ID: 1113822000

View in Genome Browser
Species Human (GRCh38)
Location 13:113221325-113221347
Sequence AGGTCACTCTGGCAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113821994_1113822000 30 Left 1113821994 13:113221272-113221294 CCAGAGTCCTCACAGGTTTTTTA 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG 0: 1
1: 0
2: 2
3: 17
4: 221
1113821995_1113822000 23 Left 1113821995 13:113221279-113221301 CCTCACAGGTTTTTTAAGCAAGA 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG 0: 1
1: 0
2: 2
3: 17
4: 221
1113821997_1113822000 -2 Left 1113821997 13:113221304-113221326 CCAGAATTAGATTGTTCATGGAG 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG 0: 1
1: 0
2: 2
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113822000 Original CRISPR AGGTCACTCTGGCAGAATGA TGG Intronic
902166378 1:14575158-14575180 AGGTCACTCTGGCAGCAGAGTGG + Intergenic
902711574 1:18243554-18243576 AGGTCACTCTGGCTGCTTGGTGG - Intronic
902724681 1:18326870-18326892 AGGTCACTCTGACAGCAGGGTGG + Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
904672866 1:32179481-32179503 TGGGCACTCGTGCAGAATGACGG + Intergenic
904826731 1:33277979-33278001 GGGTCACTCTGGGAAAATGCAGG - Intronic
906784917 1:48606801-48606823 AGATCACTCTGGCTGCAGGATGG - Intronic
906894423 1:49755829-49755851 AGATCACTCTGGCACAAATATGG - Intronic
908856629 1:68437066-68437088 AAGTTACTCTGGCAGCATCATGG - Intronic
915766762 1:158371172-158371194 AGGTCACTCTGCCAGTGAGAGGG - Intergenic
916187679 1:162148739-162148761 AGATCACTCTGGCAGCTTCATGG + Intronic
917752373 1:178065677-178065699 AGATCACTCTGGCTGCAGGATGG + Intergenic
919186848 1:194162008-194162030 AGGTCATTCTGTGACAATGATGG + Intergenic
919932554 1:202230796-202230818 AGGCCAATCTGGCATAAGGAGGG - Intronic
919972013 1:202587079-202587101 ATATCACTCTGGCAGATTCATGG - Exonic
920856588 1:209667646-209667668 AGATCACTGTGGCAGAGTGCAGG - Intergenic
921060898 1:211583684-211583706 AGATCACTCTGGCAGTAAAATGG - Intergenic
922903476 1:229156290-229156312 GGGTTGCTCTGGCAGAGTGAGGG - Intergenic
1065833967 10:29640453-29640475 AGCTCACTCTGGGAGAAGGTAGG - Intronic
1066463020 10:35628816-35628838 AGGTAACTATGGCAGAGAGAGGG + Intergenic
1067374961 10:45719356-45719378 AGGTCACTCTGGTTGAAATAAGG + Intergenic
1067378769 10:45753165-45753187 AGGTCACTCTGGTTGAAATAAGG - Exonic
1067882774 10:50060997-50061019 AGGTCACTCTGGTTGAAATAAGG + Intergenic
1067886468 10:50093845-50093867 AGGTCACTCTGGTTGAAATAAGG - Exonic
1069669928 10:70193711-70193733 AGGTCACCCTGACAGTAGGATGG - Intergenic
1069881609 10:71597009-71597031 AGCACACTCTGGCAGATTTATGG + Intronic
1070260098 10:74846258-74846280 AGTTCTCTGTGGCAGAATGTGGG + Intronic
1070720614 10:78754366-78754388 AGATCACTCAGGCAGCAAGAGGG + Intergenic
1070983574 10:80669280-80669302 AGGTCACTCTGTGAGGTTGATGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1076677580 10:132155350-132155372 AGGACACGCAGTCAGAATGAAGG + Intronic
