ID: 1113821236

View in Genome Browser
Species Human (GRCh38)
Location 13:113214957-113214979
Sequence CAAGATGTCCACAGCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113821236_1113821240 -5 Left 1113821236 13:113214957-113214979 CCCATGTGGCTGTGGACATCTTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1113821240 13:113214975-113214997 TCTTGTCTGTGTGGCTGTGGAGG 0: 1
1: 3
2: 4
3: 46
4: 486
1113821236_1113821242 15 Left 1113821236 13:113214957-113214979 CCCATGTGGCTGTGGACATCTTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1113821242 13:113214995-113215017 AGGTTGCTGTGTGACTATGGAGG 0: 2
1: 9
2: 13
3: 18
4: 215
1113821236_1113821239 -8 Left 1113821236 13:113214957-113214979 CCCATGTGGCTGTGGACATCTTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1113821239 13:113214972-113214994 ACATCTTGTCTGTGTGGCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 287
1113821236_1113821241 12 Left 1113821236 13:113214957-113214979 CCCATGTGGCTGTGGACATCTTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1113821241 13:113214992-113215014 TGGAGGTTGCTGTGTGACTATGG 0: 2
1: 8
2: 12
3: 25
4: 240
1113821236_1113821243 30 Left 1113821236 13:113214957-113214979 CCCATGTGGCTGTGGACATCTTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1113821243 13:113215010-113215032 TATGGAGGTCTCGTCCTTTGTGG 0: 1
1: 0
2: 1
3: 12
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113821236 Original CRISPR CAAGATGTCCACAGCCACAT GGG (reversed) Intronic
900038896 1:440652-440674 GGAGATGTCCACAACCACTTAGG + Intergenic
900060328 1:675628-675650 GGAGATGTCCACAACCACTTAGG + Intergenic
900572108 1:3363727-3363749 CAAGGTGACCACAGCCACCCAGG + Intronic
903539670 1:24089884-24089906 CAGGAGGGCCACAGCCAGATGGG + Intronic
904591852 1:31619347-31619369 CACGACGAACACAGCCACATAGG - Exonic
905526042 1:38640649-38640671 CTAGGTGACCACAGACACATGGG + Intergenic
905769698 1:40629486-40629508 CAAGATGGCACCAACCACATGGG + Intronic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
910754041 1:90666943-90666965 AAACATGTCCAAAGCCACTTGGG + Intergenic
910926760 1:92405526-92405548 CAAAATGACCACAGACACCTTGG - Intergenic
913218077 1:116637173-116637195 CAGGATGTCCACAGGCACAGGGG - Intronic
913433745 1:118825624-118825646 TAAGATGTCCACAGCTACAGAGG + Intergenic
913691233 1:121281691-121281713 CAATCTGTCCACAACCACACTGG - Intronic
914146310 1:144998290-144998312 CAATCTGTCCACAACCACACTGG + Intronic
915278619 1:154807274-154807296 CGAGTTGTCCACAGCCACCAGGG - Intronic
915476449 1:156155461-156155483 CAAGGTGTTCACAGTCACAAGGG + Intronic
916674769 1:167055802-167055824 GAATATCTCCACAGACACATCGG - Exonic
917200281 1:172507496-172507518 CAAGCTGTGCACAGCCAAATAGG - Intergenic
919969143 1:202561430-202561452 CAAGATGTCCACGGTCATAGTGG + Intronic
920478557 1:206300167-206300189 CAATCTGTCCACAACCACACTGG - Intronic
922236214 1:223724468-223724490 CAAGTGCTCCACAGCCACACAGG - Intronic
923594908 1:235353708-235353730 CAATATGTACAAAGCAACATAGG + Intergenic
924592809 1:245419701-245419723 CGAGACTTCCACAGGCACATCGG + Exonic
1067962724 10:50874518-50874540 CAAGATGTGCACAGGTGCATAGG - Intronic
1068118495 10:52760595-52760617 GAAGAGGTCCACAACCTCATCGG + Intergenic
