ID: 1113816023

View in Genome Browser
Species Human (GRCh38)
Location 13:113171796-113171818
Sequence TGCGTGCCCAGCCGCTGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113816023_1113816027 -7 Left 1113816023 13:113171796-113171818 CCTCCTCAGCGGCTGGGCACGCA 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1113816027 13:113171812-113171834 GCACGCAATGGCACTGACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 64
1113816023_1113816029 12 Left 1113816023 13:113171796-113171818 CCTCCTCAGCGGCTGGGCACGCA 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1113816029 13:113171831-113171853 TGGGCAACTCGCTGACCACGCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1113816023_1113816031 28 Left 1113816023 13:113171796-113171818 CCTCCTCAGCGGCTGGGCACGCA 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1113816031 13:113171847-113171869 CACGCGGCCTGTCACACTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1113816023_1113816026 -8 Left 1113816023 13:113171796-113171818 CCTCCTCAGCGGCTGGGCACGCA 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1113816026 13:113171811-113171833 GGCACGCAATGGCACTGACCTGG 0: 1
1: 0
2: 2
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113816023 Original CRISPR TGCGTGCCCAGCCGCTGAGG AGG (reversed) Exonic
900005978 1:51742-51764 TGCGGTCCCAGCTGCTGGGGAGG + Intergenic
900410721 1:2511298-2511320 TGTGTCCCCAGCAGCAGAGGTGG + Intronic
900833818 1:4984907-4984929 TGCGTCCCCAGGGGCTGGGGAGG + Intergenic
902531118 1:17091283-17091305 TGCATGCCCAGCTGCCTAGGGGG - Intronic
906447472 1:45915050-45915072 TGTGGTCCCAGCTGCTGAGGTGG - Intronic
910055211 1:83025374-83025396 TGTGGTCCCAGCTGCTGAGGAGG + Intergenic
912783011 1:112571046-112571068 TGCGGTCCCAGCCACTTAGGAGG + Intronic
916884042 1:169049673-169049695 TGTGTGCCCAGCCACTCAGTGGG - Intergenic
917895763 1:179485171-179485193 TGCGTGCTCATCAGCTGTGGTGG - Intronic
920222779 1:204416513-204416535 TGTGTTCCCAGCCACTCAGGAGG + Intergenic
920396436 1:205649389-205649411 TGTGGTCCCAGCCGCTGGGGAGG - Intergenic
1064728304 10:18303381-18303403 TTTGTTCCCAGCCGCTCAGGGGG + Intronic
1065838362 10:29679675-29679697 TGCGGTCCCAGCTGCTCAGGAGG - Intronic
1067062304 10:43083717-43083739 GGCGGGCCCAGCAGCTGAGGGGG + Intronic
1072733729 10:97865543-97865565 TGCGAGCCCAGCTGCTGAGCAGG - Exonic
1072956817 10:99894155-99894177 TGTGGTCCCAGCCACTGAGGTGG + Intronic
1073425903 10:103455350-103455372 TCCTGGCCCAGCCGCAGAGGCGG + Exonic
1074718866 10:116247603-116247625 TCAGTGCCCAGCCTCAGAGGTGG - Intronic
1077223347 11:1426982-1427004 TGCGTGCCGGGGCGGTGAGGGGG + Intronic
1079195663 11:18324170-18324192 TGTGATCCCAGCCGCTGGGGAGG - Intronic
1079306822 11:19330690-19330712 TGACTGCCCAGCTGCTTAGGAGG + Intergenic
1083299980 11:61735193-61735215 TGCTTTCCCAGCCCCAGAGGTGG - Intronic
1083899624 11:65637269-65637291 TGCAGGCCCAGGGGCTGAGGTGG - Exonic
1084474228 11:69379693-69379715 TGAGGCCACAGCCGCTGAGGTGG + Intergenic
1085013360 11:73156778-73156800 TGTGTACCCAGCAGCAGAGGTGG + Intergenic