1077726776 11:4682746-4682768 AGGTCACACTGGCAGTCTGCAGG + Exonic
1080183233 11:29448338-29448360 ATGACACTCTGGTAGACTGATGG + Intergenic
1081650731 11:44822455-44822477 AGGTCATTATGGAAGAAGGAAGG + Intronic
1085050914 11:73379787-73379809 AGGTCACTCTGGCAGTGTGCGGG - Intronic
1085189200 11:74603212-74603234 ACTTCACTCTGGCAGCATCATGG + Intronic
1087624442 11:100581020-100581042 AGATAACTGTGGCAAAATGAAGG + Intergenic
1091134552 11:133177019-133177041 GGGTCCCGCTGGCAGGATGATGG - Intronic
1093387934 12:18582419-18582441 AGCTCAGTCTGTCAGACTGAAGG - Intronic
1094221787 12:28001764-28001786 AGATAACTCTGGCAGAAAAACGG - Intergenic
1098131036 12:67350330-67350352 AAGTCACTCTGGCAACAGGAGGG - Intergenic
1101060049 12:100961441-100961463 GGGTCACTCTGCCAGAGGGAAGG - Intronic
1103042632 12:117708544-117708566 AGGACCCCCTGGAAGAATGAAGG + Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1105941429 13:25151361-25151383 AGCTCACTTTGTCAGAATGACGG + Intergenic
1106728090 13:32506931-32506953 AGATCACTCTGACAGAGAGAGGG + Intronic
1107607561 13:42075825-42075847 AGGTAACACTGGCAGAAACAAGG - Intronic
1107884727 13:44865856-44865878 AGGGGACTCGGGCTGAATGAAGG + Intergenic
1111485889 13:88897406-88897428 AGCTCACTTTAGCAGAATCAGGG - Intergenic
1113806762 13:113114549-113114571 ACGTCATTCTGGGAGAATTAAGG - Intronic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1117031775 14:51679123-51679145 AGGTCACCCTGGCAGCATTGTGG + Intronic
1117578527 14:57127460-57127482 TGGTCAGTCTGTCAGCATGAAGG - Intergenic
1118040156 14:61907747-61907769 AGGTAACTCTGGCACAATATGGG + Intergenic
1118437186 14:65782310-65782332 AGGGGGCTCTGCCAGAATGAGGG - Intergenic
1118760098 14:68875692-68875714 AGGGCACTCTGGCAGAGGTAGGG - Intronic
1118823300 14:69358869-69358891 AGGTCACTTTGGCTGATTGTAGG - Intergenic
1121044636 14:90778759-90778781 AGGGCACTCTGGCAGTTTAATGG - Intronic
1122820063 14:104338025-104338047 AGGTGACACTGGCAGGATCAGGG - Intergenic
1122895466 14:104754522-104754544 AGGACACTCGGGAAGAATAAAGG - Intronic
1125036265 15:35127512-35127534 AGGTCACTCTGATAGCATTATGG + Intergenic
1127807889 15:62537887-62537909 GGAGCACTGTGGCAGAATGAGGG - Intronic
1127998618 15:64170611-64170633 AGGTCCCTCTGGCAGGTGGAAGG + Exonic
1133315783 16:4883168-4883190 ACGTCACTCAGGGTGAATGATGG + Exonic
1133707384 16:8367874-8367896 AGGTCACACAGGGAGAATGTGGG - Intergenic
1134761928 16:16722203-16722225 AGCTCACTCTGGCAGCAGGGTGG + Intergenic
1134984130 16:18636967-18636989 AGCTCACTCTGGCAGCAGGGTGG - Intergenic
1135678404 16:24436768-24436790 AGGTCACTCGGACTGATTGAAGG - Intergenic
1135847620 16:25933037-25933059 AAGTCTCTCTGGCAAAATGTGGG - Intronic
1137592280 16:49700868-49700890 CAGTCACTCTGGCAGAAAGGAGG + Intronic
1137923625 16:52517731-52517753 AGGTCACTCTGAAAGTATGGAGG + Intronic
1138873524 16:60921858-60921880 AGGACACTGTGGCCGAATCATGG + Intergenic
1141008050 16:80371611-80371633 ATTTCACTGTGGCAGCATGATGG - Intergenic
