ID: 1113821974

View in Genome Browser
Species Human (GRCh38)
Location 13:113221111-113221133
Sequence CACCAGAAGCAGAGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 299}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113821971_1113821974 -10 Left 1113821971 13:113221098-113221120 CCTGTGGCTGTGGCACCAGAAGC 0: 1
1: 0
2: 1
3: 47
4: 629
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299
1113821966_1113821974 17 Left 1113821966 13:113221071-113221093 CCTGAAGGGATGGGGAGGATGCG 0: 1
1: 0
2: 1
3: 19
4: 215
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299
1113821969_1113821974 -6 Left 1113821969 13:113221094-113221116 CCCTCCTGTGGCTGTGGCACCAG 0: 1
1: 0
2: 3
3: 24
4: 354
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299
1113821970_1113821974 -7 Left 1113821970 13:113221095-113221117 CCTCCTGTGGCTGTGGCACCAGA 0: 1
1: 0
2: 3
3: 37
4: 288
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299
1113821964_1113821974 21 Left 1113821964 13:113221067-113221089 CCCTCCTGAAGGGATGGGGAGGA 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299
1113821965_1113821974 20 Left 1113821965 13:113221068-113221090 CCTCCTGAAGGGATGGGGAGGAT 0: 1
1: 0
2: 0
3: 15
4: 241
Right 1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113821974 Original CRISPR CACCAGAAGCAGAGCGTGGA GGG Intronic
900459718 1:2797077-2797099 CCCCAGAAGCACAGTATGGAGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
903049964 1:20593395-20593417 AACCAGAACCAGAGCGGGCAAGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912384402 1:109264090-109264112 CACGTGATGCTGAGCGTGGAGGG + Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
917802021 1:178580227-178580249 CACTAGAATCACAGCGAGGAAGG - Intergenic
918473741 1:184901742-184901764 CACCAGAAGCAGGGCGTCCCTGG - Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
920189126 1:204181137-204181159 CAGCAGAAGCATAGCTGGGATGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
923338404 1:232988919-232988941 CAGCAGATGCACAGCGTGGCTGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064956551 10:20917420-20917442 CAACAGAAGCAAAGGGTAGAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070627515 10:78061812-78061834 CACCAGCAGCAGAGTATGGATGG - Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073948157 10:108776370-108776392 GGCCAGAAGGAGAGAGTGGAGGG - Intergenic
1075581957 10:123625604-123625626 CCCCAGAAGAAGAGTGGGGAAGG + Intergenic
1077101990 11:826416-826438 CCCCAGAAGGAGAGCCAGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1082173325 11:49032350-49032372 CACCAGAACCAGATGCTGGAAGG + Exonic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083592308 11:63902941-63902963 CACCTGAAGCAGACAGTGGTAGG - Intronic
1084068787 11:66720560-66720582 AACCAGCAGCAGCGGGTGGAGGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085800234 11:79582594-79582616 CAAGAGAAGCAGAGCTTAGAAGG - Intergenic
1086692435 11:89803697-89803719 CACCAGAACCAGATGCTGGAAGG - Exonic
1086696713 11:89855721-89855743 CACCAGAACCAGATGCTGGAAGG + Intergenic
1086709445 11:89988769-89988791 CACCAGAACCAGATGCTGGAAGG - Intergenic
1086713363 11:90035962-90035984 CACCAGAACCAGATGCTGGAAGG + Exonic
1087218739 11:95522825-95522847 GACCAGGAGCAGAGAGTGGCTGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088617123 11:111642124-111642146 CACCAAATGCGGAGGGTGGAGGG + Intronic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1090410959 11:126509353-126509375 CACCTGAAGCCAAGCTTGGAGGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091601847 12:1922555-1922577 CACCAGCAGGAGAGCGGGGGAGG - Intergenic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092630701 12:10372851-10372873 CACCACAAGCCCAGAGTGGATGG - Exonic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092930755 12:13313277-13313299 CACTAGAAGGAGAGCCTAGAAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102583308 12:113905999-113906021 CACCATAAACTGACCGTGGAAGG + Intronic
