ID: 1113824792

View in Genome Browser
Species Human (GRCh38)
Location 13:113243341-113243363
Sequence CTGCATGCATGGGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113824792 Original CRISPR CTGCATGCATGGGTGGAGGA GGG Intronic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901737328 1:11320621-11320643 CTGCAGGCATGGGCAGAGGAGGG - Intergenic
901875038 1:12162605-12162627 CTGCAAGCGAGGGTGGAAGAAGG - Intergenic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
902397910 1:16142567-16142589 ATGGATGGATGGGTGGAGGGGGG + Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902721184 1:18305246-18305268 ATGGATGCATGGATGGTGGATGG + Intronic
902895933 1:19480038-19480060 CTGCAGGGCTGCGTGGAGGAGGG + Intronic
903293951 1:22331987-22332009 CTCCAGGCAGGGGTGGGGGATGG + Intergenic
903974666 1:27141679-27141701 CTGCCTGCCTGGCTGGTGGAAGG - Intronic
904773729 1:32894565-32894587 CTGCATGCAGGGGGGGCGGTTGG - Exonic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905238443 1:36566278-36566300 CTGCCTGCCTGGGTGGAGGGAGG - Intergenic
905272039 1:36793675-36793697 GTGGATGGATGGGTGGTGGATGG + Intergenic
905288992 1:36908466-36908488 CTTCTTGCATGGGTGGAGCTTGG - Intronic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
907510259 1:54952759-54952781 CAGCATGCATGGGGGCAGGTGGG - Intergenic
909941591 1:81617341-81617363 TTCCATGGATGGGTGGAGGTAGG - Intronic
910556233 1:88536701-88536723 CTGCATGCATGCATGGGTGATGG - Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
912977248 1:114341834-114341856 CTGCAAGGGTGGGTGGAAGAGGG + Intergenic
914351283 1:146842681-146842703 ATGGATGGATGGGTGGATGATGG + Intergenic
914351301 1:146842755-146842777 ATGCATGGATGGATGGATGATGG + Intergenic
916328160 1:163586753-163586775 TTTCTTGCATGGGTGGAGGCTGG + Intergenic
917985659 1:180315622-180315644 CTGAATGTAGGGGTGGAGGTTGG + Intronic
918234528 1:182566952-182566974 TTGTATGTATGGGTGGAGGGTGG - Intergenic
918372169 1:183871466-183871488 TTGCAGACCTGGGTGGAGGAGGG + Intronic
919918907 1:202156711-202156733 CTGCCTGCATGGGCGGATCAAGG - Intronic
920188662 1:204178539-204178561 CTGCATACATGGTGGGAGGCAGG - Intergenic
921218025 1:212953202-212953224 CCGCATACATGGTTGGAGGAAGG - Intronic
921377144 1:214486104-214486126 CTGCAGGCAGGGGTAGAGGGAGG + Intronic
921589904 1:216991188-216991210 TTCCATGGATGGGTGGGGGATGG - Intronic
922050289 1:221982855-221982877 TTGCATGCATGCGTGGAAAAAGG + Intergenic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
924049015 1:240061535-240061557 CGGAATGCAAGGGTGGCGGAGGG + Intronic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063588995 10:7378099-7378121 GTGTATGGATGGGTGGATGATGG + Intronic
1064428953 10:15255004-15255026 CTGCATGAATGGGGGAAGGGAGG - Intronic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1065860666 10:29870276-29870298 ATACATGAATGGGTGGTGGATGG - Intergenic
1065860814 10:29871046-29871068 ATGGATGGATGGGTGGTGGATGG - Intergenic
1068419985 10:56779033-56779055 CTGAAATCATGGGGGGAGGAGGG - Intergenic
1068705495 10:60071094-60071116 CCGCATCCAGTGGTGGAGGAGGG + Exonic
1068810268 10:61247855-61247877 TTGGATAAATGGGTGGAGGATGG - Intergenic
1068911378 10:62381822-62381844 CTGCCTGCAAGGGAGTAGGATGG - Intronic
1069711103 10:70489166-70489188 CAGCCTACGTGGGTGGAGGATGG + Intronic
1070746948 10:78939489-78939511 CTGAAAGGATGGGTGTAGGAGGG - Intergenic
1071747819 10:88441891-88441913 TTGCCTGCATGGGTAAAGGAAGG - Intronic