1142692981 17:1617992-1618014 AGGTCACGCTGGGAGAGTCAAGG + Intronic
1143330375 17:6130581-6130603 AGCTCACTCAGGTAGAATAATGG + Intergenic
1143619702 17:8073880-8073902 GGGTCACGCAGGCAGGATGAGGG - Intronic
1144452547 17:15393095-15393117 GGGTCACCCTTGCAGAAGGATGG - Intergenic
1145261170 17:21355654-21355676 AGGCCACTCTTGCTGAATAAGGG + Intergenic
1148468421 17:47878488-47878510 AGGTAAAGATGGCAGAATGAAGG - Intergenic
1151783412 17:76262793-76262815 AGGTCACTCAGGAAGAAGGAAGG - Intergenic
1152181274 17:78823229-78823251 AGGTCACTTTTGAAGAATGGTGG - Intronic
1153394429 18:4602458-4602480 AGGTCACTTTAGCAACATGATGG - Intergenic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1153601637 18:6786515-6786537 AGGTTACAGTGGCACAATGATGG - Intronic
1155014667 18:21821507-21821529 AGGTAGCTCTGGAAGAAAGACGG - Intronic
1155266572 18:24100372-24100394 AGGTCACTCGGCCAGAGTGGAGG - Intronic
1158083759 18:53625994-53626016 AGGTCACGCTGACAAATTGAAGG - Intergenic
1158392803 18:57057602-57057624 ACATAACTGTGGCAGAATGAAGG - Intergenic
1160197794 18:76770954-76770976 AGAACACACTGGAAGAATGAGGG + Intergenic
1163294585 19:16404151-16404173 AGATCACTTTGGAATAATGAGGG + Intronic
1164038650 19:21475052-21475074 AGGCCACTCTGGCCGCAAGATGG + Intronic
1164244101 19:23415753-23415775 AGGTCCCTCTGGCCGCAAGATGG - Intergenic
1164546152 19:29164760-29164782 AGTTCATTTTGGCAAAATGATGG - Intergenic
1165711462 19:38014046-38014068 AGGTCTCCCAGGCAGAATGCCGG - Intronic
1165996473 19:39847310-39847332 AGGTCCCTCTGGCTGCATGTGGG + Intergenic
927146810 2:20171638-20171660 AGGCCACTGGGGCAGATTGAGGG + Intergenic
927491940 2:23526591-23526613 AGGTCACTCTGGTAGGCAGAGGG - Intronic
931048015 2:58379086-58379108 AAGGCACTCAGGCAGAAAGAGGG + Intergenic
932486663 2:72088061-72088083 AGGTCACTCTGGTATCATTATGG - Intergenic
933790225 2:85878115-85878137 AGCTCACTGTGGCACAATGTAGG + Intronic
935834480 2:107036267-107036289 AGCTCTTTCTGTCAGAATGAAGG - Intergenic
936396230 2:112133801-112133823 AGTTCACACTGGCAGCAAGAAGG + Intergenic
936493624 2:112997830-112997852 AGGTCCCACAGGCAGAATGATGG - Intergenic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
937094133 2:119224549-119224571 TGGTCACTCTGGGTAAATGAAGG + Intronic
937384879 2:121420223-121420245 ACATCACTCTGGCAAAATTAAGG - Intronic
939008282 2:136815291-136815313 AGGTCAGTCAGGCAAAAAGATGG + Intronic
940173128 2:150849988-150850010 AGGTCACGCTGACAAACTGAAGG + Intergenic
940422184 2:153492101-153492123 AGAGGATTCTGGCAGAATGATGG + Intergenic
940755205 2:157674113-157674135 AGGTACCTCTGGAAGCATGAAGG + Intergenic
941140429 2:161774047-161774069 AGAACACTCTGGCAGTATTAAGG - Intronic
942300466 2:174556425-174556447 AGGTCACTCAGGGAGTATGAAGG + Intergenic
942781235 2:179646094-179646116 AGATCACTCTGGCAGCATTGTGG - Intronic
943749175 2:191494004-191494026 AGGTCACACAGGCAAATTGAAGG + Intergenic
944386634 2:199172262-199172284 AGCTCAGTCTGGCAGTAGGATGG + Intergenic
