 CACCCCCAGCACCTTCAGCCTGG + Intergenic
1194946714 X:100077271-100077293 CTCTTCCTGGATCTTGAGCCTGG - Intergenic
1196021735 X:110997939-110997961 CACCACCAGCACCTTGATCTTGG + Intronic
1196723180 X:118873758-118873780 CACTTCCAGTTTGTTGAGCCAGG - Intergenic
1199904029 X:152206548-152206570 CACCTTCAGCACAGTGAGCCAGG + Intronic
1200305475 X:155022137-155022159 CTCCTCCAGAATCTAGAGACTGG - Intronic