1069219587 10:65866767-65866789 CAAGATTTCCCCAGCTTCATTGG + Intergenic
1069515661 10:69075076-69075098 CAAGTTTTTAACAGCCACATGGG + Intergenic
1069700962 10:70425518-70425540 CAAGATGTGCATAGCCAAACTGG + Exonic
1073163329 10:101420524-101420546 GAGGATGTCCACATCCACACAGG - Intronic
1074125732 10:110527690-110527712 CTAGAAGTTCACAGTCACATGGG + Intergenic
1075225513 10:120625272-120625294 CAGAATGCCCTCAGCCACATAGG - Intergenic
1075275012 10:121085512-121085534 GAAGAAGGCCACAGCCACAATGG - Intergenic
1075313521 10:121433868-121433890 GAAGATGGCCTCAGCCACAGTGG + Intergenic
1076965103 11:76563-76585 GGAGATGTCCACAACCACTTAGG + Intergenic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1082942087 11:58716811-58716833 CAAGCTGTGCCCAGCCACCTTGG - Intronic
1084855292 11:71980756-71980778 CAAGTAGTCAGCAGCCACATGGG - Intronic
1085402003 11:76241055-76241077 CCAGATCTCCCCAGCCAAATGGG - Intergenic
1087058487 11:93956331-93956353 CAAGATCTCAAAAGCCACAAGGG - Intergenic
1088256536 11:107908619-107908641 AGAGATGGCCACAGCCACACCGG - Intronic
1088560304 11:111108511-111108533 TAAGATGTTCACAGCCTCATGGG - Intergenic
1093771344 12:23021931-23021953 AAAGATGTGCACAGCTATATGGG - Intergenic
1093885810 12:24459059-24459081 CAAGAAGTCAACATCCAAATAGG + Intergenic
1097287792 12:57890972-57890994 CATAAAGTCTACAGCCACATGGG + Intergenic
1098496330 12:71139795-71139817 CAATATGTCCACAGCAACGTAGG + Exonic
1100149925 12:91724667-91724689 CAAGATCTCAACAGCCAAACTGG + Intergenic
1101694855 12:107115572-107115594 CAGGATGTTCTCAGCCACCTTGG - Intergenic
1102678597 12:114674734-114674756 CAAGATCTCCACCACCACGTCGG - Exonic
1102833431 12:116029696-116029718 GAACATGTACACAGCCACACTGG + Intronic
1103723683 12:122987642-122987664 CATGATGTGCACATCCACCTGGG + Exonic
1108010297 13:46000242-46000264 CAAGATGTCCATAGCCAGAGAGG - Intronic
1113821236 13:113214957-113214979 CAAGATGTCCACAGCCACATGGG - Intronic
1113821245 13:113215024-113215046 CAAGACGTCCACAGCCACAAAGG - Intronic
1113821328 13:113215606-113215628 AGAGATCTCCACAGCCACACGGG - Intronic
1113821388 13:113216006-113216028 CACGACCTCCACAGCCACATGGG - Intronic
1113821413 13:113216179-113216201 AGAGACCTCCACAGCCACATGGG - Intronic
1119353520 14:73986254-73986276 CAACATGGCCTCAGACACATAGG + Intronic
1121778522 14:96606832-96606854 CAAGGAGACCACATCCACATGGG - Intergenic
1122122622 14:99562505-99562527 GCAGTTGGCCACAGCCACATAGG + Intronic
1123005074 14:105317271-105317293 CACGATGTCCACAGCAGCACGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126145581 15:45470266-45470288 CAAGCTGTCCCCAACCACCTTGG - Intergenic
1128152062 15:65369342-65369364 CAACTTGTCCACAGCCACACAGG + Intronic
1128870382 15:71150796-71150818 GAAAATGTCCAAAGCCACTTCGG - Intronic
1129254933 15:74328883-74328905 CAGGAAGCCCACAGCCACAGGGG + Intronic
1129967896 15:79753120-79753142 TAGGGTGTCCACAGCAACATGGG - Intergenic
1132443025 15:101886955-101886977 GGAGATGTCCACAACCACTTAGG - Intergenic
1133294878 16:4746805-4746827 CAAGAGGTCAGCAGCCACACTGG - Intronic
1133530584 16:6651563-6651585 CAATCTGTCCACATCCTCATGGG - Intronic
1136174208 16:28506358-28506380 CAAGATGTCAGCAGCCTCACTGG - Intronic
1141186111 16:81788792-81788814 GAAGATGGCCACCTCCACATGGG - Intronic
