ID: 1113812837

View in Genome Browser
Species Human (GRCh38)
Location 13:113152996-113153018
Sequence GTCTCTCCTCCCCACTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113812837_1113812839 1 Left 1113812837 13:113152996-113153018 CCGGGCCAGTGGGGAGGAGAGAC 0: 1
1: 0
2: 6
3: 48
4: 376
Right 1113812839 13:113153020-113153042 AGTCCGCAGACAGCGTTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1113812837_1113812842 15 Left 1113812837 13:113152996-113153018 CCGGGCCAGTGGGGAGGAGAGAC 0: 1
1: 0
2: 6
3: 48
4: 376
Right 1113812842 13:113153034-113153056 GTTCAGAGGCCGCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 112
1113812837_1113812841 14 Left 1113812837 13:113152996-113153018 CCGGGCCAGTGGGGAGGAGAGAC 0: 1
1: 0
2: 6
3: 48
4: 376
Right 1113812841 13:113153033-113153055 CGTTCAGAGGCCGCGCTGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113812837 Original CRISPR GTCTCTCCTCCCCACTGGCC CGG (reversed) Intergenic
900129750 1:1082385-1082407 CTGTGTCCTCCCCACTGGCCGGG + Exonic
900228033 1:1541742-1541764 CTCCCTCCTCCCCACCGGGCCGG - Exonic
900437352 1:2637491-2637513 GCCTCCCCTTCCCACTGGCCAGG - Intronic
900699163 1:4033315-4033337 GTCTATCCTCCTCCCTGGCCTGG - Intergenic
900951765 1:5862061-5862083 GACTCTCCACCCCACAGGGCAGG + Intergenic
901012684 1:6210322-6210344 GTCCCTCCTCCTCCCCGGCCAGG + Intronic
901179831 1:7334009-7334031 TCCTCTCCTTCCCACTTGCCTGG - Intronic
901655634 1:10767792-10767814 GTCTGTCTTGCCCACTGCCCCGG + Intronic
901721321 1:11200500-11200522 TTCTGTCCTCCCCACTGTTCTGG + Intronic
901907454 1:12426246-12426268 GCCTTTCCTCCCGCCTGGCCTGG + Intronic
902480257 1:16707857-16707879 GTCTCCCCTCCGCACCGCCCGGG + Intergenic
903063828 1:20687430-20687452 GACTCTCCTCCACCGTGGCCAGG - Exonic
903812951 1:26045217-26045239 CCCTCTCTTCCCCTCTGGCCAGG - Exonic
904730566 1:32587855-32587877 CTCTCTCCTCCCCAGAGGCTGGG - Intronic
905178600 1:36153299-36153321 CATTCTCCTCCTCACTGGCCAGG - Intronic
905501880 1:38445999-38446021 CTCTCTTCTCCCTACTTGCCTGG - Intergenic
905664720 1:39756067-39756089 GGCTCCCCTCCCTTCTGGCCTGG - Intronic
906147943 1:43570986-43571008 GACGCTCCTCCCTGCTGGCCTGG + Intronic
906521513 1:46469594-46469616 GGCTCCCCTCCCCACAGGGCAGG - Intergenic
907291339 1:53414888-53414910 GTCCCTCCTGGCCACTGGCATGG - Intergenic
907341288 1:53738099-53738121 GTCTCCCCTCCCCAGGAGCCCGG - Intergenic
907406988 1:54259674-54259696 GCCCCTCCTCCCCAGTGGGCAGG - Intronic
908929626 1:69303319-69303341 GTCTCTACTTTCCATTGGCCAGG - Intergenic
909502017 1:76345185-76345207 GTGTCTCCTCATCACTGTCCGGG - Intronic
909503647 1:76362999-76363021 ATCTCTCCTCCACATTGCCCTGG + Intronic
910428560 1:87139354-87139376 GTCTCTCCTTCCCGGAGGCCTGG + Intronic
911040923 1:93590036-93590058 ACTCCTCCTCCCCACTGGCCAGG - Intronic
912161272 1:106987609-106987631 CTGTCTCCTCCTCACTGACCTGG + Intergenic
913972103 1:143423416-143423438 GTCTCCCTTGCCCACTGGCACGG - Intergenic
914066484 1:144249029-144249051 GTCTCCCTTGCCCACTGGCACGG - Intergenic
914112669 1:144717325-144717347 GTCTCCCTTGCCCACTGGCACGG + Intergenic
915540304 1:156561892-156561914 GTCTCTCCTCACCCCTCGCAGGG + Exonic
915622066 1:157092107-157092129 GTCTCCCCACCCCACTTGCCTGG + Exonic
915688322 1:157659918-157659940 CTCTCTGCTCCCCACTTGCTTGG + Intergenic
915734603 1:158076687-158076709 CTCTCTCCTCCCCGCTGCCCAGG + Intronic
916584794 1:166141092-166141114 GTTCCACCTGCCCACTGGCCTGG - Intronic
916654309 1:166859849-166859871 GGCTCACTTCCCCACTGGGCAGG + Intronic
916761020 1:167818077-167818099 GTAGCTCCTCCCCACTGGCTTGG + Exonic
917035882 1:170746407-170746429 GTCCTTGCTCCCCACGGGCCAGG - Intergenic
917149601 1:171929783-171929805 GTTTCTCCTCCTCACTAGGCGGG - Intronic
918606807 1:186437370-186437392 GTGACTCCTACCCACAGGCCTGG - Intergenic
919355593 1:196517197-196517219 CTCTCTTCTCCCTACTGGGCAGG + Intronic
919931955 1:202226791-202226813 GGCTTTCCTGCCTACTGGCCAGG - Intronic