1073082674 10:100869732-100869754 GTGCATGCATGTGTGTAGGGGGG + Intergenic
1073727638 10:106252872-106252894 GTGCATGGCTGGGTGGGGGAGGG - Intergenic
1073861551 10:107748534-107748556 GTGCATTCAGGGGAGGAGGAAGG + Intergenic
1074783189 10:116817096-116817118 CTGCATGGTGGGGTGGGGGAAGG - Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1076867588 10:133175651-133175673 GTGGATAGATGGGTGGAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077383179 11:2256999-2257021 GTGCATGCATATGTGCAGGAGGG + Intergenic
1077404916 11:2378481-2378503 GTGCCAGCGTGGGTGGAGGAGGG + Intronic
1079132095 11:17753009-17753031 CTGCATAGATGGGTGGCTGAAGG + Intronic
1081353603 11:42086187-42086209 CTGCTTACATGTGTGGAAGAGGG + Intergenic
1081537348 11:44005374-44005396 CAGCCTGCCTGGGTGGGGGAGGG + Intergenic
1081646734 11:44795465-44795487 CTGCTTGGATGAGTGGAGGTAGG - Intronic
1083796873 11:65021955-65021977 CAGCAGGCTGGGGTGGAGGAGGG - Exonic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084457954 11:69279237-69279259 CTGCATGCATGGGTGGCTGATGG - Intergenic
1084457978 11:69279380-69279402 TTGCATGCATGGGTGGCTGGTGG - Intergenic
1084458027 11:69279664-69279686 CTGCATGCATGGGTGGCTGGTGG - Intergenic
1084458050 11:69279806-69279828 CTGCATGCATGGGTGACTGGTGG - Intergenic
1084458069 11:69279948-69279970 CTGCATGCATGGGTGACTGGTGG - Intergenic
1084458078 11:69280020-69280042 CTGCATGCATGGATGGCTGGTGG - Intergenic
1084458090 11:69280090-69280112 CTGCATGCATGGGTGGCTGGTGG - Intergenic
1084458114 11:69280230-69280252 CTGCATGCATGGGTGCCTGGCGG - Intergenic
1084667808 11:70585894-70585916 ATGGATGGATGGGGGGAGGATGG - Intronic
1084713530 11:70859189-70859211 CTGGATGGATGGGTGGATGAGGG + Intronic
1084963291 11:72728964-72728986 CTGGAAGCAGGGGTGGAGGGCGG + Intronic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1087097792 11:94336683-94336705 CTACATTCATGGGTGGGGAAGGG + Intergenic
1089085778 11:115815708-115815730 CTGGAGGCATGGGAGAAGGAGGG + Intergenic
1089524724 11:119089472-119089494 CTGCAAGAATGGCTGGGGGAGGG + Intronic
1090612259 11:128481968-128481990 CTGAATGGATGAGTGGAGGAAGG - Intronic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091117902 11:133031578-133031600 GTGAATGGATGGGTGGTGGATGG + Intronic
1091237991 11:134034381-134034403 AAGCATGGATGGGTGGAAGAGGG - Intergenic
1091299419 11:134498001-134498023 CTTGGTGCCTGGGTGGAGGACGG + Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091603022 12:1929444-1929466 CACCATGCATGGGTGGGGGCCGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1094853454 12:34392582-34392604 CTGCACGCATGTATGGTGGAGGG - Intergenic
1095205773 12:39439059-39439081 CTGAGTGCATGGGTGTAGGAAGG - Intronic
1096682697 12:53267460-53267482 CTGAATTCTTTGGTGGAGGAAGG + Intergenic
1098143046 12:67469977-67469999 CTGCAGCCAGGGGTGGGGGAGGG + Intergenic
1098197058 12:68013277-68013299 CTCAATGCATTGGTGGAGGTTGG + Intergenic
1098197639 12:68018655-68018677 CTGCATTGAGGGGTGAAGGAAGG - Intergenic
1098463685 12:70762945-70762967 CTGTTTGCAAGGGTGAAGGAGGG - Intronic
1099923190 12:88984553-88984575 GTGCATGCATGTGTAGAAGAAGG - Intergenic
1101801025 12:108022049-108022071 CTGCATGCATGGATGATGGGTGG - Intergenic
1102199791 12:111049353-111049375 ATGGATGCATGCATGGAGGAAGG - Intronic
1102566070 12:113798279-113798301 CTGCATCCATGGCTGGCGGCTGG - Intergenic
1102699476 12:114826479-114826501 CTGCAGGCTGGGGTGGAGCAGGG - Intergenic