944523551 2:200595857-200595879 AGGTCACTCTGGCTGATGTATGG - Intronic
946121931 2:217523630-217523652 AGTTCTCTCTGCCACAATGAGGG + Intronic
947192332 2:227520124-227520146 AGGTTAGTCTGACACAATGAAGG + Intronic
948230167 2:236343352-236343374 AGGGCACTGTGGGAGAATGCAGG + Intronic
1170107550 20:12767878-12767900 CAGTCCCTCTGGCAGAGTGATGG - Intergenic
1171044046 20:21793855-21793877 AGGTCACTCAGGCTGACTGCTGG + Intergenic
1171086197 20:22240210-22240232 TGGTCACTCTGGGAGTATCAAGG + Intergenic
1171195124 20:23190926-23190948 AGGTCACTGTTGCAGAGGGAAGG - Intergenic
1172448352 20:35004702-35004724 AGCTGACTGTGGCAGAAAGAAGG + Intronic
1172629295 20:36367365-36367387 AGGTCCCTCTGCCAGCATGTGGG - Intronic
1172972550 20:38883967-38883989 GGGTCACTCTGACAAACTGATGG + Intronic
1173793779 20:45844497-45844519 GGGTCCCTGTGGAAGAATGAGGG - Intronic
1174533990 20:51236941-51236963 GGGTCACTCTGGCTGTACGAAGG + Intergenic
1175800564 20:61798783-61798805 TGGTCAGTCTGGCAGGATGGCGG + Intronic
1177832785 21:26158135-26158157 AGTTCTCTCAGCCAGAATGAAGG + Intronic
1178599484 21:33983767-33983789 AGGTCACACCAGCAGACTGAGGG - Intergenic
1178881651 21:36454793-36454815 AGGTCACTGTGGCAGGAAGGAGG - Intergenic
1179046857 21:37852382-37852404 AGGTCACTCTTGCAAAGTGTTGG + Intronic
1179434827 21:41353432-41353454 CTGTCACTCTGGCATAAAGATGG + Intronic
1181511257 22:23389653-23389675 AGGACACCCTGGCAGGAAGAAGG + Intergenic
1181851183 22:25751041-25751063 AGGACACTCAGGCAGAGGGAGGG - Intronic
1182356485 22:29724514-29724536 AGGTCACCCTGCCAGGATGTAGG + Intronic
1183426210 22:37740844-37740866 AGGTCCCTTTGGCAGGATGGGGG - Intronic
1184187940 22:42877148-42877170 AGGTTACTATGGCAGAATGCGGG + Intronic
1185085122 22:48736786-48736808 AGGTCACAGAGGCCGAATGAAGG + Intronic
950274562 3:11647738-11647760 AGGTCAGTCTGGCAGAAGTCTGG + Intronic
953373567 3:42409900-42409922 AGGTGACTATGGCAGAGTGAAGG - Intronic
954574183 3:51666050-51666072 AGGTCAGCCTCCCAGAATGATGG - Exonic
960063124 3:113343622-113343644 AGGTCACTCTGGCAGGAGCCTGG + Intronic
960366838 3:116783113-116783135 AGATCACTTTGGCTGACTGAAGG - Intronic
961211951 3:125132208-125132230 AAGCCATCCTGGCAGAATGAAGG + Intronic
963005650 3:140724191-140724213 AGGTCACTGTGGGAGAGGGAAGG - Intergenic
963683213 3:148407336-148407358 ATGGCACTTTGGAAGAATGAAGG - Intergenic
966677289 3:182602993-182603015 AGGTTAACCTGGCAGTATGATGG - Intergenic
969456229 4:7301208-7301230 AGCAAACCCTGGCAGAATGAAGG - Intronic
970485467 4:16520683-16520705 AGATCACTCTGGAAGAAGGATGG - Intronic
973277090 4:48321566-48321588 AGATTACTCTGGGAGAAGGATGG - Intergenic
975903812 4:79185961-79185983 AGGGCACTTTGGCACAATGTGGG - Intergenic
979733622 4:124055034-124055056 AGTTGACTCTGGCAGGATGAGGG - Intergenic
982546057 4:156734486-156734508 AGGGCACTCTTACAGAAAGATGG + Intergenic
982637108 4:157910532-157910554 AGGACACTCACCCAGAATGAGGG - Intergenic