1141379020 16:83558885-83558907 CTGGGTGTCCACAGTCACATCGG + Intronic
1143664144 17:8346668-8346690 CAACATGTCCAAAGCCTGATGGG - Intergenic
1144097082 17:11909558-11909580 CCATATGTGCAAAGCCACATGGG - Intronic
1145757250 17:27401715-27401737 CCAGATGTCTACAACCACACAGG + Intergenic
1145965970 17:28917534-28917556 CTAGAAGCCCTCAGCCACATAGG + Intronic
1147426818 17:40349739-40349761 CAGGTTGTCCACACCCACAGTGG - Intronic
1150319428 17:64199766-64199788 CAAGGGCTCAACAGCCACATAGG + Intronic
1151491740 17:74435727-74435749 CAAGAAGCCCACAGGCACTTGGG - Intronic
1152713903 17:81889077-81889099 CAAAGTGTCCTCAGCCACAGGGG + Intronic
1153710814 18:7796927-7796949 CATGATGTTCACAGTCACCTTGG - Intronic
1154018350 18:10639665-10639687 CAACATGTCCACACACACACAGG + Intergenic
1156398716 18:36721773-36721795 CAAAATGTAAACAGCCACTTTGG + Intronic
1157382133 18:47228054-47228076 CAAGATTTGCAAAGCCTCATCGG - Intronic
1160384578 18:78487335-78487357 CCAGTTGTCCACTGTCACATAGG - Intergenic
1160641908 19:146193-146215 GGAGATGTCCACAACCACTTAGG + Intergenic
1162588565 19:11576519-11576541 AAAAATGGCCACAGACACATTGG + Exonic
1163200217 19:15761223-15761245 AAAGATGCTCACAGCCTCATGGG - Intergenic
1163228560 19:15981315-15981337 AAAGGTGCCCACAGCCTCATGGG - Intergenic
1163693636 19:18751156-18751178 CACGATGAGCACAGCCAGATAGG - Intronic
1164276385 19:23722384-23722406 CAGGATGGCCACAGTCAGATAGG + Intergenic
1166967277 19:46536664-46536686 CAAGATCTCATCAGCCACATGGG - Intronic
1168638197 19:58012672-58012694 AAAGATCTCCACGGCCACAGTGG + Intergenic
926316450 2:11713994-11714016 CAAAATGTTCACAGCTCCATGGG - Intronic
926405195 2:12544385-12544407 CATGATGTCAACAGACACTTAGG - Intergenic
926838629 2:17052808-17052830 CAACATGCCCACAGCTACATGGG - Intergenic
928690470 2:33793707-33793729 CAAGTAGTCAACAGCCTCATTGG + Intergenic
929322375 2:40559753-40559775 TTAGATATCCACAGCTACATAGG + Intronic
929553436 2:42908616-42908638 CAAGAAGTCCAGAGACACTTCGG - Intergenic
929617801 2:43325946-43325968 CAAGATATCCACTGCCATTTTGG - Intronic
932123295 2:69120873-69120895 CCAGATGACCACGGCCACATAGG - Intronic
935065141 2:99641009-99641031 TCAGATGCCCACAGCCACAGAGG + Intronic
935810879 2:106795915-106795937 CCAAATGTCCACAGCAACACAGG - Intergenic
940839117 2:158558958-158558980 AAAGCTGGCCACAGCTACATTGG + Intronic
942065082 2:172263280-172263302 CAAGATGTCCAGAGCAAAAAAGG - Intergenic
942701614 2:178717591-178717613 CAAACTGACCAGAGCCACATAGG - Exonic
942786182 2:179705450-179705472 CATGATTTCAACATCCACATGGG + Intronic
943104200 2:183523487-183523509 CAATATATCCAAAACCACATAGG - Intergenic
944694289 2:202187249-202187271 CAAGCCCTGCACAGCCACATTGG + Intronic
945630101 2:212263976-212263998 CAACATGACCACAGCAATATAGG - Intronic
947263801 2:228253886-228253908 AAATATATACACAGCCACATTGG - Intergenic
947335695 2:229080373-229080395 CAGGATGTGCACAACCACAGAGG - Intronic
948262402 2:236613795-236613817 CAATGTGGCCACAGCCAGATGGG - Intergenic
1170159076 20:13294521-13294543 CCAGATGCACAAAGCCACATTGG + Intronic
1170368176 20:15619610-15619632 CAACATGGCCAAAGCCAAATAGG - Intronic
1172572512 20:35981791-35981813 CATGAAGCCCACAGCCACAATGG + Intronic