920128615 1:203713372-203713394 GTATGTTCTCCCCACTAGCCTGG - Intronic
920403222 1:205690353-205690375 GTCTCTCCTTCCCGCAGGCCTGG - Intergenic
920660473 1:207910640-207910662 TTCTCTCCTCCCCAGTCTCCCGG + Intronic
922416632 1:225428126-225428148 GCCTCCCCTCCCCACCGGCGAGG + Intronic
923054481 1:230415616-230415638 GTCTCTCTTCCCCCATGGGCAGG + Intronic
923669390 1:236027162-236027184 GTCTCTCCTCTCCTCTGTTCAGG - Intronic
924055449 1:240119731-240119753 TTCTCTCCTCCACACTGTTCTGG + Intronic
1064567950 10:16662100-16662122 GTCTCTCCTGCCCACTTGTATGG - Intronic
1064599001 10:16974385-16974407 GTCTCTTCTGCCCACTGGCTGGG + Intronic
1065322847 10:24524954-24524976 GTCTCACCTTCCTACAGGCCAGG - Intronic
1065322852 10:24524978-24525000 GTCTCACCTTCCTACAGGCCAGG - Intronic
1065322857 10:24525002-24525024 GTCTCACCTTCCTACAGGCCAGG - Intronic
1066649121 10:37638966-37638988 GTCTCTCCACACCACTGCCATGG - Intergenic
1067031615 10:42881664-42881686 GTCCATGCTCCCCACTGACCTGG - Intergenic
1067031975 10:42884379-42884401 GTCTCTCCACACCACTGCCATGG - Intergenic
1067098782 10:43319763-43319785 CTCTCTCCACCCCCTTGGCCAGG - Intergenic
1067169514 10:43895165-43895187 GTCTCTCCTCCCCAAAGGTCAGG - Intergenic
1067532776 10:47086506-47086528 GGGGCTCCTCCCCTCTGGCCAGG - Intergenic
1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG + Intergenic
1067839212 10:49662761-49662783 GTTTGTCCTCTCCACTAGCCAGG + Exonic
1069680457 10:70281265-70281287 GCTTCACCTCCCCACTGGTCTGG - Intronic
1070342443 10:75510349-75510371 GACTCTCCTCCCCAGAGTCCAGG - Intronic
1070386981 10:75934616-75934638 GTCTCTCTTCCCCACTAGCCAGG - Intronic
1070805391 10:79267804-79267826 ACCTCTCCTGCTCACTGGCCTGG - Intronic
1070920588 10:80183148-80183170 CTCTCTCCTGCCCAGTGACCTGG - Intronic
1070961389 10:80502451-80502473 GTCTCTGCTCCCACCTGCCCCGG - Intronic
1071513391 10:86281475-86281497 TTCTCTCCTACCCACTGGGCAGG + Intronic
1072067803 10:91887360-91887382 GTCCGACCTTCCCACTGGCCAGG - Intergenic
1072744741 10:97932175-97932197 GTTTCTCTTTCCCACAGGCCAGG + Intronic
1073332875 10:102682205-102682227 GTCTCTCCTCATCACTCCCCTGG + Intronic
1074618369 10:115093108-115093130 TACACTCCTCCCCACAGGCCCGG - Intergenic
1074775752 10:116767151-116767173 GTCTCCTCTCCTCATTGGCCTGG + Intergenic
1075060456 10:119253383-119253405 GTCCCTCTTCTCCACAGGCCTGG - Intronic
1075735379 10:124661601-124661623 TTCCCTCCTCCCCACTGCCCTGG - Intronic
1075961501 10:126571299-126571321 GTCTCACCTGCCCTTTGGCCTGG - Intronic
1076141788 10:128085107-128085129 GACTCTCCCCTCCACTGTCCGGG + Exonic
1076507399 10:130987201-130987223 GTCTCTCCTGCCCACATGCTGGG - Intergenic
1077166861 11:1146133-1146155 GTCTCTCCTCTCCCCTCCCCTGG + Intergenic
1077220065 11:1411831-1411853 GAGGCTCCTGCCCACTGGCCCGG + Intronic
1077251859 11:1564291-1564313 GTGTCTCCTCCACACAGGCCTGG - Intronic
1077307751 11:1875617-1875639 GTCTCCCTTGCCCACTGGCGTGG + Intronic
1077456533 11:2684775-2684797 GCCTTCCCTCCCCACTGGTCTGG + Intronic
1077505400 11:2927868-2927890 GCCTCTCCACCCCAATGTCCTGG + Intergenic
1078064866 11:8071820-8071842 GTCTCTCTTCCCCAGTGGGAGGG - Intronic
1078175583 11:8967382-8967404 GTGTACCCTCCCAACTGGCCTGG + Intergenic
1078403145 11:11045303-11045325 ACCTCTCCTGCCCACAGGCCTGG - Intergenic
1078628645 11:12981613-12981635 GTCTATCCTCCTCACTGTCTTGG + Intergenic
1078645993 11:13141829-13141851 GTCGGCCCTCTCCACTGGCCTGG - Intergenic
1078721035 11:13883344-13883366 CTCTCCCCTCCCCACTGCACTGG - Intergenic
1078815984 11:14823015-14823037 CTCTCTTCTCCTCACTGGGCAGG + Intronic
1079124305 11:17708035-17708057 TGCTCTGCTCCCCTCTGGCCAGG + Intergenic
1080002328 11:27363441-27363463 GTCTCCCCACGCCACTGGCGGGG + Exonic
1080121412 11:28682070-28682092 GTCTCCCCTCCACCCTGTCCAGG - Intergenic
1081591950 11:44429525-44429547 GCATCCCCTCGCCACTGGCCAGG - Intergenic
1083053820 11:59800756-59800778 GTCTTTCCTCCCCACCTTCCAGG + Intronic