984655549 4:182313916-182313938 AGATCTCTCTGGCTGAAGGATGG - Intronic
985550785 5:532566-532588 AGGTCACTCTGACAGTTTCAGGG - Intergenic
988955532 5:36312773-36312795 AGGACACTGAGGCAGAATGATGG + Intergenic
990036035 5:51320951-51320973 ACGTCACTTTGAAAGAATGAAGG - Intergenic
990153793 5:52850908-52850930 AGGTACCTCTGGGAGAATAATGG + Intronic
991131304 5:63125481-63125503 ATGTCACTCTTTCTGAATGAGGG + Intergenic
994209617 5:97073389-97073411 AGGTCACACAGGCAAATTGAAGG - Intergenic
994858665 5:105159590-105159612 TCGTGACTCTGGCAGAGTGAAGG + Intergenic
997058024 5:130467670-130467692 AGGTCACTCTGGCACAGGGATGG - Intergenic
997529454 5:134572934-134572956 CTGTCACTGTGGCAGAGTGAAGG + Intronic
1000495657 5:161981389-161981411 AGGTCATTGTGGCATAATTAAGG - Intergenic
1001575008 5:172757623-172757645 AGATCACTGTGGCAAAATCATGG + Intergenic
1001973743 5:175979402-175979424 AGGTCACACTTGCCGATTGAAGG - Intronic
1002243689 5:177864377-177864399 AGGTCACACTTGCCGATTGAAGG + Intergenic
1002613055 5:180433869-180433891 AAGCCACTTTGGCAGAATAATGG - Intergenic
1004019189 6:11761117-11761139 AGGACATTCTGGCAGAAGAAAGG - Intronic
1004422679 6:15486082-15486104 AACTCCCTCTGGCAGGATGATGG + Intronic
1004470244 6:15922556-15922578 AGGTCTCCCTGGGAGAATGCAGG + Intergenic
1004960325 6:20781143-20781165 AGGTCACTCTGTGAGACTGCTGG + Exonic
1007322320 6:41036666-41036688 AGGCCTTTCTGGCAGAAGGAGGG - Intronic
1010568564 6:77449698-77449720 ACCTCACTCTGGCCCAATGATGG - Intergenic
1012988558 6:105900617-105900639 AGGTCTCGATGGCAGAAAGATGG - Intergenic
1013277108 6:108595971-108595993 TGGGCAGTCTGACAGAATGAAGG - Intronic
1015689966 6:135910919-135910941 AGGTTAATCATGCAGAATGATGG - Intronic
1017738849 6:157386928-157386950 TGCTCACTGGGGCAGAATGAAGG + Intronic
1018282085 6:162197994-162198016 AGGACACTTTGGTAGAATGAAGG + Intronic
1018873285 6:167799282-167799304 AGGACATTCTGGGAGAGTGAAGG - Intergenic
1021235001 7:18132167-18132189 GGGACACACTGGCACAATGAAGG - Intronic
1021416606 7:20393468-20393490 AGATCACTCTGGCAGCCAGATGG - Intronic
1021576073 7:22107558-22107580 AGGTCACGGTGCCAGAAGGATGG + Intergenic
1021929303 7:25563719-25563741 AGATCAATCTGGAAGAAGGAAGG + Intergenic
1023295535 7:38711540-38711562 AGGTGACTCTGGGAGATGGAGGG - Intergenic
1023791516 7:43757449-43757471 AGGTCACTCTGGCTGCTTTATGG + Intergenic
1024205754 7:47159231-47159253 AGGTCAGGCAGGCAGAATGCTGG + Intergenic
1024831665 7:53466598-53466620 AGGTCACACTGGCAGCATCATGG - Intergenic
1026580830 7:71615335-71615357 AGGTCTCGCTGGCAGATGGAGGG - Intronic
1027245782 7:76366334-76366356 AGGTCACTCAGGAAGATTAATGG - Intergenic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028231980 7:88316543-88316565 AAGTCACTGTGGCACAATGTTGG - Intergenic
1028577217 7:92365614-92365636 AGATCACTCAGGCAGAAGTATGG + Intronic
1028869219 7:95748890-95748912 AGGTCAATATGGCAGTATGAAGG + Intergenic
1030108033 7:106003312-106003334 TGGTCAATCTGCCAGACTGATGG + Intronic