1103362224 12:120361333-120361355 TTGCAGGGTTGGGTGGAGGAAGG - Intronic
1103892175 12:124248000-124248022 CTGCATGCATAGGTGCCGGCAGG - Intronic
1103903780 12:124317003-124317025 CTGCCTGCTTTGATGGAGGATGG + Intergenic
1103933569 12:124463468-124463490 CTGCCTGCGTGGGTGGGGGCCGG - Intronic
1103941441 12:124503425-124503447 ATGCATGCATGGATAGAGAAAGG + Intronic
1104599314 12:130141861-130141883 CTGTAACCATGGGTGGAGGGTGG - Intergenic
1104968083 12:132518511-132518533 ATGCATGCATGCATGGTGGATGG - Intronic
1106270286 13:28146386-28146408 CTGGATCTATGGGGGGAGGAGGG - Intronic
1106423398 13:29602715-29602737 CTGCATGCATGCCTGTGGGATGG + Intergenic
1106856863 13:33863400-33863422 TTGCATTTATGGGAGGAGGAAGG + Intronic
1106892065 13:34256424-34256446 CTGTATGTGTGCGTGGAGGAGGG + Intergenic
1107435387 13:40376741-40376763 TTGCTGGCCTGGGTGGAGGATGG - Intergenic
1107462400 13:40616732-40616754 CTGCATGCAAGGGGTGTGGAGGG + Intronic
1110633584 13:77738558-77738580 CTCCATCCATGGTAGGAGGAGGG - Intronic
1112371527 13:98798081-98798103 CTGCTTGCAAGGGTGGTGCAGGG - Intronic
1113388295 13:109871139-109871161 CTGCTAGCATGGGTGGCGGGTGG + Intergenic
1113643487 13:111975785-111975807 GGGCATGCATGTGTGCAGGATGG + Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1114447666 14:22801825-22801847 CCGCATGCATGGGTGCATGCCGG - Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115712136 14:36062180-36062202 CTTCCTGCATGTGTGGAGGGAGG + Intergenic
1116164612 14:41318647-41318669 ATGCATGTATGTGTGGAGTATGG - Intergenic
1116582045 14:46654175-46654197 CCTCATGCATGAGTGGAGTAGGG - Intergenic
1117558522 14:56911234-56911256 CTGCCTCCATGGGTGGGGGGCGG - Intergenic
1117628718 14:57667182-57667204 CTGCAAGCATGGGGGAGGGAGGG + Intronic
1118323437 14:64766589-64766611 CTGCAGGGATGTGGGGAGGATGG + Intronic
1118727497 14:68639443-68639465 CTGCATGCAAGGGTGGCTGATGG + Intronic
1119206851 14:72800774-72800796 GTGGATGCATGGGTGGATGCAGG + Intronic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1122391952 14:101395536-101395558 CTGTATGCCAGGGTGGAGGCTGG - Intergenic
1122393684 14:101407821-101407843 CTGCATGCAGGCATGGTGGATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122866722 14:104609074-104609096 TTGCATTCCTGGGTGGAGAAAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123941844 15:25220460-25220482 CTGGATGCATGTGTGGGGCAGGG + Intergenic
1124864341 15:33474226-33474248 CTGGATGCATGGATGGATGGTGG + Intronic
1125491505 15:40152072-40152094 CTGCATGCCGTGGCGGAGGAAGG - Intergenic
1126779079 15:52123321-52123343 CTGGATGCAGGGGTGGGGGAGGG - Intronic
1127582560 15:60351097-60351119 CTTGATTCATGGATGGAGGAAGG - Intronic
1127675262 15:61232132-61232154 CTGCATGGATGGCTGCAGAAAGG - Intergenic
1128579468 15:68798735-68798757 CTGCATGGATGTGTGGAAGGTGG - Intronic
1128983661 15:72203615-72203637 CTCCATGCATGCATGGAGGCTGG - Intronic
1128997470 15:72307325-72307347 CAGCATGCCTGGGTGGTGGGAGG - Intronic
1129881057 15:79006151-79006173 CTCCGGGCATGGGAGGAGGAGGG + Intronic
1131348938 15:91678820-91678842 CAGCATTCATGGGAGGAAGAAGG - Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132699113 16:1214794-1214816 CTGTATGCTGGGCTGGAGGAGGG + Intronic
1132866113 16:2093473-2093495 CTGCGTGCATGGGTGGGAGGTGG + Intronic
1133210372 16:4260292-4260314 CTGCATGAAAGGGAGGTGGATGG - Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1134319607 16:13150710-13150732 CTGCTTGCAGGGGTGGTGGGAGG - Intronic