1172858984 20:38032863-38032885 CATGAGGTCAACAGACACATTGG + Intronic
1173524648 20:43722251-43722273 AAACATATCCACAGCCACGTGGG - Intergenic
1174189297 20:48728754-48728776 CAAGATTTTCACAGCCACCAAGG + Intronic
1175721067 20:61287669-61287691 CAAGAGGCCCAGGGCCACATGGG - Intronic
1177127568 21:17214904-17214926 CAAGAAATCAACAGCCACTTAGG + Intergenic
1179006988 21:37523821-37523843 CAAGTTGTCCACGGCCACTTTGG + Intergenic
1179590595 21:42405553-42405575 CCAGGTGGCCACAGCCCCATCGG + Intronic
1180100406 21:45581342-45581364 CATGATCTCCTCATCCACATGGG - Intergenic
1180819384 22:18815257-18815279 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181205609 22:21249702-21249724 CAGGATGTCCACAGGCACAGGGG - Intergenic
1182824860 22:33256191-33256213 CCAGATGTGCAAAACCACATTGG - Intronic
1183110084 22:35642448-35642470 CAGCATGTCCATAGCCACAGTGG + Intergenic
1184348874 22:43930203-43930225 CAAGTTCCCCACAGCCACACAGG - Intronic
1185204058 22:49527053-49527075 CCAGGTCTCCTCAGCCACATGGG - Intronic
1203221314 22_KI270731v1_random:45711-45733 CAGGATGTCCACAGGCACAGGGG + Intergenic
1203269512 22_KI270734v1_random:41110-41132 CAGGATGTCCACAGGCACAGGGG - Intergenic
954419242 3:50409929-50409951 CAAGAACTCCAAGGCCACATGGG - Intronic
955095983 3:55798664-55798686 CAAGTTTTCCACAGCAACAGTGG + Intronic
955962277 3:64352744-64352766 CACAATCTCCAAAGCCACATAGG + Intronic
956813030 3:72883211-72883233 CAAGTGCTCCACAGCCACATGGG + Intergenic
959425782 3:106186129-106186151 CAATTTTTCCACGGCCACATAGG + Intergenic
962505688 3:136044833-136044855 CCAGATGTCCACAGTGACAGTGG - Intronic
962936452 3:140085504-140085526 GAAGATGTCCACAGCCCAACTGG - Intronic
964759691 3:160123033-160123055 CAAGATGTTCAAAGACACAGGGG - Intergenic
964954010 3:162329756-162329778 CATGATGGCCCCACCCACATAGG - Intergenic
965521329 3:169670239-169670261 CAAGATGTCCACAGCTGAAAGGG - Intergenic
965542121 3:169880719-169880741 CAAGATGCCACCAGCCACAGAGG + Intergenic
967371817 3:188755336-188755358 AAAGCTGTCCACAGCCATTTTGG - Intronic
969081915 4:4625625-4625647 ACAGATGACCACAGACACATTGG + Intergenic
974333190 4:60505966-60505988 CAGGATCTCCACAGCCTCACAGG - Intergenic
976580751 4:86733245-86733267 CATGATGTTCACAACCACAGTGG + Intronic
980480116 4:133377063-133377085 CAACATGGCCACCTCCACATAGG - Intergenic
980758640 4:137199000-137199022 CAGGCTGTCCACAGGCACAGTGG + Intergenic
981737130 4:147964413-147964435 CATGTTGTGCACAGCCACGTGGG - Intronic
985886239 5:2681849-2681871 CTCGGTGTCCACAGCCACACTGG - Intergenic
986085801 5:4444516-4444538 CAAAATCTCCACAGCCACGTGGG - Intergenic
987431041 5:17833376-17833398 CAAGAAGCACACAGCCAGATAGG - Intergenic
991094058 5:62720617-62720639 AAAGATGTCCACATCCTCAAAGG - Intergenic
991630160 5:68648665-68648687 GAAGAAGCCCACAGCCACATGGG + Intergenic
993737063 5:91489878-91489900 AAAGAGGTCCACAGTCACTTAGG - Intergenic
994258518 5:97629595-97629617 CTAGATGTCCACAGACATTTTGG + Intergenic
994849136 5:105031714-105031736 TAAGATCTACTCAGCCACATAGG + Intergenic
997741545 5:136259241-136259263 TAAGTTGTCCAAAGCCACACAGG + Intronic
1002734951 5:181378291-181378313 GGAGATGTCCACAACCACTTAGG - Intergenic
1005116181 6:22340089-22340111 CAAATTGTCCAGAGCTACATGGG - Intergenic