1083741914 11:64715749-64715771 GGATCTCCTCCCCACTGCCCGGG - Intronic
1084750133 11:71199062-71199084 GTCCCTCATGCCCCCTGGCCTGG - Intronic
1084980642 11:72826845-72826867 ACCTCTCCTCCCCACCAGCCAGG + Intronic
1085040442 11:73323632-73323654 GCCCCTCCTCCCCTCTGGCCTGG + Intronic
1085314585 11:75536659-75536681 CTCTGGCCTCCCCACTGGGCTGG - Intergenic
1086982179 11:93209994-93210016 CCCTCTCCTTCCCATTGGCCTGG + Intergenic
1088804754 11:113341992-113342014 GACTGTCCTCCCCAAAGGCCAGG + Intronic
1089188211 11:116635448-116635470 CTCTCGCCTGCCAACTGGCCTGG + Intergenic
1089202271 11:116731673-116731695 GTCCCTCCGCTCCCCTGGCCAGG - Intergenic
1089303773 11:117514275-117514297 GCTTCCCCTCCCCACTGCCCTGG + Intronic
1089534405 11:119151794-119151816 GTCTCTCCAGCCCAAGGGCCTGG + Intronic
1089699220 11:120234405-120234427 GTCTTTTCTCCCCACTCTCCCGG + Intergenic
1090258364 11:125301752-125301774 CTGTCTCCTCTCCACTGGCCTGG - Intronic
1091333675 11:134750901-134750923 GTTTCTGCTCCCCATTGCCCGGG - Intergenic
1091603984 12:1935037-1935059 CCCTCTGCTCCCCACTGCCCGGG - Intergenic
1091668350 12:2435359-2435381 GTCCTTCCTGCCCACTTGCCTGG + Intronic
1091825437 12:3509021-3509043 GTGTCTCTTCACCTCTGGCCTGG + Intronic
1092260789 12:6952319-6952341 GTCCCTCCTCCCTGCTGTCCTGG + Intronic
1093178617 12:15942690-15942712 GACTCTCTTCCCCACTCTCCTGG - Intronic
1096197642 12:49658856-49658878 TCCTCTGCTCCCCACTAGCCAGG + Intronic
1096763901 12:53867535-53867557 GTGTCTCCTCCTCAGGGGCCAGG + Intergenic
1096841237 12:54380173-54380195 GTCTCTCTTTCCCAGTGGACTGG - Intronic
1102455661 12:113069451-113069473 GTCTCCCCACCACCCTGGCCTGG + Intronic
1102482479 12:113233277-113233299 CACTCTCCTCCCCACTCGCCTGG + Intronic
1102532807 12:113559062-113559084 GTCTCTTTTTCCCACTGGCTAGG + Intergenic
1102820784 12:115907612-115907634 GTCTCACCTCGTCATTGGCCAGG - Intergenic
1103925743 12:124422632-124422654 GCCTGCCATCCCCACTGGCCGGG + Intronic
1105764683 13:23547279-23547301 GTCTCTCCACCGCCCTGTCCCGG - Intergenic
1106439391 13:29752061-29752083 CTCTCTCCTCCCTACTAGGCAGG + Intergenic
1112508184 13:99987955-99987977 GCCTTTCCTCCCCACTGAACAGG - Intergenic
1113347405 13:109493784-109493806 CTCTCTTCTCTCCACTGGCTTGG - Intergenic
1113369267 13:109707683-109707705 GTCGCCCCTCCCTGCTGGCCTGG - Intergenic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1113926357 13:113943967-113943989 GCCTCTCCTCTCCTCTGGCTCGG + Intergenic
1113930272 13:113964651-113964673 GTGTCTCCTACCCACCAGCCAGG - Intergenic
1113962282 13:114132669-114132691 GCCCCTGCTCCCAACTGGCCCGG + Intergenic
1114360065 14:21961870-21961892 CTCACTTCTCCCCACTGGCCAGG + Intergenic
1114644642 14:24248358-24248380 GTCTGTCACCCCCACTGGACAGG + Intergenic
1117107896 14:52417657-52417679 GTCTCTCTTCCCCACACACCTGG + Intergenic
1117740540 14:58814782-58814804 GAGTCTCCTCACCGCTGGCCTGG + Intergenic
1118723499 14:68610186-68610208 TTCTACCCTCCCCACTGCCCAGG + Intronic
1119632774 14:76248512-76248534 TTCTCTCCTCCCAAATGCCCTGG + Intronic
1120951524 14:90046104-90046126 GACCCTACCCCCCACTGGCCTGG - Intergenic
1121419167 14:93800275-93800297 CTCTGTCTTCCCCACTGGACTGG - Intergenic
1121434815 14:93912125-93912147 GTCTCAGCACCCCACAGGCCTGG - Intergenic
1121625863 14:95385052-95385074 GTCCCTCCTCCCCACTTGGAAGG + Intergenic
1122125089 14:99574566-99574588 GCCTCCCCTCCTCACAGGCCGGG - Intronic
1122312054 14:100803744-100803766 GCCAATCCTCCCCACAGGCCAGG - Intergenic
1122353839 14:101112066-101112088 GCCTCTCCTTCCCCCTGCCCGGG + Intergenic
1122750150 14:103927496-103927518 GTGTGTCCCCCTCACTGGCCAGG - Intronic
1123043036 14:105498283-105498305 GTCACTCCTCCACACCTGCCTGG + Intronic
1124589062 15:31037021-31037043 CTCTCTCCTCCCGACTGACGTGG + Intronic
1127837304 15:62800262-62800284 TTCTCTCCTCCCCCGTGCCCTGG + Intronic
1128311431 15:66633607-66633629 GGCTCTCCTCTCCACAGCCCAGG + Intronic