1135548100 16:23379081-23379103 AGGGATGAATGGGTGGAGGATGG - Intronic
1135548123 16:23379173-23379195 AGGGATGAATGGGTGGAGGATGG - Intronic
1135915270 16:26599978-26600000 CAGCATGCATGCGGGGAGCAGGG + Intergenic
1137558434 16:49488093-49488115 CTGAATGGATGAGTAGAGGAAGG + Exonic
1137726082 16:50657659-50657681 CTGCAGGCAAGGGCAGAGGAGGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138149203 16:54639868-54639890 CTGAATGGATGGGTGGGGGTGGG + Intergenic
1138421192 16:56900304-56900326 CTGCAGCCATGCTTGGAGGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138511038 16:57508512-57508534 GTGGAAGGATGGGTGGAGGAAGG - Intergenic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1139659562 16:68411482-68411504 CTGCAGGCATGGGTGGAGGCTGG + Intronic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1139982753 16:70872865-70872887 ATGGATGGATGGGTGGATGATGG - Intronic
1140781510 16:78301036-78301058 TTACATGCATGGATGGATGATGG - Intronic
1141032001 16:80597138-80597160 ATGCATGGATGGTTGGATGATGG + Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141907526 16:87037298-87037320 CCCCACCCATGGGTGGAGGAAGG + Intergenic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1142936979 17:3342970-3342992 CGGCAAGCCTGGCTGGAGGAGGG - Intergenic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1143171357 17:4932449-4932471 CTGCAGGCAAGGGTGGGAGATGG + Intronic
1143252622 17:5534454-5534476 CTGGATGCATGGGTGGATGGAGG - Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1145262425 17:21362479-21362501 ATGCATGGATGGATGGATGATGG + Intergenic
1145291382 17:21549339-21549361 CTGGATGCTTGAGTGGAGGCTGG + Intronic
1145388694 17:22437714-22437736 CTGGATGCTTGAGTGGAGGCTGG - Intergenic
1145908514 17:28529239-28529261 CTCCAGGGATGGGAGGAGGAGGG + Intronic
1145984015 17:29032182-29032204 TTGCAGGCATGGGTGGGGGTGGG + Intronic
1146080210 17:29773057-29773079 ATGGATGGATGGGTGGATGATGG - Intronic
1146080215 17:29773076-29773098 ATGGATGGATGGGTGGATGATGG - Intronic
1146091139 17:29879468-29879490 CTATATGCATGTGTGGAGGCAGG - Intronic
1146834486 17:36099244-36099266 CTGGATGCGTGGGTTGAGGGTGG + Intergenic
1146849097 17:36206430-36206452 CTGGATGCGTGGGTTGAGGGTGG + Intronic
1147308505 17:39579774-39579796 CTGCATGCGGCGGGGGAGGAGGG - Intergenic
1147310192 17:39591452-39591474 TTGGCTGCATGGGTGGAGGAAGG + Intergenic
1147835137 17:43324653-43324675 CTGCAGGCATGGTTGCAGGCGGG + Intergenic
1148158936 17:45439148-45439170 GTGTATGCATGGGTTGAGGAGGG - Intronic
1148235965 17:45969392-45969414 ATGCATGATTGGGTGGAGGGAGG - Intronic
1148463783 17:47852334-47852356 AAGAATGCGTGGGTGGAGGACGG - Intronic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148916058 17:50979853-50979875 CAGCTTGCGTGGGTGGGGGATGG - Exonic
1150145098 17:62762191-62762213 TTTAATGAATGGGTGGAGGAAGG - Intronic
1150390290 17:64786237-64786259 GTGTATGCATGGGTTGAGGAGGG - Intergenic
1150443643 17:65211455-65211477 CTTCATTCATGGGAAGAGGATGG + Intronic
1151175022 17:72281030-72281052 GTGCATGCATAGGTGGAGGTGGG - Intergenic
1151384335 17:73746001-73746023 CTGCATGAAAGGGAAGAGGAAGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152307806 17:79531334-79531356 CTGCCTGCGTGTGCGGAGGAGGG + Intergenic
1152312524 17:79559695-79559717 GTGGATGGATGGGTGGATGATGG + Intergenic