1105761327 13:23517508-23517530 CACCAGCAGCACAGGCTGGAGGG - Intergenic
1106001356 13:25726552-25726574 CAACAGAAGCAGAGAATGAAGGG - Intronic
1110185720 13:72672749-72672771 CATCAGAAACAGAGCGTGCTGGG - Intergenic
1110284249 13:73731203-73731225 CCCCAGCAGCTGAGCATGGATGG + Intronic
1112894874 13:104286513-104286535 CACAAAAAGGAGAGTGTGGAGGG - Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119229082 14:72966175-72966197 CAACACAAGCAGAGCCTGAATGG - Intergenic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1121421293 14:93817342-93817364 CATCAGAAACAAAGCGGGGAAGG - Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122873311 14:104651208-104651230 GTCCAGAAGGAGGGCGTGGACGG + Intergenic
1124689080 15:31806832-31806854 CCCCAGAGGCAGAGCACGGACGG - Intronic
1124945567 15:34262514-34262536 CTCCACTGGCAGAGCGTGGAGGG - Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127231491 15:57000482-57000504 CAACAAAAGCAGTGCTTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127642177 15:60926277-60926299 CACCTGCAGCAGAACCTGGAAGG + Intronic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132396987 15:101481449-101481471 CAACAGAAGCAAAGCCTGAAAGG + Intronic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133440804 16:5819429-5819451 GAGCAGAAGCAGAGCATAGATGG - Intergenic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1134251470 16:12577204-12577226 CACCAGGAGCAGAGCAGGGCAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137231237 16:46569553-46569575 CACCAGAAGCTGCGCTGGGAGGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138240023 16:55419895-55419917 CACCAGAAGCAGCAAGTGCAAGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140188773 16:72796864-72796886 CATCTGAAGCAATGCGTGGAGGG + Exonic
1140506731 16:75478315-75478337 CACCAGAAGGAGAGAGTTAAAGG + Exonic
1141278360 16:82608063-82608085 GACCGGAAGCAGAGAGGGGAGGG + Intergenic
1142151334 16:88513787-88513809 CCCCAGAAGCTGAGAGTGGCAGG - Intronic
1142272263 16:89096285-89096307 CACCAGGAGCACAGTGTGGAGGG - Intronic
1142365727 16:89648554-89648576 CACAAGAGGCAGAGCCTGCATGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142864316 17:2781104-2781126 GTCCAGAACCAGAGCGTGGCCGG - Intronic
1143376361 17:6469878-6469900 CGCCAGAAGGAGAGCCTGGTGGG - Intronic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1147375379 17:40019752-40019774 CACCAGCAGGAGAGCCGGGAAGG + Intronic
1151183206 17:72344522-72344544 AAACAGAAGCAGTGCCTGGAAGG + Intergenic
1151348744 17:73519164-73519186 CACCAGATGCAGGGCACGGAAGG + Intronic
1151560345 17:74866443-74866465 CACCAGCACCACAGCGTGGTAGG + Exonic
1151624838 17:75270386-75270408 CACCAGAAGCCAAGCCTGGTGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1155544503 18:26901603-26901625 TAACAGAGGCAGAGCTTGGAGGG + Intergenic
1155780526 18:29826886-29826908 CACAAGCAGCAGACCCTGGAGGG + Intergenic
1156955076 18:42952547-42952569 CCCCAAAAAAAGAGCGTGGAAGG + Intronic
1158685797 18:59613165-59613187 CACCAGCTGCAGGGCATGGATGG + Intronic
1159474332 18:68900185-68900207 CACCAGAAACAGAGCTTCGGTGG + Exonic
1159999248 18:75001087-75001109 CACCAGAAGCTGAGCTTTCAGGG + Intronic
1161079991 19:2305853-2305875 CCCCAAAAGCAGACCTTGGAGGG - Intronic
1161253541 19:3293941-3293963 AACCAGGAGTGGAGCGTGGAAGG + Intronic
1161571756 19:5034667-5034689 CACCAAAACCAGGGAGTGGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164074409 19:21800914-21800936 CACCAGATGCAGTGCTTTGAAGG - Intergenic
1165275900 19:34751334-34751356 CTCCAGGAGCACAGGGTGGAAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166831389 19:45641822-45641844 CTCCAGCAGCAGAGGGTGCAGGG - Intronic