1085569563 11:77547472-77547494 TGCGTGCCCAGTTACTCAGGAGG - Intronic
1085713638 11:78852869-78852891 TGCGGTCCCAGCTGCTCAGGAGG - Intronic
1086090967 11:83004463-83004485 TGCTTGCCCAGAAGCTGTGGAGG + Intronic
1086380252 11:86245071-86245093 ATCGCGCCCAGCCGCCGAGGCGG - Exonic
1088259904 11:107934310-107934332 TGCATCCCCAGCTGCTCAGGAGG + Intronic
1088517726 11:110656715-110656737 TGCATGCTCAGCCACTGAGGTGG + Intronic
1089322383 11:117635091-117635113 TGGATGCGCAGCCCCTGAGGTGG + Intronic
1089783439 11:120891141-120891163 TGCACGCCCTGCCGCTGAGGGGG - Intronic
1090817431 11:130311328-130311350 TGTGTTCCCAGCTGCTCAGGAGG - Intronic
1090910950 11:131118810-131118832 TGCGGTCCCAGCTGCTCAGGAGG - Intergenic
1091224016 11:133946935-133946957 TGCCAGCCCTGCCGCAGAGGGGG + Intronic
1091252073 11:134152792-134152814 TGAGTGCCAGGCCCCTGAGGAGG + Exonic
1092336543 12:7639160-7639182 TGCGGTCCCAGCTGCTCAGGAGG + Intergenic
1094473186 12:30822474-30822496 TGCCTGCCCAGCTGCTGGGCTGG + Intergenic
1097020541 12:56017598-56017620 GGCCTCCCCAGCCTCTGAGGTGG - Intronic
1101282869 12:103277739-103277761 TGTGGTCCCAGCTGCTGAGGAGG - Intronic
1101605789 12:106247253-106247275 TGCCTGCCCAGGCCCGGAGGCGG - Intronic
1101876960 12:108602509-108602531 TGCGTGCAAAGGCCCTGAGGTGG + Intergenic
1102485210 12:113250842-113250864 TGCATGCCCAGCTACTCAGGAGG + Intronic
1103960724 12:124607510-124607532 TACGTGCCAAGGCCCTGAGGTGG - Intergenic
1104773061 12:131376212-131376234 TGCCTGCCCACTCCCTGAGGGGG - Intergenic
1113552956 13:111207288-111207310 TGCAGACCCAGCTGCTGAGGAGG - Intronic
1113816023 13:113171796-113171818 TGCGTGCCCAGCCGCTGAGGAGG - Exonic
1113940761 13:114017575-114017597 TGCGTGGCCACCAGCTCAGGAGG + Intronic
1117203275 14:53414220-53414242 TGGGTGCCCAGACACTGATGTGG - Intergenic
1121968556 14:98334771-98334793 TGCTGGCCCAGCTTCTGAGGGGG - Intergenic
1122276517 14:100593497-100593519 TGTGGGCCCAGCTACTGAGGAGG + Intergenic
1122289407 14:100672117-100672139 TGCGTGCAAAGGCCCTGAGGTGG + Intergenic
1122469330 14:101955718-101955740 TGCGTGCCCAGCTGGCGAGGCGG + Intergenic
1125629345 15:41134426-41134448 TGCATGATCAGTCGCTGAGGAGG - Intergenic
1125698121 15:41656461-41656483 TGCGGTCCCAGCCACTCAGGAGG - Intronic
1126027626 15:44462992-44463014 ATCGTGCCCAGCCACTCAGGAGG + Intronic
1128151010 15:65363488-65363510 TGCTTGCCCAGCCCCAGAGTCGG + Intronic
1128548871 15:68584931-68584953 TGCGGGACCAGCTGCTAAGGAGG + Intronic
1129466442 15:75726932-75726954 TCCCTGCCCTGCTGCTGAGGTGG + Intronic
1129609175 15:77039285-77039307 TTGGTTCCCAGCAGCTGAGGTGG - Intergenic
1129808613 15:78486789-78486811 TGCGGTCCCAGCCACTCAGGAGG - Intronic
1131328174 15:91469133-91469155 TGGATGCCCAGGAGCTGAGGAGG - Intergenic
1132447537 15:101939181-101939203 TGCGGTCCCAGCTGCTGGGGAGG - Intergenic
1132546606 16:536100-536122 CGTGTGCCCAGGCCCTGAGGTGG + Exonic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1132831326 16:1929810-1929832 TGCGTGCGCAGGCGCGGCGGGGG - Intergenic
1133031793 16:3014525-3014547 TGCCTGCCCAGCCCCAGCGGCGG - Intergenic