1152566326 17:81102002-81102024 CTGCCTGCAGGGATGGAGGGCGG + Intronic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1152996432 18:410898-410920 TTGCTGGCATGGGTGGAGGTGGG - Intronic
1153661383 18:7329229-7329251 CTAGCTGCCTGGGTGGAGGAAGG - Intergenic
1154251865 18:12751349-12751371 CAACATGCATGGGTGAAGCATGG + Intergenic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1156482691 18:37446063-37446085 CCGCAAGCATGAGGGGAGGATGG - Intronic
1156495325 18:37521794-37521816 CTGCCTGCATGGCAGGATGAAGG - Intronic
1157177590 18:45465569-45465591 ATGCATGGATGGATGGATGAAGG - Intronic
1157687379 18:49653100-49653122 CTGGATGCAGGGGAGGTGGAAGG - Intergenic
1157732091 18:50012834-50012856 GTCCTTGCATGGGAGGAGGAAGG - Intronic
1158855840 18:61542760-61542782 CTGCTTCCATGCATGGAGGAAGG + Intronic
1159118239 18:64139731-64139753 CAGGATGGATGGGTGCAGGATGG + Intergenic
1159369629 18:67514275-67514297 CAGCATGCTTTGGTGGAGGTAGG + Exonic
1160767804 19:816190-816212 TTGGGTGCATGGGTGGAGAATGG - Intronic
1160767822 19:816274-816296 ATGGCTGCATGGGTGGATGATGG - Intronic
1160767858 19:816407-816429 GTGGGTGCATGGGTGGAGAATGG - Intronic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160767947 19:816777-816799 TTGGGTGCATGGGTGGAGAATGG - Intronic
1160767963 19:816861-816883 ATGGCTGCATGGGTGGATGATGG - Intronic
1160935880 19:1594364-1594386 CAGGATGGATGGGTGGATGATGG + Intergenic
1161285645 19:3467065-3467087 CGTCATCCCTGGGTGGAGGAGGG + Intronic
1161347844 19:3776970-3776992 GTGGATGGATGGGTGGATGATGG + Intergenic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1162514817 19:11141673-11141695 CTGAATGCCAGGCTGGAGGAGGG + Intronic
1162797779 19:13095550-13095572 CTGCATGCAGGGCTGGGGGCGGG - Exonic
1162935184 19:13978553-13978575 CTGCAGACAAGGGTGGGGGATGG - Intronic
1163238425 19:16043381-16043403 ATGGATGAATGGGTGGAGGATGG + Intergenic
1163383654 19:16985734-16985756 GTGGATGGATGGGTGGAGGGAGG + Intronic
1163609858 19:18295211-18295233 GTGGATGGATGGGTGGATGATGG - Intergenic
1166053433 19:40274710-40274732 CTGCAGGCAGGGGAGGAGCAGGG + Intronic
1166220798 19:41363349-41363371 CTGCGTTAAGGGGTGGAGGAAGG + Intronic
1166739036 19:45103145-45103167 CTGGATGAATTGGTGGTGGATGG + Intronic
1166770084 19:45276489-45276511 CAGCAGGCATGGCTGGGGGAGGG + Intronic
1166815487 19:45542254-45542276 CTGAATGACTGTGTGGAGGAGGG + Intronic
1166935600 19:46330604-46330626 ATGGATGCATGGATGGTGGATGG + Intronic
1166935656 19:46330856-46330878 ATGGATGGATGGGTGGTGGATGG + Intronic
1167233740 19:48301363-48301385 ATGGATGGATGGGTGGATGATGG + Intronic
1167523993 19:49972494-49972516 CTGCATCCAGGGATGTAGGAAGG + Intergenic
1168266811 19:55227870-55227892 CTGTATGCCTGTGTGGAGGAAGG - Intronic
1168414318 19:56159078-56159100 ATGAATGCATGGGTGGATGATGG - Intronic
1168414337 19:56159174-56159196 ATGAATGCATGGGTGGATGATGG - Intronic
925254621 2:2472550-2472572 CTTTAGGCATGGGTGGAAGATGG - Intergenic
925913332 2:8587380-8587402 CTGCAGGCCTGGGAGGAGGGAGG - Intergenic
928239314 2:29572795-29572817 CTGAAGGAATGGGTGGATGAGGG - Intronic
928603466 2:32923368-32923390 AACCATGCATGGGAGGAGGAAGG + Intergenic
931916262 2:66960310-66960332 CTGCCTGCATTGGTGGTGGAAGG - Intergenic
932340470 2:70960095-70960117 CAGCAGGCATGGCTGGGGGAGGG + Intronic
932455060 2:71844249-71844271 AGGGATGCAGGGGTGGAGGAAGG - Intergenic
932463159 2:71896400-71896422 ATGGATGGATGGTTGGAGGAGGG + Intergenic
932570800 2:72937386-72937408 CTGCAGGCAAGGGGAGAGGAGGG + Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
