ID: 1113816523

View in Genome Browser
Species Human (GRCh38)
Location 13:113175528-113175550
Sequence TACCCAACACTGCAAGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113816520_1113816523 11 Left 1113816520 13:113175494-113175516 CCCATGCAGAGCAGCAGGGAAGA 0: 1
1: 0
2: 0
3: 35
4: 278
Right 1113816523 13:113175528-113175550 TACCCAACACTGCAAGAGAACGG 0: 1
1: 0
2: 0
3: 9
4: 145
1113816521_1113816523 10 Left 1113816521 13:113175495-113175517 CCATGCAGAGCAGCAGGGAAGAT 0: 1
1: 0
2: 0
3: 35
4: 337
Right 1113816523 13:113175528-113175550 TACCCAACACTGCAAGAGAACGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113816523 Original CRISPR TACCCAACACTGCAAGAGAA CGG Intergenic
900495218 1:2973112-2973134 TCCCCTACCCTGCAGGAGAAGGG + Intergenic
901275643 1:7988955-7988977 TCCCAAACACTGTCAGAGAAAGG - Intergenic
902103484 1:14013517-14013539 TACCCACCACTGTCAGAGGATGG + Intergenic
909919336 1:81361030-81361052 TGCCCAACAGTGCAAGATTAGGG - Intronic
910113141 1:83702994-83703016 CACACAACCCTGCAAGAAAAGGG - Intergenic
910485417 1:87708192-87708214 TTCCCAACACTGCAGGAGGCAGG + Intergenic
911050140 1:93663996-93664018 TACCCTAGACTGTAAGAAAAAGG - Intronic
912645760 1:111390296-111390318 TATCTAACATTGAAAGAGAAGGG - Intergenic
917051408 1:170928750-170928772 TATGAAAAACTGCAAGAGAATGG + Intergenic
921720454 1:218465043-218465065 TACCCTAGAATGCATGAGAAAGG + Intergenic
922243254 1:223770812-223770834 TAACCAACCCTGCACCAGAAAGG - Intronic
923912576 1:238464985-238465007 AAGCCAACACTGAATGAGAAAGG - Intergenic
1065329769 10:24583468-24583490 TACCCACCACAGCAAGAAAGAGG + Intergenic
1068537240 10:58253938-58253960 TACTCAAAACATCAAGAGAAAGG - Intronic
1069700826 10:70424205-70424227 TCCCCAAGACAGCAAGAAAAAGG - Exonic
1071191382 10:83105356-83105378 TACCTGACACTGCCAGGGAATGG - Intergenic
1074870801 10:117574500-117574522 AACCCAACACTGCAACAGTCCGG + Intergenic
1075352644 10:121737616-121737638 GACCTAACTCTGCAAAAGAAAGG - Intergenic
1075871608 10:125775253-125775275 TCCCCAACACCGCAATAGTAAGG - Intronic
1079159717 11:17980426-17980448 TACCCCTCAGTGCAAGAGACTGG - Intronic
1080128767 11:28768309-28768331 TTCTCAAAACAGCAAGAGAAAGG + Intergenic
1083060980 11:59871641-59871663 TACACAAAACTTCAAGAGAAAGG - Intergenic
1090083803 11:123633387-123633409 TCTCCATTACTGCAAGAGAATGG - Exonic
1092160464 12:6312769-6312791 TACCCACCACTGGAGGAGTAGGG - Intronic
1094095705 12:26702251-26702273 AAACCAACATTGCAAGAGAAAGG + Intronic
1095362544 12:41360765-41360787 TAACCGACACAGGAAGAGAATGG + Intronic
1095457454 12:42403846-42403868 TACCTAACACTGGTAGAGAGTGG - Intronic
1095902153 12:47339148-47339170 TCCCCAACACTACATGAGAGAGG + Intergenic
1096647343 12:53046053-53046075 TACCAGGCACTGCAAAAGAAGGG + Intergenic
1098928646 12:76382906-76382928 TACACAGCCCTGGAAGAGAATGG - Intronic
1101381770 12:104219550-104219572 TACACACCACTTCAGGAGAATGG + Intronic