1167857250 19:52252646-52252668 CACCAGAAGCAGTCCATGGTTGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925476340 2:4220952-4220974 AACCAGCAGCAGAGTATGGAAGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925900099 2:8503063-8503085 CACAAGATGCTGGGCGTGGAAGG - Intergenic
926129721 2:10295185-10295207 CATCAGAAGCAGAGCTGGAAAGG + Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
926994087 2:18715099-18715121 CAGCAGCAACAGAGCCTGGAGGG - Intergenic
927152569 2:20204298-20204320 GACCAGAAGCAGAGTGTGTTGGG + Intronic
927152583 2:20204339-20204361 GACCAGAAGCAGAGTGTGTTGGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928466500 2:31527655-31527677 CACCAGAGGCAGAGCGGGAATGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929000694 2:37344766-37344788 CACCAGCAGCAGCAGGTGGAGGG - Exonic
929435381 2:41924874-41924896 CACCAGTAGTAGAGTGGGGAGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
935576416 2:104716297-104716319 CACCTGAAGCTGCGGGTGGAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935928439 2:108095758-108095780 CATCAGAAGCAGAGCTCAGAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945500877 2:210573357-210573379 CACCAGCAACAGAGGATGGATGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170872090 20:20215180-20215202 AACCAGAAGCCAAGCCTGGACGG - Intronic
1174767516 20:53267995-53268017 CACCAGAAGCAGTCCAGGGAGGG - Intronic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1176068164 20:63210955-63210977 CACCAGAAGCACAGCAAGGCGGG + Intronic
1176290004 21:5038640-5038662 ACACAGAAGCACAGCGTGGAAGG + Intronic
1179867250 21:44224999-44225021 ACACAGAAGCACAGCGTGGAAGG - Intronic
1180010770 21:45049852-45049874 CAGCTGCAGCAGAGCCTGGATGG - Intergenic
1180198390 21:46210685-46210707 AACCTCAAGCAGAGCCTGGATGG + Exonic
1180931718 22:19596757-19596779 CCCCAGCAGCAGAGGGTGGTGGG - Intergenic
1181171927 22:21014832-21014854 CAGCAGCAGCAGGGCGGGGAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1183706871 22:39479566-39479588 CACCAGAAGCAGAGGCTTGGAGG - Intronic
1183748869 22:39707853-39707875 CCGCAGAAGCTGTGCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185222902 22:49637882-49637904 GCCAAGAAGCAGAGCGTGGATGG + Intronic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954422089 3:50424187-50424209 GACCAGAACCAGAGCATAGAAGG - Intronic
954446740 3:50550871-50550893 CACCAGCAGGAGAGCCAGGATGG - Intergenic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961326901 3:126114410-126114432 CATCACAAGCATAGCGTGGCAGG - Intronic
963644909 3:147901857-147901879 CACCAGAAGAACAGACTGGAAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
970054461 4:11954762-11954784 CACCAGTAGCAGAGGGAGAAAGG - Intergenic
970235649 4:13955681-13955703 CACCAGAAGGTGAGCGGGGTGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970448211 4:16141481-16141503 CCCTAGAAGCAGGGCGTGCAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973297810 4:48545400-48545422 AACCAGAAGCAGTGCGTAGCAGG - Intronic
973337224 4:48969137-48969159 CCCCAGAAGCAGAGCTGCGATGG - Intergenic
974278000 4:59751584-59751606 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977122223 4:93116604-93116626 CACCAGAAACAGAGCAGGAAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978453326 4:108860736-108860758 CACCAGGAGCAGTGCATGTAGGG - Intronic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
979137200 4:117124717-117124739 CACCAGAAGCTAAGCTAGGAGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
988965021 5:36407358-36407380 CAGCATAAGCAGAGCATGAAAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993570116 5:89526400-89526422 CACCAGGAGCAGAGCAAGGGAGG + Intergenic
995656381 5:114431728-114431750 CACCAAAAGCAGTACTTGGAAGG - Intronic
995835970 5:116399846-116399868 CACCAAGACCAGAGTGTGGATGG + Intronic
997152380 5:131512125-131512147 CAACAGAAACAGAGCATGCAGGG + Intronic