936308717 2:111366387-111366409 CTGCAGGCATAGGCGGAGGGAGG + Intergenic
937074044 2:119088125-119088147 ATGGATGCATGGGTGGATGGAGG + Intergenic
937921702 2:127136094-127136116 CTTCATGGATGGATGGATGAGGG + Intergenic
937941516 2:127289825-127289847 CTGCAAGCAGGGGAGGAAGAAGG + Intronic
938711825 2:133981730-133981752 CGGCATGCAGAGGTGGAGGCCGG - Intergenic
939057804 2:137384472-137384494 CTGCCAGCATGGGTGAAGGAAGG + Intronic
939132669 2:138256380-138256402 ATGGATGGATGGGTGGATGATGG + Intergenic
939480598 2:142742839-142742861 GTGCATGCATTGGGGGTGGAGGG - Intergenic
941563384 2:167077551-167077573 CTGCAGAGATGGGTGGAAGATGG + Intronic
943582101 2:189696704-189696726 ATGCATGGATGGGTGAAGGCAGG + Intronic
945103171 2:206282371-206282393 CTGCATGGATGTGGGGAGGTGGG + Intronic
945910723 2:215646154-215646176 CTGCCTGGAAGGGTGGAGGGGGG + Intergenic
946211405 2:218150196-218150218 ATGCAGGAAAGGGTGGAGGAAGG - Intergenic
947758684 2:232587873-232587895 CTGACTGAAAGGGTGGAGGATGG - Intergenic
948383667 2:237568315-237568337 TTACATGGCTGGGTGGAGGATGG - Intergenic
948673324 2:239582591-239582613 CTGCTTGAATGGGGGGCGGAGGG - Intronic
949065828 2:241989902-241989924 ATGGATGCATGGATGGTGGATGG - Intergenic
949065870 2:241990081-241990103 ATGGATGGATGGGTGGATGATGG - Intergenic
949065879 2:241990122-241990144 ATGGATGCATGGATGGTGGATGG - Intergenic
949065883 2:241990141-241990163 ATGGATGCATGGATGGTGGATGG - Intergenic
949065894 2:241990186-241990208 ATGGATGCATGGATGGTGGATGG - Intergenic
949065898 2:241990205-241990227 ATGGATGCATGGATGGTGGATGG - Intergenic
949065906 2:241990238-241990260 ATGGATGCATGGATGGTGGATGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169890104 20:10443549-10443571 CGGCATGCATGGGTGAAGGCAGG + Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1172124248 20:32615912-32615934 CTGCATGAATGGGAGGGTGAAGG + Intergenic
1173054587 20:39598790-39598812 CTGCACTCCTGGCTGGAGGATGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1174271328 20:49371514-49371536 CTGCATCGATGGCTGCAGGAAGG + Exonic
1174387867 20:50197883-50197905 CCTCATGCAGGGGTGGAGTAGGG + Intergenic
1174387922 20:50198027-50198049 CCTCATGCATGGGTGGAGTGGGG + Intergenic
1174387959 20:50198127-50198149 CCGCATGCAGGGGTGGAGTGGGG + Intergenic
1174427061 20:50439308-50439330 CTGCAGGCCTGGGCAGAGGAAGG - Intergenic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1175305296 20:57971766-57971788 AAGAATGGATGGGTGGAGGATGG + Intergenic
1175342386 20:58241899-58241921 GTGCATTCATGGGTTGAGCATGG - Intergenic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779237 20:61671831-61671853 ATGGATGCATGGGTGGAAGGTGG + Intronic
1175817400 20:61890490-61890512 ATGGATGCATGGGTGGATGATGG + Intronic
1175986472 20:62766368-62766390 CTGAATGGGTGGGTGGGGGAGGG - Intergenic
1176062176 20:63177259-63177281 CTGCGCGCGTGGGTGCAGGAGGG + Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1178280877 21:31281756-31281778 ATGGATGGATGGGTGGTGGATGG + Intronic
1178699410 21:34820359-34820381 CACCATGCCTGGCTGGAGGAGGG - Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1180090037 21:45529221-45529243 CTGCCTGCATGTGGGGAGGATGG + Intronic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181040034 22:20187778-20187800 CTGCATGGCTGGGTGGAGCCAGG + Intergenic
1181804101 22:25364828-25364850 CTGCATGCGTGCAAGGAGGAAGG - Intronic