1103102015 12:118185360-118185382 TACAAAACACTGCACTAGAAGGG + Intronic
1106636583 13:31534997-31535019 CACCCAACACTGGATGTGAAAGG - Intergenic
1108364624 13:49697447-49697469 TAACCATCACTGTAAGACAACGG + Intergenic
1108837010 13:54563145-54563167 TACCTAACACTCCAAAACAAGGG - Intergenic
1109570961 13:64189122-64189144 TGGCCAACACTGCATAAGAATGG - Intergenic
1111253304 13:85634124-85634146 TACCCAGCACTGAAAAATAATGG - Intergenic
1113017214 13:105841084-105841106 TACCCAAAACTTACAGAGAATGG - Intergenic
1113816523 13:113175528-113175550 TACCCAACACTGCAAGAGAACGG + Intergenic
1113960439 13:114122888-114122910 CAGCCAACGCTGCATGAGAAAGG + Intronic
1120360637 14:83497258-83497280 TTCCCAAGAATGCAAGACAATGG - Intergenic
1122785574 14:104161911-104161933 CACCCAACACTGCCAGGGAGCGG - Intronic
1127804114 15:62502853-62502875 TACCAAACAGTACAAGAGCAAGG - Intronic
1129080124 15:73032327-73032349 GACCCAACACTCCGAGATAATGG + Intergenic
1130425936 15:83799423-83799445 TACACACTTCTGCAAGAGAAAGG - Intronic
1131563745 15:93466730-93466752 TCACCAACACTGTAAGGGAAAGG + Intergenic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1135698893 16:24614202-24614224 TTCCAAACGCAGCAAGAGAAGGG + Intergenic
1138803776 16:60068096-60068118 TCCTCAATACTGCAAGAGGAAGG - Intergenic
1140768686 16:78183488-78183510 TCCACAACACTGCTACAGAACGG - Intronic
1143870362 17:9953844-9953866 TACCCAACACTGCACCAGTCAGG - Intronic
1145744223 17:27302003-27302025 TACCCTACACTGAGAGAAAATGG - Intronic
1147735664 17:42636373-42636395 TATCCAACACCCCAAGAAAAGGG - Intergenic
1151740937 17:75981519-75981541 GACCCAACACTACAAAACAATGG - Intronic
1151758833 17:76089410-76089432 TACCCCACACTGGCAGAGGATGG + Intronic
1153116936 18:1669432-1669454 TACAAAAGACTGCAAGAAAAGGG + Intergenic
1155881335 18:31152272-31152294 TCCCCAACACTCAGAGAGAAAGG + Intronic
1156475094 18:37400974-37400996 GGCCCAACACTGCATCAGAAGGG - Intronic
1157043177 18:44063418-44063440 TAACCATCACTGCAAGAAACTGG + Intergenic
1157115830 18:44862097-44862119 TACACACCACTGTAAGAGTATGG + Intronic
1158246255 18:55435630-55435652 TTCCCATCACTGGAAGAGGAAGG - Intronic
1162603188 19:11686035-11686057 TTCCAAAGACTGGAAGAGAAAGG - Intergenic
1166064667 19:40350404-40350426 TGCCCAACACTGCTAGACACTGG + Intronic
1167618398 19:50548549-50548571 TACCTGAACCTGCAAGAGAACGG - Exonic
1167712255 19:51119662-51119684 GACCCACCACTGCCAGAGATGGG - Intergenic
926752636 2:16210403-16210425 TTCCCAATACTTCAAGACAATGG - Intergenic
927769525 2:25846846-25846868 TACTCAACACAGGAAGAGTAAGG + Intronic
929879377 2:45822882-45822904 TACCCTACAGTGGGAGAGAAGGG - Intronic
931054309 2:58451817-58451839 TACAGAACACTGCAGGAAAAGGG - Intergenic
932887658 2:75561478-75561500 ACCCCAACCCTGAAAGAGAAAGG - Intronic
933362182 2:81302369-81302391 CACACAATACTGCAAGGGAATGG - Intergenic
933537772 2:83598071-83598093 TACTGAACACTGCCAGGGAAAGG + Intergenic