1133797324 16:9056753-9056775 TGTAGGCCCAGCTGCTGAGGAGG - Intergenic
1136649167 16:31651644-31651666 TGCATTCCCAGCCACTCAGGAGG - Intergenic
1137578922 16:49621663-49621685 TGGCTGCCCTGCCGCTGACGGGG - Intronic
1137727308 16:50665525-50665547 TGCGTTCGGAGCCGCCGAGGCGG + Intergenic
1139921919 16:70466060-70466082 TGCCTGCACAGCTGATGAGGTGG + Intronic
1140826396 16:78710734-78710756 TGCGGTCCCAGCCACTCAGGAGG - Intronic
1141146276 16:81532570-81532592 GGCTTGCCCAGCAGCTGAGTCGG + Intronic
1141286033 16:82672934-82672956 TGCGGTCCCAGCTGCTCAGGAGG - Intronic
1141997378 16:87644212-87644234 TGAGTGCCCAGCGACAGAGGAGG - Intronic
1142981889 17:3677244-3677266 TTCAGGCCCAGCCTCTGAGGAGG + Intronic
1143057542 17:4173544-4173566 TGCGTGGCCAGTCGCTGCTGTGG - Intronic
1143303205 17:5926363-5926385 TGCGCGCCCAGCCAGTGAAGAGG - Intronic
1143930685 17:10420200-10420222 TGCGAGCTCAGACGCTGAGATGG - Exonic
1144703586 17:17353543-17353565 GGCAGGCCCAGCCACTGAGGTGG + Intergenic
1145052771 17:19676529-19676551 TGTGTTCCCAGCTGCTTAGGAGG + Exonic
1145281465 17:21470372-21470394 TGTATTCCCAGCTGCTGAGGTGG + Intergenic
1145395961 17:22495233-22495255 TGTATTCCCAGCTGCTGAGGTGG - Intergenic
1147427953 17:40355223-40355245 TGTGTTCCCAGCTGCTCAGGGGG + Intronic
1149296392 17:55265649-55265671 GGCGTGCCCGGCCGCGGAGGGGG - Intronic
1150427485 17:65088008-65088030 TTCATGACCAGCCCCTGAGGGGG - Intergenic
1151975595 17:77482133-77482155 TCCTTCCCCAGCCACTGAGGCGG + Exonic
1152472178 17:80495834-80495856 TGCCTGCTCCGCCACTGAGGTGG - Intergenic
1152677845 17:81650860-81650882 GGCCTGGCCAGCCCCTGAGGGGG + Exonic
1154315592 18:13301030-13301052 TGTGTGCCCTGCAGCTGAAGGGG + Intronic
1157117175 18:44872820-44872842 TGCATGCCCAGCCACAGTGGTGG + Intronic
1158029321 18:52943869-52943891 TGCGGCCCCAGCTGCTCAGGAGG - Intronic
1158381005 18:56930049-56930071 TGCCGGCCCAGCTGCTGAAGGGG + Intronic
1160637735 19:93348-93370 TGCGGTCCCAGCTGCTGGGGAGG + Intergenic
1161790661 19:6357972-6357994 TGCCTGCCCTGCCTCTGACGTGG - Intergenic
1162044957 19:7992895-7992917 TGCGTTCCCAGCTACTCAGGAGG - Intronic
1162435940 19:10658739-10658761 TGCAATCCCAGCTGCTGAGGAGG + Intronic
1162464121 19:10830465-10830487 TACGTGCCCAGCTGCTGGAGTGG + Intronic
1165740650 19:38203387-38203409 TGCGTGCACAGGCACAGAGGCGG - Intronic
1165857543 19:38888988-38889010 TGCGTGCCCAAGAGCTCAGGCGG - Intronic
1166325920 19:42051187-42051209 GGCGAGACCAGCGGCTGAGGAGG + Intronic
1167449151 19:49556847-49556869 TGCGTGCCGGGGCGCTGTGGGGG + Intronic
1168151735 19:54452754-54452776 TGAGTGCCCAGCCAGTGGGGCGG + Intronic
1168263862 19:55210491-55210513 TGTGTGCCCAGCTACTCAGGAGG + Intergenic
1168646350 19:58061413-58061435 TGGGTGCCCTGCTGATGAGGTGG - Intronic
925395312 2:3529407-3529429 TGTGGTCCCAGCCGCTCAGGAGG + Intergenic
925918887 2:8625914-8625936 AGAGTGCCAAGCAGCTGAGGCGG - Intergenic
926456824 2:13076880-13076902 GTCCTGCCCAGCCACTGAGGAGG + Intergenic
927647661 2:24888226-24888248 TGCCTGTCCAGCCTCTGAGGTGG + Intronic
930422542 2:51171503-51171525 TGCAGGCCCAGCCTCTGAAGAGG - Intergenic