1128879922 15:71233898-71233920 CTCTCTCCTCCCCTCTTCCCAGG + Intronic
1130297204 15:82655844-82655866 GTCTCTCTTGCCCATTTGCCTGG + Intergenic
1130880001 15:88046703-88046725 GTCTCTTCTCCCCACACACCTGG + Intronic
1133028953 16:3000697-3000719 AGCTCTCCTCCCCACAGGGCAGG + Intergenic
1133456979 16:5950908-5950930 GTCTCTTATCCTCTCTGGCCTGG - Intergenic
1133496527 16:6323380-6323402 ATCTGTCTTCCCCACTGGACTGG + Intronic
1134126265 16:11618321-11618343 GGCTCTCCTCCCGCCTTGCCAGG - Intronic
1134174285 16:11993321-11993343 TTTTCTCCTCCCCACGTGCCAGG + Intronic
1134743141 16:16566275-16566297 TTTTCTCCTCCCCACAGCCCTGG + Intergenic
1134924419 16:18146185-18146207 TTTTCTCCTCCCCACAGCCCTGG - Intergenic
1135189535 16:20343809-20343831 GACTCTGTCCCCCACTGGCCAGG + Intronic
1135870047 16:26141426-26141448 GTCCATCTTCCCCACTGGGCTGG - Intergenic
1135910408 16:26555587-26555609 GGTACTGCTCCCCACTGGCCTGG - Intergenic
1136044102 16:27601981-27602003 CTCTCTCCTCCCATCAGGCCTGG + Intronic
1136127315 16:28193543-28193565 ATCCCTCCACCCCACTGGCGAGG + Intronic
1136348898 16:29694647-29694669 TTCTCTCTTCCCCCCAGGCCTGG + Exonic
1136403551 16:30030880-30030902 GCCTCCCCTCCCCACCTGCCTGG - Exonic
1136569162 16:31086554-31086576 GTCTCAGCTCCCAACTGTCCTGG - Intronic
1136605278 16:31329714-31329736 GCCTCCCCTCCCCACGGGGCAGG - Intronic
1136778727 16:32884744-32884766 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1136891891 16:33976770-33976792 CCCGCTCCTCCCCTCTGGCCCGG + Intergenic
1137287197 16:47026291-47026313 GTCACTGCTCTCCACAGGCCTGG + Intergenic
1138230328 16:55331559-55331581 GTCTGGCCTCCGCGCTGGCCTGG - Intergenic
1138579646 16:57932347-57932369 CTGGCTCCTCCCCACAGGCCTGG - Intronic
1139939113 16:70591948-70591970 TTCTCTTCTCACCACTGTCCTGG + Intronic
1141699513 16:85636036-85636058 GCCGCTGGTCCCCACTGGCCAGG + Intronic
1141841585 16:86577336-86577358 GCCTCTCCTCCCCACTCCACCGG - Intronic
1141979471 16:87541091-87541113 GCCACTCCTGCCGACTGGCCAGG + Intergenic
1203081144 16_KI270728v1_random:1146838-1146860 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1142974658 17:3636348-3636370 TTCTCGTCTTCCCACTGGCCGGG + Intergenic
1143106039 17:4531038-4531060 GTCTCTTCTCTGCAGTGGCCTGG + Exonic
1143863671 17:9908872-9908894 GACCCTCCTGCCCTCTGGCCTGG + Intergenic
1144378251 17:14667126-14667148 TTCTCTTCTCCCCACAGCCCTGG - Intergenic
1146919912 17:36703615-36703637 GTCTCTCTTCCCCAGTGGTCTGG - Intergenic
1147450590 17:40501667-40501689 TTCTCTCCTCCCCTCCGGGCGGG + Intergenic
1147881471 17:43656857-43656879 GTCTTTAATCCCCATTGGCCTGG + Intronic
1147964579 17:44187254-44187276 GACCCTACTCCTCACTGGCCGGG + Intronic
1147980027 17:44268476-44268498 GTCCATCCTCCACTCTGGCCAGG + Intergenic
1148110830 17:45144013-45144035 CTCACTCCTCCCAACTGGTCCGG - Exonic
1148163168 17:45463323-45463345 CTCTCTGCTCCCCACCTGCCTGG - Intronic
1148587352 17:48790492-48790514 GTCTCCCCTCCACCCTGGCCAGG - Intronic
1148685304 17:49497396-49497418 GTCCCTCCTCCCCGCTCTCCTGG - Intronic
1149474193 17:56945388-56945410 ATCTCCCCTGCCCTCTGGCCAGG + Intronic
1150394401 17:64809975-64809997 CTCTCTGCTCCCCACCCGCCTGG - Intergenic
1150421432 17:65039502-65039524 CTCACTCCTCCACCCTGGCCTGG + Intronic
1150477545 17:65486454-65486476 CAACCTCCTCCCCACTGGCCAGG + Intergenic
1152091349 17:78249478-78249500 GTCTCTCCTCTCCACCTCCCAGG - Intergenic
1152104230 17:78319380-78319402 TTCTCTCCTCCCTGCTTGCCTGG + Intergenic
1152199021 17:78934473-78934495 CTCTCTCCTCCCCTCTCCCCAGG + Intergenic
1152487035 17:80601258-80601280 GTCTCTGCTCCACAATGTCCGGG - Intronic
1152563610 17:81090616-81090638 CTTTCTGCTCCCCAGTGGCCTGG + Intronic
1152571473 17:81123065-81123087 GTCTCCCCTCCCCTCTGGTAGGG - Intronic
1152640720 17:81448159-81448181 GGCTCTCCTCTCCCCTTGCCAGG - Intronic
1157582086 18:48779566-48779588 GAGCCTCCTCCCCACAGGCCAGG + Intronic
1157582135 18:48779781-48779803 GTCCTTCCTTCCCACTGGGCTGG + Intronic