933989111 2:87621008-87621030 TCCCCAACACTGGAAAGGAAAGG - Intergenic
934076692 2:88434430-88434452 TTAAAAACACTGCAAGAGAAAGG - Intergenic
936304732 2:111329818-111329840 TCCCCAACACTGGAAAGGAAAGG + Intergenic
940512571 2:154637195-154637217 TCACCAACACTGCAAGCAAAAGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169864143 20:10181992-10182014 TTCCCACCACTGAAAGAGAGAGG - Intergenic
1173081145 20:39868791-39868813 TTCCCCATACTGCAACAGAATGG + Intergenic
1173447130 20:43129227-43129249 TAACCATCACTGTAAGAGGAAGG + Intronic
1174168463 20:48601208-48601230 GACCTCACACTGCAAGAGCATGG - Intergenic
1175089126 20:56487336-56487358 TACCTTGCACTTCAAGAGAAGGG + Intronic
1175388067 20:58609954-58609976 TACACAAAACTGCACGAGACAGG - Intergenic
1177485580 21:21751110-21751132 TAACCTACACTGCAAAAGAAGGG - Intergenic
1178902574 21:36609128-36609150 TGCCCAACACTGAAACAGAATGG + Intergenic
949316774 3:2765332-2765354 TAACCGACAGTGCTAGAGAATGG + Intronic
949721144 3:6991587-6991609 TACCCCACAAGCCAAGAGAATGG + Intronic
949724683 3:7030098-7030120 TACCCAGCAATGAAAAAGAATGG + Intronic
951624606 3:24645535-24645557 TACCCAACACTACTAGAGTCCGG - Intergenic
952469728 3:33634420-33634442 TACTCAACTCTGCAAATGAATGG + Intronic
953793479 3:45965970-45965992 TAGCCAACATTGAAAGAGCAGGG - Intronic
953847034 3:46435877-46435899 TACCCAAGACTGCAAGAAAGAGG + Exonic
955062592 3:55506073-55506095 TAACCAATAGTACAAGAGAATGG - Intergenic
955251049 3:57282719-57282741 TAACCAAAACTCCAAGGGAAGGG - Intronic
961159555 3:124711641-124711663 TACCCACCCCTGAAATAGAATGG - Intronic
964968183 3:162525158-162525180 TACCAACAACTGCAAGAAAAGGG - Intergenic
964994221 3:162854931-162854953 TACTCAAAAAAGCAAGAGAAAGG + Intergenic
967918501 3:194597220-194597242 TTCCCAGCATTGCAAGAGACGGG - Intronic
970472380 4:16391774-16391796 TTCCCAACACTGAAAAGGAAGGG - Intergenic
971062201 4:22985004-22985026 TACCCACCACAACAAGATAAGGG + Intergenic
971655440 4:29338411-29338433 TACCCAACCCTGCAATAGGGAGG + Intergenic
973210755 4:47612925-47612947 TTCCAAAAAATGCAAGAGAAGGG + Intronic
974522455 4:63000754-63000776 TACCCAAGACTGAGGGAGAAGGG + Intergenic
974662865 4:64917278-64917300 TAGCCAAAACTGCGATAGAAAGG - Intergenic
975877288 4:78856446-78856468 TACTGAACTCTTCAAGAGAATGG - Intronic
976659998 4:87530847-87530869 TTCAGAACACTGCAAGAAAAAGG + Intronic
977502112 4:97853712-97853734 TACCAAATTCTTCAAGAGAAGGG - Intronic
980014432 4:127632677-127632699 TATCCAGCACTGGAAGAAAAAGG + Intronic
980402859 4:132315545-132315567 AACCAAACACTTCAAGAGAGGGG + Intergenic
985938884 5:3118392-3118414 TTCCCAACACTGCCAAACAACGG + Intergenic
988382912 5:30522212-30522234 TACCCAACTCTTCAATACAAAGG + Intergenic
992518005 5:77516138-77516160 TACCCAAAACAGATAGAGAAAGG - Intronic
992774359 5:80076841-80076863 TCTCCATCACTGCAGGAGAAAGG - Exonic
994614230 5:102083182-102083204 TAACCAACACAGCAAGATACTGG + Intergenic