931705522 2:64943534-64943556 TGTGGTCCCAGCCGCTCAGGAGG + Intergenic
932463640 2:71899035-71899057 TGTGTGCGCAGCCGCAGAGCAGG - Intergenic
932689478 2:73900212-73900234 TGCCTGCCCAGCCCCTCAGCTGG + Intronic
933641696 2:84769182-84769204 TGCGGATCCAGCCGCTGAGAAGG + Intronic
936059557 2:109285547-109285569 TGGGAGCCCAGAGGCTGAGGTGG + Intronic
937333870 2:121048598-121048620 TGTGGGCCCAGCCGCTGGGGAGG + Intergenic
937954798 2:127416150-127416172 TGCGCTGCCAGCCGATGAGGCGG + Intergenic
938079811 2:128363899-128363921 TGGGTGGCCAGCCGAAGAGGAGG - Intergenic
940974880 2:159931410-159931432 TGCGGGCCCAGCTACTCAGGAGG + Intergenic
942801005 2:179875440-179875462 TGCATGGCCAGCCGAAGAGGAGG + Intergenic
944529543 2:200653626-200653648 TCCCTGCCCAGCAGCTGAGGGGG + Intronic
947653916 2:231810239-231810261 TGAGCTCCCAGCCACTGAGGAGG + Intergenic
948829653 2:240592129-240592151 TGCGTGCTCAGCCCCAGAGCAGG + Exonic
1170568313 20:17619042-17619064 TCCGTTCCCAGCTGCTTAGGAGG - Intronic
1171960413 20:31489558-31489580 TGTGTTCCCAGCTGCTCAGGAGG + Intergenic
1172414138 20:34750321-34750343 TGCATGCCCATCAGCTGAGATGG + Exonic
1173505486 20:43583838-43583860 TGCATGCCCAGCTACTCAGGAGG + Intronic
1174225314 20:48994116-48994138 TGAGTGCCAAGGCCCTGAGGTGG + Intronic
1174410290 20:50330715-50330737 TGTCTGCCCAGCCTCAGAGGAGG - Intergenic
1175517340 20:59577746-59577768 TGCGCCCCCAGCCACAGAGGTGG + Intronic
1176166914 20:63679212-63679234 TGAGCGCACAGCCGCCGAGGTGG + Intronic
1176233066 20:64041814-64041836 TGCGCGCCCCACCGCTGAAGGGG - Intronic
1183126311 22:35784842-35784864 TGCGTTGCCGGCCGCTGCGGTGG + Intronic
1185325072 22:50221548-50221570 TGCCTCCCCAGGAGCTGAGGGGG + Exonic
954270653 3:49505791-49505813 TGCATGCCCAGCTACTCAGGAGG - Intronic
954655406 3:52191333-52191355 TGTCTGCCCAGCAGCTCAGGAGG + Intergenic
955462761 3:59202853-59202875 TTAGTGCCCAGCTGCTCAGGAGG - Intergenic
959693746 3:109227171-109227193 TGTGGGCCCAGCTACTGAGGAGG + Intergenic
960969846 3:123131540-123131562 TGCTTGCCCAGGAGCTGAGAGGG + Intronic
961305676 3:125958214-125958236 AGCGTGCCCCGCCGGCGAGGGGG + Intergenic
961628424 3:128279489-128279511 GGCAGGCCCAGCAGCTGAGGGGG - Intronic
962259898 3:133895635-133895657 TGCGTGTCCGGCGGCGGAGGAGG + Exonic
963620661 3:147601432-147601454 TGCCTGCCCAGCTACTCAGGAGG - Intergenic
965722031 3:171672607-171672629 TGCGGTCCCAGCCACTTAGGAGG - Intronic
968063113 3:195741251-195741273 TGTGGTCCCAGCTGCTGAGGAGG + Intergenic
968522132 4:1038804-1038826 TGCGTGCCCAGATACTCAGGAGG - Intergenic
968573048 4:1352432-1352454 TGGGTGCCCAGACAATGAGGAGG + Intronic
968573084 4:1352613-1352635 TGCAGGCCCAGCTGCTGAGCTGG + Intronic
968830591 4:2931417-2931439 AACGTCCCCAGCCGATGAGGAGG + Exonic
968838017 4:2979755-2979777 TGTGGTCCCAGCTGCTGAGGAGG + Intronic
974671265 4:65033182-65033204 TGCAGTCCCAGCCACTGAGGAGG + Intergenic
975542059 4:75523678-75523700 TGCCTACCCAGCTGCTCAGGAGG + Intronic
975689422 4:76949638-76949660 TGCGCGCCCGGCCGCGGTGGTGG - Intergenic
976303990 4:83541337-83541359 TGTGGGCCCAGCCACTCAGGAGG - Intronic
