ID: 1113817415

View in Genome Browser
Species Human (GRCh38)
Location 13:113183127-113183149
Sequence TGTCCCCAAAAAGCCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113817415_1113817416 18 Left 1113817415 13:113183127-113183149 CCAGCGCTGGCTTTTTGGGGACA 0: 1
1: 0
2: 2
3: 17
4: 184
Right 1113817416 13:113183168-113183190 TCAGAGCATCACACTCTCAATGG 0: 1
1: 0
2: 0
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113817415 Original CRISPR TGTCCCCAAAAAGCCAGCGC TGG (reversed) Intronic