994669162 5:102746031-102746053 CAGTCAACACTGCAGGAGAAAGG - Intergenic
1001915314 5:175555485-175555507 TACGCAAGAGTGCAAGAAAAAGG - Intergenic
1003241551 6:4349820-4349842 TATCTAACAGTGTAAGAGAAGGG + Intergenic
1007950988 6:45872220-45872242 TGCCCAACACTGCACTAGAAAGG - Intergenic
1008930047 6:56929923-56929945 CACCCATCACTGTAAGATAAAGG + Intronic
1012755528 6:103225691-103225713 TAACCAACACTGCATGATGATGG + Intergenic
1014089351 6:117385740-117385762 TACCCAGCATTGCAGGAGCAGGG - Exonic
1017722770 6:157255521-157255543 TACCCAACACCCCTAGAGATAGG - Intergenic
1018083158 6:160276249-160276271 TCCACACCACTGCATGAGAAAGG - Intronic
1018083434 6:160278410-160278432 TCCACACCACTGCATGAGAAAGG - Intergenic
1019004844 6:168788121-168788143 TGCCCAACACTGCAGAGGAAAGG - Intergenic
1020468196 7:8505013-8505035 TACACAGCCCTGCAAGAGTAAGG + Intronic
1022227719 7:28380892-28380914 TACCCAGCACAGCAATAGTAAGG + Intronic
1023328645 7:39088877-39088899 AGCCCAAAACTGCAGGAGAAGGG + Intronic
1027756988 7:82226442-82226464 TACCCATCCCTTCTAGAGAAAGG + Intronic
1028133921 7:87207249-87207271 TCCCCAACACTCCCAGAGAGGGG + Intronic
1030009096 7:105148260-105148282 TTTTTAACACTGCAAGAGAAGGG + Intronic
1031053270 7:116967256-116967278 TACCAAACTCTGCAGGGGAATGG - Intronic
1031177668 7:118373038-118373060 AATGCTACACTGCAAGAGAAAGG + Intergenic
1031291687 7:119945669-119945691 TACCCAATACATCAAGAAAATGG - Intergenic
1031843622 7:126777366-126777388 TACCCAACATTGCAAAGTAATGG + Intronic
1032373685 7:131386878-131386900 TCCCCAACACTGTAGGTGAAGGG - Intronic
1034455734 7:151168560-151168582 TACCCACCGAGGCAAGAGAAAGG - Intronic
1036430910 8:8689579-8689601 TACCCAGCCCAGCCAGAGAATGG + Intergenic
1039629544 8:39094458-39094480 TTCCCAACACTTGAAGAGGAAGG - Intronic
1039656205 8:39411003-39411025 TACACAAAAGTGAAAGAGAAAGG + Intergenic
1041493286 8:58458854-58458876 TACCCAAAACTGCAGGACAATGG - Intergenic
1043851121 8:85218034-85218056 TATCCAACACTTCAAGGCAAGGG - Intronic
1045768115 8:105700963-105700985 TACTCAACAATGCAAGACAATGG - Intronic
1052245833 9:26333395-26333417 AATTCAACACTGCAAGGGAATGG + Intergenic
1053081035 9:35176962-35176984 TAGCCAATATTCCAAGAGAAAGG + Intronic
1055318976 9:75063549-75063571 TATCCAACAGAGTAAGAGAATGG - Intronic
1056256430 9:84803724-84803746 TACCCAACTCTGCCTGAGAGTGG - Intronic
1058637916 9:107054810-107054832 TTCCCAACACTTCATCAGAAGGG + Intergenic
1062172016 9:135140088-135140110 CACCCAGCACTGCAGGGGAAAGG + Intergenic
1193924617 X:87468079-87468101 AAACCAGCACTGCAAGAAAAAGG + Intergenic
1194679998 X:96840936-96840958 TATCCAAAACTAGAAGAGAAGGG - Intronic
1196650411 X:118163041-118163063 TTCCCCACACAGCAAGAGAAAGG - Intergenic
1196750748 X:119115391-119115413 TACTGAACACTGCAAGGCAATGG + Intronic
1197692734 X:129521208-129521230 AACACAACACTGCAAGAGTCTGG + Intronic
1201892668 Y:18959483-18959505 TCCTCACCAATGCAAGAGAATGG + Intergenic