1031674083 7:124588081-124588103 AGGTCTCTCTGACAGCATGTGGG - Intergenic
1031883826 7:127225136-127225158 AAGTGACCCTGGCAGAAGGAGGG - Intronic
1033547409 7:142413915-142413937 AGGACACTCTCCCAGTATGAAGG + Intergenic
1034091747 7:148370409-148370431 AGGTCACTCTGCTAGAAGGTGGG - Intronic
1034841133 7:154398378-154398400 AGGTAAATCTGGCAGTGTGATGG - Intronic
1034936039 7:155201594-155201616 AGGTCACTCAGGCCAAATGCTGG + Intergenic
1035891299 8:3346498-3346520 ATCTCACACTGGCAGTATGAGGG - Intronic
1038193001 8:25340987-25341009 AGGTCAGCCTGGCAGCATCATGG + Exonic
1038709959 8:29934143-29934165 AGGTCACTGTGATAGAGTGAGGG + Intergenic
1039005788 8:33035578-33035600 AGGTCTGCTTGGCAGAATGAAGG - Intergenic
1039385181 8:37129245-37129267 AGGTCACCCTGACTGGATGAAGG + Intergenic
1039912146 8:41834166-41834188 AGGTCACTCCAGCAGGAGGAGGG + Intronic
1040899040 8:52398719-52398741 ACATCACATTGGCAGAATGAAGG - Intronic
1041093847 8:54329874-54329896 AGATCACTCTGGCTGATGGATGG + Intergenic
1041500568 8:58534572-58534594 AGGGCACCCTGGCCAAATGAGGG - Intergenic
1042372816 8:68011508-68011530 TGGTGACTGTGGCAAAATGAAGG + Intronic
1042911460 8:73831651-73831673 AGGAGACTCAGGCAGAAGGACGG - Intronic
1045912815 8:107429844-107429866 AGGACACTCTGACAGAATGATGG + Intronic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1047641670 8:126827600-126827622 AGGTTACACTGGCAGCAAGATGG + Intergenic
1049264703 8:141661318-141661340 AGGTCACCCTCTCAGAAAGAAGG - Intergenic
1052376310 9:27721699-27721721 GGGTCACCCTGTCAGACTGAGGG + Intergenic
1053427784 9:38022427-38022449 GGGTCACTCTGAGAGAATGATGG + Intronic
1057576864 9:96249381-96249403 AGCTCACTCTGGAAAACTGACGG - Intronic
1057942932 9:99300521-99300543 AGGAGGCTCTGGCAGAATGGGGG - Intergenic
1058783171 9:108359813-108359835 AAAACACTCTGGCAGAAAGAAGG - Intergenic
1058950059 9:109894943-109894965 AGGTAAATCTTGCAGAATGGTGG - Intronic
1060053380 9:120392762-120392784 AGGTCAACCTGGCAGAGTGGTGG - Intronic
1061847313 9:133394956-133394978 AGGTCACTCTGGCTGCAGGGAGG + Intronic
1061997069 9:134191665-134191687 AGGTCACTATGGCTGAGAGAGGG + Intergenic
1187162606 X:16778615-16778637 AGATCACTCAGGCATACTGATGG - Intergenic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1187683531 X:21792785-21792807 ACATCACTCTGGCAGAGAGAAGG - Intergenic
1188331423 X:28876250-28876272 TGGTCACTGTGGCAGGAGGAAGG + Intronic
1189839553 X:45059511-45059533 AGAACACTCAGGCAGAAGGAGGG + Intronic
1190125159 X:47698384-47698406 AGGTCACACTGACAAATTGAGGG - Intergenic
1190492168 X:50993160-50993182 AGCTCACTCTGACAGGATGAGGG - Intergenic
1190500934 X:51077988-51078010 AGCTCACTCTGACAGGATGAGGG + Intergenic
1192815717 X:74589093-74589115 AGGTAACTCAAGCAGAATGCTGG - Exonic
1193297815 X:79852951-79852973 AGGCCACTCTGGCAGGCTGGGGG - Intergenic
1194529909 X:95033952-95033974 AGGTCACTATGTCATAATAAAGG - Intergenic
1196510680 X:116508082-116508104 AGGTCACTTTGCCATATTGATGG + Intergenic