ID: 1113821992

View in Genome Browser
Species Human (GRCh38)
Location 13:113221265-113221287
Sequence GAGTATCCCAGAGTCCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113821991_1113821992 1 Left 1113821991 13:113221241-113221263 CCAAGGAGTCAGACTTCAGTCTG 0: 1
1: 0
2: 6
3: 96
4: 681
Right 1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113821992 Original CRISPR GAGTATCCCAGAGTCCTCAC AGG Intronic
900639652 1:3682536-3682558 GGCTAGCCCAGAGTCCTCCCGGG - Intronic
900885249 1:5410517-5410539 GAGTCTCCCAGGGCCCTCCCTGG - Intergenic
903221129 1:21870242-21870264 GAGGATCCCAGAGCCCCCAGAGG - Intronic
904501085 1:30913276-30913298 GAGGATCCCAAAGTCCTCCTAGG + Intergenic
905412729 1:37782858-37782880 GACTACGCCAGAGTCTTCACTGG - Intergenic
907942916 1:59106394-59106416 TAGTATCGCAGAGTCTGCACAGG - Intergenic
909942233 1:81624109-81624131 CAGTCTCCCAGAGACCTCAAAGG + Intronic
910422321 1:87079777-87079799 CAGAATCCCAAAGTGCTCACAGG - Intronic
911450788 1:98057844-98057866 CTGTTTCCCAGAGTCTTCACAGG + Intergenic
913190695 1:116410590-116410612 GAGAAGCCCAGAGTCCTTGCAGG + Intergenic
919881631 1:201904822-201904844 AAGGAGCCCAGAGTCCTCCCAGG + Intronic
920718674 1:208366666-208366688 CAGTAGCCCAGAATCCTCCCTGG + Intergenic
921195212 1:212750039-212750061 GAGAATGCCAGGGTTCTCACTGG - Intronic
924728778 1:246693187-246693209 CAGTATTGCAGAGTGCTCACAGG + Intergenic
1063252235 10:4286289-4286311 GAGTCTCCCACATTCATCACAGG + Intergenic
1069585964 10:69602554-69602576 GAGTTTACCAGAGTCCTCCTGGG + Intergenic
1073430160 10:103480681-103480703 GAGGATCCCAGCTTCCTCCCTGG - Intergenic
1074962817 10:118463473-118463495 GATTATCCCAGCGTGCTCCCTGG - Intergenic
1075726590 10:124613661-124613683 GAGATTCCCAGAGGCCTGACAGG - Exonic
1077363726 11:2152911-2152933 GAAAACCCCAGAGTCCTCCCAGG - Intronic
1083712089 11:64555807-64555829 GAGTTTCCCCGAGGCATCACAGG + Exonic
1084334740 11:68450093-68450115 GGGAATCCCTGGGTCCTCACAGG + Intergenic
1088252917 11:107877217-107877239 GGGGATCCCTGTGTCCTCACAGG + Intronic
1089065172 11:115657121-115657143 GTGTATCTCAGAGCCCTCCCTGG - Intergenic
1089410154 11:118234349-118234371 GAGTTTCCCTGAGACCTCAGGGG - Intronic
1089534190 11:119150391-119150413 TAGTATCCCATGGTGCTCACAGG - Intronic
1089951687 11:122534230-122534252 GAGAATCCCACAGTCCTCACAGG + Intergenic
1091556222 12:1575583-1575605 GAGGATCCCAGAGTCCTACAGGG - Intronic
1092349536 12:7744866-7744888 GAGCCTCCCAAAGTGCTCACAGG + Intronic
1096834279 12:54339030-54339052 AAGAAACCCACAGTCCTCACAGG - Intronic
1096997350 12:55847108-55847130 CAGTCTCCCAGAGTTCCCACAGG + Intergenic
1099485278 12:83222402-83222424 GAGAATCTCAGAGGCCCCACTGG + Intergenic
1101565692 12:105902806-105902828 GAGTATCCAGGAGTCCTTTCTGG + Intergenic
1102858640 12:116316592-116316614 AAGTGTCACATAGTCCTCACAGG - Intergenic
1113069255 13:106404011-106404033 GGCTATCACAGAGTCCTCACTGG - Intergenic
1113763628 13:112867346-112867368 GAGCAACCCAGAGGCCGCACTGG - Intronic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1114549624 14:23525478-23525500 GAGTTTCCCACAGGCCCCACAGG + Exonic