1158426849 18:57348000-57348022 GTCTCACCTCCCCACGGGCCTGG + Intergenic
1159084235 18:63770116-63770138 CTCTATCCTCCCCACTGGCCTGG - Intronic
1160733039 19:649801-649823 GTCTATCCACCCCACTCACCAGG + Intronic
1160806427 19:994134-994156 GCCACTCACCCCCACTGGCCAGG - Intronic
1160895574 19:1400496-1400518 CTCTCGCCTCCCCACAGGCCTGG - Intronic
1160915234 19:1493220-1493242 GTCATTCCTCCCCACGAGCCAGG + Intronic
1161107856 19:2453488-2453510 AACTCTGCTCCCCACTAGCCGGG + Intronic
1161177948 19:2858963-2858985 GTGCCTCCTCCCCACAGTCCAGG + Exonic
1161641463 19:5426153-5426175 GTCTCACTTCCCCACTCTCCTGG + Intergenic
1161655964 19:5515110-5515132 AGCTCTCCTGCCCTCTGGCCTGG + Intergenic
1161715809 19:5875689-5875711 GTCGATCCTCCCCACTGGCCTGG - Intronic
1162159176 19:8698769-8698791 GCCTGCCCTCCCCACTGGCCGGG - Exonic
1162809282 19:13154460-13154482 CACTCTCCTCCCCACTGCCCAGG - Exonic
1163154183 19:15431177-15431199 GTCTCCCCAACCCACAGGCCTGG - Intronic
1163314021 19:16530698-16530720 CTTTCCCCTCCCCACTGACCCGG - Intronic
1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG + Exonic
1164713105 19:30373228-30373250 GGAACTCTTCCCCACTGGCCAGG + Intronic
1164737515 19:30552766-30552788 GTCTCCCCACCCAACTGGCTGGG - Intronic
1164778868 19:30876395-30876417 CTCACTCCTCCCCACTGCTCTGG - Intergenic
1165794634 19:38511802-38511824 GTCTGTCTCTCCCACTGGCCTGG - Intronic
1165956845 19:39506533-39506555 GTCTGTCTTCCCCTCTGGGCTGG - Intronic
1166668795 19:44697742-44697764 GTCTTTTTCCCCCACTGGCCTGG - Intergenic
1166981266 19:46633638-46633660 TCCTCTCCTCCCCACTGGCTTGG - Intergenic
1167114507 19:47480749-47480771 GCCTCTCCTACCTACTGGTCAGG + Exonic
1167241822 19:48348376-48348398 CTCTCTCCTCCCCACCCGCCTGG + Intronic
1167368216 19:49065526-49065548 TGCTCTCCTCCCCACTTCCCAGG + Intergenic
1167574120 19:50309623-50309645 GTCTCTCCTCCCCACAGACGCGG + Exonic
1167719196 19:51167207-51167229 TTCTCTGCTCCCCTCTGGGCAGG + Intergenic
1167749634 19:51371915-51371937 GACTATCCTGCCCACTGCCCTGG - Intronic
1167943282 19:52964673-52964695 GTCTCACCTCCCAACTAGCTGGG + Intergenic
1202714296 1_KI270714v1_random:33767-33789 GTCTCCCCTCCGCACCGCCCGGG + Intergenic
925313286 2:2903072-2903094 GTCTGTCTTCCCTACTGGCTGGG + Intergenic
925506575 2:4572377-4572399 GTCTTCCCTCCACACTGGTCCGG + Intergenic
925668856 2:6290492-6290514 CTCTCTCCACCCCACAGGCTGGG - Intergenic
926162952 2:10501261-10501283 GTCCCACCTCCCCACTGGCCCGG - Intergenic
927088278 2:19691243-19691265 CTCTCTCCTCTACACAGGCCAGG - Intergenic
928321037 2:30283059-30283081 CCCATTCCTCCCCACTGGCCAGG + Intronic
929040780 2:37742342-37742364 CTCTCTCCACCTCACAGGCCTGG + Intergenic
929580160 2:43076963-43076985 GTCCGTCCTTCTCACTGGCCAGG - Intergenic
929829341 2:45334609-45334631 GACTCTCATCTGCACTGGCCTGG + Intergenic
931115714 2:59164593-59164615 CTCTCCCCTCCCCAGAGGCCGGG - Intergenic
931751566 2:65334958-65334980 TTCGCTGCTCCCCACTGTCCTGG + Intronic
932584708 2:73020462-73020484 TTCTCTGCTCCCCTTTGGCCAGG + Intronic
934176802 2:89584353-89584375 GTCTCCCTTGCCCACTGGCGCGG - Intergenic
934287109 2:91658713-91658735 GTCTCCCTTGCCCACTGGCGCGG - Intergenic
934774472 2:96928407-96928429 GGCACTCCTCCCCACAGGCAGGG + Intronic
937309055 2:120890880-120890902 CTCTCTCCTCCCCACTACCTGGG - Intronic
938981907 2:136534989-136535011 GTCACTCAACCCCACTGCCCTGG - Intergenic
939702566 2:145411780-145411802 GTCTTTCCTCCCCAATGCCCAGG - Intergenic
941503890 2:166315696-166315718 ATCTTGCCACCCCACTGGCCTGG - Intronic
943512264 2:188840610-188840632 GTCTTTGCTACCCACAGGCCTGG + Intergenic
945891575 2:215436128-215436150 GTCTCTCCTCCCCCGCGCCCCGG - Exonic
946426761 2:219602618-219602640 GGCCCTCCTCCCCAAAGGCCTGG - Intronic
947500634 2:230668495-230668517 GTTGCTCCTCCCCAGTGTCCAGG + Intergenic
947746201 2:232508490-232508512 GCCCCTCCTCCCCACCTGCCAGG - Intergenic
948190060 2:236051551-236051573 GGCACACCTCCCCACAGGCCCGG - Intronic