1010273094 6:73937211-73937233 CAAAATGTCCCCAGCCAAAGAGG - Intergenic
1012553937 6:100489783-100489805 CAAGAGGTCCACTGCCACAAAGG + Intergenic
1017391683 6:153946665-153946687 CAGGATCTGCACAGCCACCTTGG - Intergenic
1017559812 6:155615110-155615132 CAAGCTGTCAAGAGGCACATGGG - Intergenic
1019239213 6:170650608-170650630 GGAGATGTCCACAACCACTTAGG - Intergenic
1022960333 7:35419828-35419850 GAAAATGTCCCCAGCCTCATTGG - Intergenic
1022965503 7:35467841-35467863 CAAGGTGCTCACAGCCACTTGGG + Intergenic
1023699772 7:42881693-42881715 CAAGATGAACTCAGCCATATTGG - Intergenic
1023845388 7:44117329-44117351 CCAGTTCTCCACAACCACATTGG + Intronic
1024606572 7:51027060-51027082 CAAGATGTAAACACACACATCGG - Intronic
1024786417 7:52912125-52912147 GAAGGTGTCCCCAGCCACAGAGG + Intergenic
1026474626 7:70724181-70724203 AAAGAAGTCCTCAGCCAAATGGG - Intronic
1027181575 7:75944087-75944109 CATGATCTCCACTGACACATGGG - Intronic
1027241644 7:76333985-76334007 CTAGCTGTCCCCAGACACATTGG + Intronic
1027860646 7:83574825-83574847 CCAGCTGACCACAGTCACATGGG + Intronic
1028692489 7:93669137-93669159 CAATATGTCCCCAATCACATAGG - Intronic
1028716926 7:93981572-93981594 TAAGCTGTCCACAGCCTCAAAGG + Intronic
1034401440 7:150864161-150864183 CAAGATGTCCACAGTCACAGGGG + Intergenic
1035000561 7:155609395-155609417 CATGGTGTCAGCAGCCACATGGG - Intergenic
1035508559 8:156000-156022 GGAGATGTCCACAACCACTTAGG + Intergenic
1036958548 8:13217488-13217510 CAAAATGTTCACAGCCTAATGGG - Intronic
1037277448 8:17196287-17196309 CAAGCGCTCAACAGCCACATGGG - Intronic
1039547048 8:38417874-38417896 CAACATCTTCACAGCCACTTTGG + Exonic
1040023540 8:42761596-42761618 GAAGGTGTCCACATCCCCATGGG - Intronic
1040654568 8:49491364-49491386 AAAGGTGTCCAAAGCCACACAGG + Intergenic
1043684185 8:83066938-83066960 CATGATATCCACAGCTACCTGGG - Intergenic
1047554830 8:125918045-125918067 TAAGATGTCCAGAGGCACATGGG + Intergenic
1048831375 8:138480507-138480529 CAAGTTGTCCACACTCAAATAGG + Intronic
1050801039 9:9615140-9615162 CAATATTTCCACAGACACCTTGG + Intronic
1057329671 9:94101681-94101703 CAACATGTCCACATCCTCTTTGG - Exonic
1059737946 9:117121083-117121105 GAAGAAGTTCACATCCACATGGG + Intronic
1061553455 9:131351029-131351051 CAGGACGTCCCCAGCCACAGTGG - Intergenic
1062759419 9:138330899-138330921 GGAGATGTCCACAACCACTTAGG - Intergenic
1203599868 Un_KI270748v1:1671-1693 GGAGATGTCCACAACCACTTAGG - Intergenic
1185655863 X:1685074-1685096 CAAGATGTCCACAGACGTGTGGG + Intergenic
1185655960 X:1685855-1685877 CAAGATGTCCACAGACGTGTGGG - Intergenic
1187363978 X:18651609-18651631 CAGGCTGGCCACAGCCCCATTGG - Intronic
1187726193 X:22204570-22204592 TATGATGTCCTAAGCCACATGGG - Intronic
1188350438 X:29123749-29123771 CAAGTGCTCAACAGCCACATGGG - Intronic
1193790841 X:85813701-85813723 ACAGATGACCAGAGCCACATGGG + Intergenic
1195494722 X:105517525-105517547 CAGGATGAACACAGACACATTGG - Intronic
1195688201 X:107603845-107603867 CCAGATGTCCCCATCCACCTTGG + Exonic
1196883611 X:120223032-120223054 AAAGATGTCACCAGCCACAGAGG - Intergenic
1199596522 X:149510287-149510309 CAAGATGTCCACAGGCAAACGGG - Intronic
1200992750 Y:9358452-9358474 CCGGCTTTCCACAGCCACATTGG - Intronic
1200998068 Y:9399076-9399098 CCGGCTTTCCACAGCCACATTGG - Intronic