1114743838 14:25125281-25125303 GTGTGCCCCAGAGTCCTCATTGG - Intergenic
1116145982 14:41069565-41069587 GAGGAACCCTGTGTCCTCACAGG - Intergenic
1117886033 14:60364106-60364128 GAGCATCCCAAAGTTCTCATGGG + Intergenic
1120272148 14:82326551-82326573 GACAATCCCACAGCCCTCACAGG - Intergenic
1122410445 14:101523048-101523070 AAGTATCACAGAGGCATCACAGG - Intergenic
1122747153 14:103905078-103905100 GAGTTTGCCAGAGGCCACACAGG + Intergenic
1124179171 15:27456834-27456856 GAGGAGCCCAAAGTCCTCAGAGG + Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125521471 15:40350217-40350239 GAGGAGCACAGAGTCCCCACTGG + Intergenic
1132667959 16:1090561-1090583 GGGGCTCCCAGAGTCCCCACAGG + Exonic
1133293831 16:4740352-4740374 AAGGATCCCAGGGTCCTCCCTGG + Exonic
1136613434 16:31380834-31380856 TACTATCCCAGACTCCTCCCAGG - Intronic
1137520718 16:49193115-49193137 CAGTAGCCCAGAATCCCCACAGG - Intergenic
1139419940 16:66844159-66844181 TAGTGTCCCAGAGTCCGCACGGG + Intronic
1141466893 16:84212186-84212208 CTGTCTCCCAGAGTCCCCACAGG + Intergenic
1142722236 17:1784246-1784268 GAGTATCCCTGAGTCCAAAACGG + Intronic
1144250657 17:13413438-13413460 GAGTATGGCACAGTCATCACCGG + Intergenic
1146112190 17:30100055-30100077 GTATATCCCAGAATCCTCAAAGG - Intronic
1146260480 17:31417187-31417209 CGGTACCCCAGTGTCCTCACAGG + Intronic
1147654324 17:42080236-42080258 GAGGATCCAGGGGTCCTCACGGG + Intergenic
1151537797 17:74748605-74748627 GAGCGTCCCAGAGTCCGCCCCGG - Intergenic
1151733980 17:75927420-75927442 GAGTGTCCCAGAGGCATGACAGG + Intronic
1152775031 17:82195823-82195845 CAGCATCCCAGAGCCCACACAGG + Intronic
1156021993 18:32610003-32610025 CAGAATACCAGAGTCATCACTGG - Intergenic
1158204369 18:54975380-54975402 CAGTATCCCCAAGTCCTCCCTGG + Intergenic
1158592639 18:58790437-58790459 CTGAATCCCAGAGTCCTGACTGG - Intergenic
1159565771 18:70046870-70046892 GAGTGTCACAGGGTCCTCAGGGG - Intronic
1160062614 18:75546639-75546661 GATTGACCCAGATTCCTCACCGG - Intergenic
1160197874 18:76771737-76771759 GTGTCTCCCAGAATCCTCCCGGG - Intergenic
1160900137 19:1423866-1423888 GAGTGTCGCTGAGTCCACACTGG + Intronic
1161031682 19:2060677-2060699 GGGGAGCCCAGTGTCCTCACAGG + Intergenic
1165419192 19:35714698-35714720 GAGTATCACAGAGTGCTGGCCGG - Exonic
1166980204 19:46627630-46627652 GAGTTCCCCAGAGTCCGTACTGG + Intergenic
1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG + Exonic
1168579004 19:57537710-57537732 GAGCATCAGAGAGTCCACACTGG + Exonic
926123612 2:10257912-10257934 GAATATTCCAGAATCCTCAGTGG - Intergenic
926695413 2:15767150-15767172 GAGTGGCCCAGTGTCCTCATAGG + Intergenic
927627905 2:24742884-24742906 GAGTATCTCAGACTACTCATTGG + Intronic
932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG + Intronic
932284971 2:70524493-70524515 GAGTATCGCCGAGCCCTCTCGGG + Intronic
932846590 2:75141762-75141784 GAATATCCAAGAATCCTCATGGG - Intronic
933857349 2:86428833-86428855 GAGAACCCCACAGTCCTCATGGG + Intergenic
934161439 2:89253268-89253290 CTGTAACCCAGAGTCCTCATAGG + Intergenic
934205840 2:89929147-89929169 CTGTAACCCAGAGTCCTCATAGG - Intergenic