997512541 5:134463452-134463474 CACCAGAACCAGAACCTGGCAGG + Intergenic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000850897 5:166339276-166339298 AGCCAGAAGCAGTGCGTGTATGG - Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1002805123 6:566567-566589 GACCAGAATCAGAACGTGGTTGG + Intronic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1006093569 6:31642307-31642329 CACCAGAAGGGGAGCCTGGTGGG + Exonic
1006117001 6:31780825-31780847 AAGCAGGAGCACAGCGTGGATGG - Intronic
1006906209 6:37535534-37535556 CACCAGGAGCAGAGCACAGAGGG + Intergenic
1007279129 6:40697412-40697434 CACCAGACGGAGAGGGTGTAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1011942468 6:92858865-92858887 CACCAGAAGCAGAACAGAGAGGG + Intergenic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1013130471 6:107227636-107227658 CACCAGAAGCATAACTGGGAGGG - Intronic
1013441192 6:110171418-110171440 CATCAAAAGCAGTGCTTGGAGGG + Intronic
1015440518 6:133241622-133241644 CACCAGAGGCACAGCGCGAAGGG + Exonic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1018998650 6:168729198-168729220 CACCAGAGGCTGAGCGTGGCAGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024617554 7:51128492-51128514 CACCAAACACAGAGCGGGGAGGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027187825 7:75982312-75982334 AACCAGAAGCCGTGAGTGGAGGG + Exonic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032761352 7:134946488-134946510 TACCAGAGGCAGAGGGTGGGCGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1034086300 7:148325858-148325880 CCCAAGGAGCACAGCGTGGAAGG + Intronic
1034878796 7:154748430-154748452 CACCAGGAGCACAGTGTGGGTGG - Intronic
1034895328 7:154872669-154872691 CACCAGGAGCAGAGGGTAGTGGG - Exonic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035426740 7:158783163-158783185 TACGAGAAGCAGAACGTGTACGG + Intronic
1036280720 8:7398325-7398347 CAACAAAAGCAGTGCTTGGAGGG - Intergenic
1037290527 8:17345223-17345245 CTGCAGGAGCAGAGCGTGGCAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040500450 8:48000484-48000506 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041520668 8:58752452-58752474 CACCAGAAGGAGATACTGGAGGG - Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042932023 8:74023203-74023225 CACCAGGAGCAGAGGGTAGCAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046294984 8:112206252-112206274 TACCAGAAGCTGGGTGTGGAAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047650831 8:126918375-126918397 GACATGAAGCAGAGTGTGGAAGG - Intergenic
1048001089 8:130380109-130380131 CCCCAGAAGCCCAGCCTGGAAGG + Intronic
1049254700 8:141607619-141607641 CACCAGATGCTGGGCCTGGATGG - Intergenic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056410756 9:86324290-86324312 CAGCAGCAGCAGAGCCTGGTGGG - Intronic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1056944556 9:90983470-90983492 CGCCAAAAGCAGAGCAGGGATGG + Intergenic
1056959893 9:91113907-91113929 CACCTGAAGCAGCTCTTGGATGG - Intergenic
1057615720 9:96588076-96588098 CACAAGAAGCAAAGCTTTGAAGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1061669896 9:132182782-132182804 CACCAGGAGCGGAGCGGGCAGGG + Intronic
1061865923 9:133491741-133491763 CCCCAGGAGCAGAGCGGGCAAGG - Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186197499 X:7124375-7124397 CAGCAAAAGCACTGCGTGGAGGG + Intronic
1186847201 X:13542535-13542557 CACCAGCAGCAGAGCATTCAGGG - Intergenic
1187701852 X:21970425-21970447 CACCAGCAGCAGAGAGGAGAGGG - Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188439375 X:30199918-30199940 CAACAGAAGCAGTGCTTAGAGGG + Intergenic
1188995366 X:36878548-36878570 CAACAGAAGGAGAGCGTCTATGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1198051363 X:132956152-132956174 GACCAGAGCCAGAGCGGGGAAGG + Intronic
1200052637 X:153443075-153443097 GGGCAGAAGCAGAGCATGGAGGG - Intergenic
1200081179 X:153577236-153577258 CAGCAGAAGCCCAGCCTGGAAGG + Intronic