1182031673 22:27163848-27163870 CAGCATGGATGGGTGGAGTGCGG - Intergenic
1183000842 22:34857363-34857385 CCACATACATGAGTGGAGGAGGG - Intergenic
1183100052 22:35578396-35578418 CTGGATGGATGGATGGTGGATGG + Intergenic
1183106455 22:35618581-35618603 TTGGATGGATGGGTGGTGGATGG - Intronic
1183266752 22:36831993-36832015 GTGCATGGATGGATGGATGACGG + Intergenic
1183303990 22:37072273-37072295 TTGCATGGATGGATGGATGATGG + Intronic
1183304009 22:37072368-37072390 GTGCATGGATGGATGGATGATGG + Intronic
1183741229 22:39669684-39669706 ATGGATGGATGGGTGGTGGATGG + Intronic
1184108547 22:42382505-42382527 CACTATGAATGGGTGGAGGAGGG - Exonic
1184281330 22:43439202-43439224 CTGCGTTCATGGGAGGGGGACGG + Intronic
1184996757 22:48212821-48212843 ATGAATGGATGGGTGGATGATGG - Intergenic
1184996768 22:48212928-48212950 ATGAATGGATGGGTGGATGATGG - Intergenic
1185103657 22:48855167-48855189 GTGAATGCATGGATGGATGATGG - Intergenic
1185196900 22:49477235-49477257 ATGGATGGATGGGTGGTGGATGG + Intronic
1185212940 22:49582035-49582057 ATGGATGGGTGGGTGGAGGATGG - Intronic
949761764 3:7478807-7478829 CTGCATGCCTGGGGGGAGATGGG - Intronic
949845201 3:8362643-8362665 CTAGATGGATGGATGGAGGATGG + Intergenic
949923102 3:9019728-9019750 CTGCAAGCCTTGGTGCAGGAAGG - Intronic
950102573 3:10367045-10367067 CCCCAGGCACGGGTGGAGGAGGG - Intronic
950144882 3:10641906-10641928 ATGGATGGATGGGTGGATGATGG - Intronic
950201486 3:11047791-11047813 ATGCATGCATGCGTGCATGAAGG + Intergenic
950443733 3:13024314-13024336 ATGGATGGATGGGTGGATGAGGG - Intronic
951217380 3:20038427-20038449 CTCCATGCATGGGTAAAGGGTGG - Intergenic
951732306 3:25823802-25823824 CAGGAAGCAGGGGTGGAGGATGG + Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
953434522 3:42868002-42868024 TAAAATGCATGGGTGGAGGAGGG + Intronic
953619620 3:44521874-44521896 GTGCAAGCATGCATGGAGGAAGG - Intergenic
953827907 3:46270207-46270229 CTGGATGCATAGGTAGAGGAGGG - Intergenic
953875668 3:46665436-46665458 CTCCATGCAGGGATGGAGGTGGG - Intergenic
954296786 3:49678806-49678828 CTGCATCCAGGAGTGGAGGTAGG - Intronic
954369434 3:50162513-50162535 AGGCATGGATGGGTGAAGGAAGG - Intronic
954500983 3:51013886-51013908 CAGCAAGCATGGCTGGGGGAGGG - Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
956028972 3:65015775-65015797 ATGGGTGCATGGGTGAAGGAAGG + Intergenic
956188429 3:66584462-66584484 GTGCCTGCATTGGTGGAGGGTGG - Intergenic
956391118 3:68773517-68773539 GTGTCTGCATGGGTAGAGGAGGG - Intronic
959467987 3:106713754-106713776 CTGCACCCATGGGTGCATGAAGG + Intergenic
959940399 3:112075305-112075327 CTGCAGGCTTTGGTGGAGAAAGG - Exonic
960246737 3:115408015-115408037 CTATATGCATTGGTGGAGAAAGG + Intergenic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
961629705 3:128287310-128287332 GTGCAGCCATGGGGGGAGGAAGG + Intronic
962744910 3:138389931-138389953 CTGGAAGCCTGGGTGGAAGAGGG + Intronic
964697256 3:159523680-159523702 GTGAATGGATGGGTGGATGACGG - Intronic
965313691 3:167163834-167163856 GAACATGCATGGGTGGAGGTGGG - Intergenic
966566216 3:181384304-181384326 CTGGATGCTGGGGTGGAGTAAGG - Intergenic
966567465 3:181398862-181398884 ATGGATGAATGGGTGGATGATGG + Intergenic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
968935816 4:3609864-3609886 ATGTATGCATGGATGGATGATGG - Intergenic
968938761 4:3627114-3627136 TTGGATGGATGGGTGGATGATGG + Intergenic
969370618 4:6728970-6728992 TTGCATGAATGAGTGGAGGACGG - Intergenic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969571591 4:8012114-8012136 ATGGATGGATGGGTGAAGGATGG - Intronic