934751161 2:96795099-96795121 GAGTATCCCTTATTCCTCACTGG - Intronic
935209213 2:100923958-100923980 GAGGATCTCAGGGTCCTCAGAGG + Intronic
936471775 2:112805296-112805318 GTGTATCTCGGAGTCCTCAGAGG + Intergenic
936686771 2:114836733-114836755 CAGTCTCCCATAGTGCTCACAGG - Intronic
940278812 2:151968207-151968229 GTGGATCCCCGAGTTCTCACAGG - Intronic
942005519 2:171695681-171695703 AAGTATTCCACAGTCCTCAAGGG - Intronic
942350617 2:175049359-175049381 GAGAGTCCCTCAGTCCTCACAGG - Intergenic
944624612 2:201558627-201558649 CAGAACCCCATAGTCCTCACAGG + Intronic
946460108 2:219861364-219861386 GGGTCTCCCAGAGTCCTCTGGGG + Intergenic
947200149 2:227607747-227607769 GAGAACCCAAGAGTCCTCTCAGG - Intergenic
1170928333 20:20745733-20745755 TGGTTTCCCAGAGTCCTCCCGGG - Intergenic
1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG + Intergenic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1177909483 21:27012955-27012977 GAATATCCCAGGGTCCCCATTGG - Intergenic
1179016173 21:37595919-37595941 CAGGAAGCCAGAGTCCTCACTGG - Intergenic
1179999412 21:44988251-44988273 GGGTTTCCCAAAGTCCTCAGGGG + Intergenic
1183960128 22:41406453-41406475 GGGTACCCCAGAGCCTTCACAGG - Intergenic
1184610917 22:45602512-45602534 GAGTTTCCCATATTCCTAACGGG + Intergenic
949988196 3:9555739-9555761 GAGCATCTCAGAGTCCCCTCTGG + Intergenic
952034146 3:29179107-29179129 CTGTGTCCCAGAGTCCTCAGTGG + Intergenic
955507761 3:59648881-59648903 GAGCATCCCGCAGTCTTCACGGG + Intergenic
956872273 3:73429821-73429843 GAGTAACACAGAGTTCCCACTGG - Intronic
957926845 3:86825422-86825444 GACTATCCAAGAGACTTCACTGG + Intergenic
959263671 3:104112378-104112400 GGGTTCCACAGAGTCCTCACTGG - Intergenic
961103510 3:124221775-124221797 CAGAATCTCAGAGTCTTCACTGG + Intronic
962651555 3:137498940-137498962 CAGTCTCCCAGAGTGCTCCCAGG + Intergenic
965993274 3:174846063-174846085 GAGGGTCCCCCAGTCCTCACAGG - Intronic
968423485 4:504902-504924 GACTATCCCAGTGGCCTCCCTGG + Intronic
968469594 4:773302-773324 GAGATGACCAGAGTCCTCACTGG - Intergenic
969403537 4:6973273-6973295 GAGTACCCCAGACTTCTCAGAGG - Intronic
974914686 4:68164863-68164885 AAGTATCCAAGAGTCCACAGTGG + Intergenic
976469338 4:85409461-85409483 GAGTATTCCTGACTCCTAACTGG + Intergenic
980231981 4:130057172-130057194 CAGTATCCCATAGCCCTCCCAGG + Intergenic
984443506 4:179804315-179804337 GAGATTCCCCAAGTCCTCACAGG + Intergenic
986905279 5:12488207-12488229 GAGGATCCCCTAGTTCTCACAGG + Intergenic
986932992 5:12850930-12850952 GAGTATCCCAGACTCATTAATGG - Intergenic
987205874 5:15625006-15625028 GAGTATCCAGAGGTCCTCACCGG + Intronic
989543985 5:42651090-42651112 AAGTCTCCCAGAATCATCACTGG - Intronic
992834995 5:80631378-80631400 GAGTATGCCAGCATCCTGACAGG + Intronic
995565215 5:113426968-113426990 GAGTTCTCCAGAGTCCTCAAAGG - Intronic
997595554 5:135104947-135104969 AAGTCTTCCAGAGTCCTCCCAGG - Intronic
997864933 5:137453345-137453367 GAGTATCACAGAGAGCACACAGG - Intronic
998185510 5:139976156-139976178 GAGTGTCCCAGAGTACTGAAGGG - Intronic
1000418123 5:161005566-161005588 GAGAGCCCCACAGTCCTCACAGG - Intergenic