948466860 2:238156452-238156474 GGCCCTCCTGCCCACTGGACAGG - Intergenic
948753933 2:240148469-240148491 GTCTCCCATCTCCACTGGCGGGG + Intergenic
948900716 2:240955694-240955716 GCCCCTCCTCCCCAGTGGCAGGG + Intronic
1168806814 20:676489-676511 GTCTCCCCTCCCCCCTGCTCGGG + Intergenic
1169112543 20:3043362-3043384 GTCTCACCTTCCCACTTCCCAGG - Intergenic
1169499795 20:6148314-6148336 GGCTCCCCTTCCCATTGGCCTGG - Intergenic
1169939304 20:10919734-10919756 GTCTTTCCTCCCCACTGCAAAGG - Intergenic
1170011503 20:11728552-11728574 GTCTCTCCTGCCTGCTGGCTCGG + Intergenic
1171386002 20:24769919-24769941 GTCACGCCCCACCACTGGCCAGG + Intergenic
1171966220 20:31532938-31532960 GTCTTTCCTCCTCTCTGGGCAGG + Intronic
1172361324 20:34314641-34314663 GTCTTTTTTCCCCACTGGCTAGG - Intergenic
1172596696 20:36155019-36155041 GACCCTCCCCCACACTGGCCAGG - Intronic
1173220151 20:41125800-41125822 TTCTTTCATCCCCAGTGGCCAGG - Intergenic
1173999102 20:47361334-47361356 GTTTCTCCCTCCCACTGGACCGG + Intergenic
1175032532 20:55970107-55970129 TTCTCTCTTCTCCACTGGCCTGG + Intergenic
1175189641 20:57202622-57202644 GTCTCTCCTCCTCTCTCGCAGGG - Exonic
1175812961 20:61868665-61868687 ATGTCCCCTCCACACTGGCCGGG + Intronic
1175840049 20:62020978-62021000 GTCTTTCCTTCCCAGTGGTCTGG - Intronic
1175866315 20:62179089-62179111 GTCCCTCCTACCCCCTGTCCGGG + Intronic
1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG + Intronic
1176094540 20:63333881-63333903 CTCTCCCGTCCCCACTGCCCTGG - Intronic
1178414015 21:32389242-32389264 GTCACCCCTCCCCACTCACCTGG - Intronic
1179110702 21:38442699-38442721 GTCTCCTCTCCCTCCTGGCCAGG - Intronic
1179194230 21:39150647-39150669 CTCTCTCCTCCCCAAAGGACGGG + Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179975251 21:44861752-44861774 ACCTCTCCTCCCCACACGCCGGG + Intronic
1180261309 21:46670967-46670989 GTCTCCCTTCCGCACTGCCCAGG + Intergenic
1181085267 22:20436850-20436872 GACTCGCCCCCCCACCGGCCGGG + Intronic
1181366607 22:22381357-22381379 GTCTCAGTTCCCCATTGGCCTGG - Intergenic
1181369452 22:22404731-22404753 GTCTCAGTTCCCCATTGGCCTGG - Intergenic
1181505592 22:23354275-23354297 GCATCTCCTCCCCATTGTCCAGG + Intergenic
1181943376 22:26496316-26496338 GTTTCTCCTCCCCACTTCGCAGG - Exonic
1182519303 22:30876401-30876423 GCCTCACCGCCCCACTGCCCTGG + Intronic
1183218031 22:36493798-36493820 CTCTCTCCTCCCCACAGAACAGG - Exonic
1184167100 22:42736071-42736093 GCCTCTCAGCCCCACTGACCAGG + Intergenic
1184792055 22:46706230-46706252 GTCTGTCTTCCCCACAGGCAGGG - Intronic
1184803483 22:46776676-46776698 CTCTCTCCTCCCCACGGCCATGG - Intronic
949519096 3:4833574-4833596 CTCTCTCCTCTCCCCTGGTCTGG + Intronic
949918277 3:8981831-8981853 CTCTCTCCTGACCCCTGGCCTGG + Exonic
949920966 3:9000199-9000221 GTCTCTCCACTCCACTCACCTGG - Intronic
949981889 3:9507233-9507255 GTCTCCCCACCCCGCAGGCCTGG - Intronic
954151368 3:48658947-48658969 GTCGCAGCTCCCCACTGGTCTGG + Exonic
954577706 3:51685948-51685970 GGCTCTGCTCCCCTCTGGCCTGG + Intronic
954773963 3:52999355-52999377 GTGGCTCCTCCCCGCAGGCCTGG - Intronic
955997785 3:64695247-64695269 CCCTCTCCTCCACACTGACCAGG + Intergenic
956294355 3:67695779-67695801 GATTCTCCTACCCACTGGTCAGG - Intergenic
956682861 3:71797657-71797679 GTGACTTCTCCCCACTGGCAAGG - Intergenic
960573833 3:119210235-119210257 CTCTTGCCTCCCCACTGGGCAGG - Intergenic
961509265 3:127391116-127391138 CCTCCTCCTCCCCACTGGCCAGG - Intergenic
961642964 3:128376334-128376356 GGCTTTCCTCACCACTGGCATGG + Intronic
962933502 3:140058915-140058937 GTCTCTGCTCCCTGCTGGTCAGG - Intronic
966417833 3:179707579-179707601 GTCTTTCTTCCCCACTTCCCTGG + Intronic
968582506 4:1401611-1401633 GACACTGCTGCCCACTGGCCTGG - Intergenic
968973786 4:3810644-3810666 GTCTCTCCTGACCATTGGTCGGG + Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
969432019 4:7160952-7160974 GTCTGTCTCCCCCACTAGCCTGG - Intergenic