976614731 4:87064915-87064937 TGCGGTCCCAGCTGCTCAGGAGG + Intronic
977591767 4:98834852-98834874 TGCATGCCCAGCTACTCAGGAGG + Intergenic
978994380 4:115131500-115131522 TCCATGCTCAGCCCCTGAGGAGG - Intergenic
982378779 4:154725122-154725144 TGCGTTCCCAGCTACTCAGGAGG + Intronic
984992635 4:185396278-185396300 TGCGTTCCCCGGCGCCGAGGCGG + Intronic
985022257 4:185704438-185704460 TGCGATCCCAGCTGCTCAGGAGG - Intronic
987146954 5:15000999-15001021 TTCGTGCCCAGCCCCTGGAGCGG + Intergenic
990562737 5:56999671-56999693 TGGGCGCCCAGCTGCTTAGGAGG - Intergenic
992396635 5:76374751-76374773 TGTGGTCCCAGCTGCTGAGGAGG + Intergenic
997356082 5:133263871-133263893 TGGGGGCCCAGCCTCTGATGGGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1006141106 6:31930470-31930492 TGCATTCCCAGCTACTGAGGAGG - Intronic
1006239928 6:32668717-32668739 TGCCTGCCCAGCCTCTGTGGAGG + Intergenic
1006391487 6:33761494-33761516 TGCATCCCCAGCGACTGAGGTGG - Intergenic
1007591445 6:43023275-43023297 TGTATTCCCAGCCACTGAGGAGG + Intronic
1009247338 6:61255140-61255162 TGTGTGCCCAGCTACTTAGGAGG - Intergenic
1016804503 6:148199250-148199272 TGGGTGCCCAGCTACTCAGGAGG + Intergenic
1019612058 7:1941609-1941631 TGCATGCGTAGCGGCTGAGGAGG - Intronic
1026788263 7:73315479-73315501 TGTGGGCCCAGCTACTGAGGAGG - Intronic
1029385672 7:100241910-100241932 TGAGTGCCCAGCTACTCAGGAGG + Intronic
1029926776 7:104327678-104327700 TCTGTGCCCAGACGCTGAGCTGG - Intergenic
1031211904 7:118839885-118839907 TGTGTTCCCATCCGCTCAGGAGG - Intergenic
1033707428 7:143902694-143902716 TGTGGTCCCAGCCTCTGAGGTGG - Intergenic
1034869373 7:154670147-154670169 ACCGTGCCCAGCCTCTGCGGAGG + Intronic
1035083561 7:156237124-156237146 TGCGTGCCAGGCTGCTGAAGAGG + Intergenic
1035303874 7:157917138-157917160 TGCGTGGCCAGCCCCTGCCGTGG - Intronic
1038423932 8:27452444-27452466 TGCAAGCCCAGCGGCTCAGGAGG + Intronic
1039901047 8:41752772-41752794 TGTGTGCCCAGCAGCGCAGGAGG - Intronic
1047509729 8:125506926-125506948 GGCGTGCCCAGCCCTTGAGCAGG + Intergenic
1049428031 8:142545908-142545930 TGCGCGCCAAGCTGCAGAGGCGG + Intergenic
1050612491 9:7367353-7367375 TGCGGTCCCAGCTGCTCAGGAGG + Intergenic
1051059031 9:13024864-13024886 TGTGTGCCCAGCTACTCAGGAGG - Intergenic
1052331451 9:27273769-27273791 TGCCTGCCCAGCTACTCAGGAGG + Intergenic
1052506563 9:29361470-29361492 TGCAATCCCAGCTGCTGAGGAGG - Intergenic
1052949208 9:34194434-34194456 TGTGGTCCCAGCTGCTGAGGAGG - Intronic
1053123091 9:35560618-35560640 GGCCTGCCCTGCCTCTGAGGAGG + Exonic
1059193083 9:112345495-112345517 TGCGGTCCCAGCTACTGAGGAGG - Intergenic
1061398143 9:130354567-130354589 GGCGCGCCCAGGGGCTGAGGAGG + Intronic
1062278051 9:135739843-135739865 GGAGTGCCCAGCCGCAGGGGTGG + Intronic
1062319434 9:135983135-135983157 TCCTTGCCCAGCAGCCGAGGGGG + Intergenic
1062491097 9:136805256-136805278 TACCTGCCCAGCTGCTGGGGCGG - Intronic
1062534021 9:137013706-137013728 TGCGTGCCCAGCCTCAGGTGTGG + Intronic
1198684787 X:139216621-139216643 TGTGGTCCCAGCCGCTCAGGAGG - Intronic
1200072887 X:153537719-153537741 TCCTTGCCCAGCCCCCGAGGAGG + Intronic