1002078614 5:176724598-176724620 GAGTATCCCACGGTCCTGACAGG + Intergenic
1004472023 6:15938072-15938094 GAGTGTCCCAGAGTCTAGACTGG + Intergenic
1006507326 6:34497807-34497829 GAATCTCCCAAAGTCCCCACTGG + Intronic
1006927102 6:37662858-37662880 GAATGACCCAGAGGCCTCACTGG + Intronic
1007110338 6:39310021-39310043 CAGTATCCCAGCCTCCCCACAGG - Intronic
1010007426 6:71010937-71010959 GAGACTCCTACAGTCCTCACAGG - Intergenic
1013208381 6:107965125-107965147 TAGAATCCCAGATTCCACACAGG - Intergenic
1013748537 6:113374134-113374156 GCATATCCCAGTGTCCACACTGG - Intergenic
1014844874 6:126262660-126262682 GAGAATCCCCCAGTCCTCATAGG - Intergenic
1023493411 7:40768356-40768378 GAGTTTCCTAGAGTCCTCAATGG + Intronic
1024535125 7:50424062-50424084 GAGTCTCCCAGAGGCCTCTGGGG - Intergenic
1024822418 7:53348539-53348561 AGGTATCACAGAGTCCTCACTGG + Intergenic
1025035857 7:55592154-55592176 GTGTATCCCATTGTCCTCAAGGG + Intergenic
1027534365 7:79378379-79378401 CAGTATCTCAGTGTCCTCATCGG - Intronic
1029405325 7:100371509-100371531 AAGTATCCTACTGTCCTCACTGG - Intronic
1030501449 7:110364458-110364480 GAGAAGCCTACAGTCCTCACAGG - Intergenic
1030577800 7:111311861-111311883 GAGTGTCCCAGTGTAATCACTGG - Intronic
1035457395 7:159017457-159017479 GGGGATCCCAGAGCCCACACGGG - Intergenic
1036443466 8:8801785-8801807 GAGGATCCCAGTGTCCACAGGGG + Intronic
1037910718 8:22742093-22742115 TAGAATCCCAGACTCCTCAGAGG - Intronic
1039297391 8:36171196-36171218 GAGTCTACAAGAGTCCTCAGGGG + Intergenic
1048433227 8:134390183-134390205 GAGGATTCTACAGTCCTCACAGG + Intergenic
1048522573 8:135170631-135170653 GAGTAGCTCAGAGTCCTACCGGG + Intergenic
1049245067 8:141557955-141557977 GAGTCTCACAGAGCCCCCACAGG - Intergenic
1053563059 9:39216031-39216053 TAGACTCCCAGAGTTCTCACAGG - Intronic
1054134088 9:61403024-61403046 TAGACTCCCAGAGTTCTCACAGG + Intergenic
1057457946 9:95231455-95231477 TCGAATCCCAGGGTCCTCACAGG - Intronic
1059389932 9:113992685-113992707 GAGCCTCCCCGAGTCCACACTGG + Intronic
1059511451 9:114852007-114852029 AATTTTCCCAGAGTCCTTACTGG + Intergenic
1061540367 9:131275097-131275119 CAGGGTCCCAGGGTCCTCACCGG + Intronic
1062201539 9:135305559-135305581 GAGCAGCCCAGAGGCCCCACCGG + Intergenic
1062693331 9:137857008-137857030 GAGAGCCCCATAGTCCTCACAGG - Intronic
1188514424 X:30969677-30969699 CAGAATCCCAGTGTCCTCATTGG + Intronic
1189872183 X:45395519-45395541 TAGTGTCCCAGAGTTCTCATAGG + Intergenic
1195706714 X:107742805-107742827 GAGTTTCCCAGATTCCTGAGGGG + Intronic
1195766180 X:108298638-108298660 GAGTTTCCCAGATTCCTGAGGGG - Intronic
1195839460 X:109157189-109157211 GAGAATCACGCAGTCCTCACAGG + Intergenic
1197341364 X:125270169-125270191 GAGAGACCCAGAGTCCCCACTGG + Intergenic
1198236999 X:134744941-134744963 CAGTCTCCCAGAGTCTCCACTGG + Intronic
1198846041 X:140912011-140912033 GAGTAGCTCTGAATCCTCACAGG + Intergenic
1200049203 X:153419796-153419818 GAGGATCCCAGACCCCTCCCTGG - Intronic
1201427857 Y:13874187-13874209 CAGTATCCCATAGTGCTCCCAGG + Intergenic
1202039603 Y:20668190-20668212 GGGTATCCCAGAGTCCCTGCAGG - Intergenic