969728390 4:8939251-8939273 CTGTCTCCTCCCTGCTGGCCTGG + Intergenic
969859291 4:10023086-10023108 GTGCCTCCTCCACACTGTCCTGG - Intronic
971237623 4:24856875-24856897 GTCACTGCTGCCCAATGGCCTGG - Intronic
972335943 4:38107168-38107190 GTCTCCTCTCCCCACTGGAACGG + Intronic
972630321 4:40836525-40836547 GTCTTTCTTCCCCAGTCGCCAGG - Intronic
972670044 4:41206496-41206518 GTCTCTCTTCACCAGTGTCCTGG + Intronic
973107317 4:46356368-46356390 GTCTCTCCACACCCCTGGCCAGG + Intronic
973532555 4:51847486-51847508 ATCTCTCCTTGCCACTGACCAGG - Intronic
973782231 4:54299643-54299665 GTCTCTGCTCCACATTGCCCAGG + Intergenic
978443776 4:108761912-108761934 CTCTCTCATGCCCACTGGCCCGG + Intronic
978605695 4:110476648-110476670 CGCTCTCATCCTCACTGGCCGGG - Exonic
978857293 4:113407627-113407649 CACTCTCCTCGCCATTGGCCAGG - Intergenic
981078831 4:140618203-140618225 GTTTCTCCTCCTCACTTTCCTGG - Intergenic
981606548 4:146546513-146546535 GTCACTTCTCCTCACTGGGCTGG - Intergenic
983646170 4:169993668-169993690 GTTCCTCCTGCCCACTGGCCAGG + Intronic
984956319 4:185049553-185049575 TTCTATCGTCCCCACTGGCAAGG + Intergenic
985038307 4:185863024-185863046 GTCCCACCTCTCCACTGGCCTGG - Intronic
985791022 5:1926804-1926826 TTCCCTCCTCCCCCATGGCCAGG + Intergenic
986070074 5:4274211-4274233 GTCTCTCCACTCCACTGGCTAGG - Intergenic
989081971 5:37631904-37631926 GGCTCTCCTCCCCACTCACCCGG - Intronic
990745168 5:58951473-58951495 GCCTCCCCTCCCCAGTGGCTGGG - Intergenic
993018558 5:82563943-82563965 CTCACTTCTCCCCACTGGGCAGG + Intergenic
993633653 5:90318038-90318060 CTCTCTCCTCCCCAGAGGTCAGG + Intergenic
994238095 5:97389305-97389327 GTCTCTCCTGTCCACTGTGCTGG + Intergenic
998006579 5:138661319-138661341 GTCCCTCATCCCCCCTGTCCAGG + Intronic
999179240 5:149657269-149657291 GTCTCCTCTCCCCACTGCCTTGG + Intergenic
999288314 5:150407257-150407279 GACTCTGCTCCTCGCTGGCCAGG - Exonic
1001090211 5:168734444-168734466 GTCTCTCCTCCCTCCTTGCCAGG + Intronic
1002148330 5:177204802-177204824 GTTTTTCCTCCCCAGTGGGCTGG + Intronic
1002349899 5:178576684-178576706 CTCTCTCCTCCCCACGGCCGCGG + Intronic
1002419802 5:179139608-179139630 GTCTCTCCTGGCCACGGGCATGG - Intronic
1002447425 5:179297987-179298009 GTCCCTCCTCCCCAGGGCCCCGG + Intronic
1002575349 5:180170942-180170964 GCCCCTCCTCCCCACTCTCCAGG - Intronic
1002789732 6:428245-428267 CTCTTTCCACCCCACTGTCCCGG - Intergenic
1003105554 6:3212365-3212387 GTCTCTCTCCCCCGCTGGCTTGG + Intergenic
1003594609 6:7463180-7463202 TTCTCTCCTCCCCAGTCCCCTGG - Intergenic
1004873316 6:19929799-19929821 GGCTCTCTTCCCCATTGGCAAGG + Intergenic
1005345560 6:24886430-24886452 GTCCCTCCTCCCCACATTCCAGG + Intronic
1006986255 6:38177608-38177630 GTCTCTGCTCCGCACTGCGCTGG + Intronic
1007764549 6:44152853-44152875 CCCCCTCCTCCCCACAGGCCAGG - Intronic
1007880407 6:45159068-45159090 TTCTCTCCTCCCCACTGAAGGGG + Intronic
1009289802 6:61868425-61868447 TTCATTCCTCCTCACTGGCCGGG - Intronic
1010158598 6:72824973-72824995 GTCTCTCCTGCCCACTTCTCTGG - Intronic
1010236522 6:73579525-73579547 GCCTCTCCTCCCTATTGTCCTGG - Intergenic
1011226040 6:85108381-85108403 GTCTCTCCACCGCAATGCCCAGG + Intergenic
1013844170 6:114429087-114429109 CTCTCTCCTCCCGACTGGACAGG + Intergenic
1015024735 6:128519958-128519980 TTCTCTCTTCCCCACTAGCCCGG + Intronic
1015660569 6:135569844-135569866 GACTCCCCTCTCCACTGGCCTGG + Intergenic
1016395835 6:143622406-143622428 ATCTGGTCTCCCCACTGGCCAGG + Intronic
1016843260 6:148544916-148544938 GTGTCTCCTGTCCACTGGGCGGG - Intronic
1017777699 6:157692360-157692382 ATCTGTCCTTCCCACTGGCCAGG + Intergenic
1017935618 6:159002254-159002276 GTCCCTCGTCCCCACTCCCCTGG + Intergenic
1018427894 6:163699900-163699922 CACTCTCCTCTCCCCTGGCCAGG - Intergenic
1018924248 6:168195338-168195360 GTCTCTGCTCCACACGGGCCGGG + Intergenic
1019295319 7:270768-270790 GCCTCTCCTGCCCTCTGGCCTGG + Intergenic
1019335331 7:480080-480102 GTCTTCCCTGCCCGCTGGCCGGG - Intergenic
1019385795 7:755365-755387 GCCTCTCCTCCTCACTAGGCCGG + Intronic
1019619991 7:1987229-1987251 GACTCTCCTCCCCACTGGATGGG + Intronic
1021711061 7:23415645-23415667 CTCTCTCCTCCCCACATCCCAGG + Intronic
1024125986 7:46295063-46295085 TGCTGTCCTCCCCAATGGCCAGG + Intergenic
1024984062 7:55180744-55180766 GCCTCCCTTCCCCACAGGCCAGG - Intronic
1026994805 7:74608494-74608516 GCCTCGCCTCCCAACTGGCTGGG + Intergenic
1028488749 7:91387823-91387845 GCCTCTACTTCCCACTGTCCAGG + Intergenic
1032184512 7:129712634-129712656 ATCTCTCTTCCCCACTAGACTGG - Intronic
1033230196 7:139591376-139591398 CTCTCTCTTCCCAACTGGCCTGG + Intronic
1033465215 7:141583375-141583397 CTCTCTCCTCTCCACTTTCCTGG - Intronic
1033743734 7:144294383-144294405 GGCTCCCCTCCCCGCCGGCCCGG - Intergenic
1033750167 7:144355214-144355236 GGCTCCCCTCCCCGCCGGCCCGG + Intergenic
1034936311 7:155202995-155203017 GTGTCTCCTCCCCACTCAGCTGG - Intergenic
1035075190 7:156173213-156173235 CTGTCTCCTCCCCAAGGGCCAGG + Intergenic
1035375754 7:158405504-158405526 GTCTCTCCTCCACACTGGAAGGG + Intronic
1035897829 8:3423822-3423844 GTCTCTCCTCACAACTGGGATGG + Intronic
1036709130 8:11067137-11067159 TTCTCCCCTCCCCACCAGCCTGG - Intronic
1037584183 8:20265157-20265179 CTCTCTCCTTCCCACTGGGGCGG + Intronic
1037991920 8:23327443-23327465 ATATCCCCTCCCCACTGGACAGG + Intronic
1038471406 8:27826067-27826089 ATCTGTCCCCCCCACTGTCCTGG - Intronic
1038662289 8:29507549-29507571 CTCTCTCCTCCCCACCTGCTTGG - Intergenic
1039805019 8:40990340-40990362 CTCACTCCACCACACTGGCCCGG - Intergenic
1041720068 8:60967676-60967698 GCCTCTCCTGCCCACTGCTCAGG + Intergenic
1042595133 8:70439360-70439382 GTTCCTCCTTCTCACTGGCCAGG - Intergenic
1043377226 8:79664226-79664248 GTCTTTCATCTCCACTGGTCAGG - Intronic
1044271210 8:90246372-90246394 GACTCTCCACCCCTCTGCCCTGG + Intergenic
1045273197 8:100679382-100679404 TTCTCTCCTCTCCACTTGCCAGG + Intergenic
1045320738 8:101080067-101080089 GCCTCTCCTCCCCACTGGACTGG - Intergenic
1045582902 8:103499745-103499767 GTCTCTCCTCCCTCCCCGCCCGG + Intergenic
1045737892 8:105318377-105318399 GTCTCCCCTCCCCACAGCCCCGG + Intronic
1046767208 8:118082784-118082806 GTCTTTCCTACCCACATGCCCGG + Intronic
1047885618 8:129247157-129247179 ATTTCTCCTCCTCACTGGTCAGG + Intergenic
1048656926 8:136549638-136549660 GTCCCTCATGCCCAATGGCCTGG + Intergenic
1049210597 8:141384826-141384848 GTCTGTCTTCTCCACTGGCCTGG - Intergenic
1049217666 8:141415447-141415469 GACCCTCCTGCCCTCTGGCCGGG + Intronic
1049270478 8:141693076-141693098 CTGTCTCCTCCTCTCTGGCCTGG - Intergenic
1051745034 9:20287388-20287410 GTCTCTCCTCACTCCTGCCCAGG + Intergenic
1055597234 9:77878007-77878029 GTCCCTCTTTCCCACTAGCCTGG + Intronic
1056074789 9:83027315-83027337 CTCTCTCCTCCCCAGAGGTCAGG + Intronic
1056580585 9:87886158-87886180 GTCTGTCATCCCCACTGGAAAGG + Exonic
1056956451 9:91085420-91085442 TTCTGTCCTCCTCACTTGCCTGG - Intergenic
1057569543 9:96193995-96194017 CTCTCCCCTCCCCACTGGAGTGG + Intergenic
1061441764 9:130609472-130609494 GCGTCTCCTCCCCCGTGGCCAGG + Intronic
1061489263 9:130936246-130936268 TTCTCTCCTCCCTTGTGGCCAGG - Intronic
1062346568 9:136118006-136118028 CTCCCTCCTCCGCCCTGGCCAGG - Intronic
1062436326 9:136548053-136548075 GCCTCACCTCCCCACCAGCCTGG + Intergenic
1062481336 9:136753918-136753940 CTTTCTCCTCCCGCCTGGCCTGG - Intergenic
1062491230 9:136806056-136806078 CTCTCTCCCCCGGACTGGCCAGG + Exonic
1203786925 EBV:133357-133379 GGATCTCCTCCGCCCTGGCCAGG - Intergenic
1187421165 X:19135032-19135054 GTCTCTCATCCCCACTGGAAGGG - Intergenic
1187577205 X:20569960-20569982 GTCATTCCTCCTCACTGTCCTGG + Intergenic
1189461924 X:41250111-41250133 ATCTCCCCTACCCACTGTCCTGG + Intergenic
1190952697 X:55161836-55161858 CTCTCTCCTCCCTACTCTCCTGG + Intronic
1191915342 X:66195076-66195098 GTCTCTCCTTCCCATTTTCCAGG + Exonic
1198325752 X:135571015-135571037 GTCTCATCTCCCCACTCTCCAGG - Intronic