969571634 4:8012300-8012322 ATGGATGGATGGGTGAAGGATGG - Intronic
969612333 4:8234413-8234435 ATGGATGGATGGGTGGAGGGTGG - Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
969709030 4:8832096-8832118 ATGCAGGCCTGGGTGCAGGAGGG - Intergenic
971128084 4:23776080-23776102 ATGAATGCATGAGTGAAGGAAGG - Intronic
971214593 4:24651401-24651423 TTGTATGCATTGGTGGAGGTGGG + Intergenic
971293298 4:25365296-25365318 CTGCATAGATGGATGGAGGGAGG + Intronic
971311590 4:25530011-25530033 TTGCATGCAGGTTTGGAGGAAGG + Intergenic
971425030 4:26507567-26507589 ATGGATGCATGGGAGAAGGATGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
973608760 4:52613264-52613286 TTCCATGCATGGGTGGATCAGGG - Intronic
973844959 4:54902192-54902214 CTTCATGGATGGGTTCAGGAAGG + Intergenic
975664142 4:76717620-76717642 CAGCATGCATGTGTGGGGCAGGG + Intronic
976568732 4:86584051-86584073 GTGCATGCATGGGTGTATGTAGG + Intronic
978681595 4:111387860-111387882 CTGGATTGATGGGTGGATGATGG - Intergenic
983256023 4:165401677-165401699 CTGCCTTCCTGAGTGGAGGAGGG + Intronic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984698431 4:182801819-182801841 GTGCATGCATGTGTGCAGGAGGG - Exonic
984699092 4:182807155-182807177 CCGCAGGCTTGGGTAGAGGAGGG - Intergenic
985373899 4:189314189-189314211 CAGAATGCAAGGGTGAAGGAAGG - Intergenic
985937505 5:3108092-3108114 GTGCATGCATGGTTTGGGGATGG + Intergenic
986518090 5:8584084-8584106 CAGCATGAATGTGTGGAGGTTGG + Intergenic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
986955873 5:13148716-13148738 ATGGCAGCATGGGTGGAGGAGGG + Intergenic
987152824 5:15059099-15059121 GTGGCAGCATGGGTGGAGGAGGG - Intergenic
990134640 5:52630841-52630863 ATGCATGCAATGGTTGAGGAGGG + Intergenic
995435482 5:112130105-112130127 CTCCATGCATGGGTGGAAAATGG - Intergenic
996851502 5:127958024-127958046 ATGCATACATGGGTGGGGGGAGG + Intergenic
997058350 5:130471209-130471231 CTATATGCATGTGTGGAGGTAGG - Intergenic
997338441 5:133123904-133123926 CTGCATGTATGGGTGGGGACAGG + Intergenic
997439208 5:133897404-133897426 ATGGATGCATGGGTGGATGCAGG + Intergenic
998217671 5:140249686-140249708 CTGCTTGCATTCGTGGTGGAAGG + Intronic
999426376 5:151490833-151490855 CTGCTTGCATAAGAGGAGGAAGG - Exonic
1001058997 5:168472186-168472208 CTCCATCCATGGCTGGAAGAGGG - Intronic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1002022794 5:176375332-176375354 ATGGATGGATGGGTGGATGATGG - Exonic
1003016255 6:2469821-2469843 CTGCATGGATCAGTGCAGGATGG - Intergenic
1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG + Intronic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1006974468 6:38085728-38085750 CTGCATGTATGGGCTGAGCACGG - Intronic
1007252887 6:40508383-40508405 CTGCATTCATGAGCAGAGGAAGG - Intronic
1008187492 6:48412023-48412045 GTGCCTGCAGGGGTGGAGAAGGG + Intergenic
1008591140 6:52994973-52994995 CTGAATGCATTGGTGGAAGGTGG - Intronic
1011335135 6:86251820-86251842 ATGGATGGATGGGTGGATGATGG + Intergenic
1011751287 6:90457652-90457674 CTCCATTCATGGCAGGAGGAAGG + Intergenic
1012930569 6:105311768-105311790 CAGCATTGATGGGTGGAGGTGGG - Intronic
1016472333 6:144387894-144387916 CTGTCTGCTTTGGTGGAGGATGG - Intronic
1017027985 6:150197909-150197931 CTGCCTGCCACGGTGGAGGAGGG + Intronic
1017028091 6:150198245-150198267 CTGCCTGCCACGGTGGAGGAGGG + Intronic
1017340545 6:153316795-153316817 GTGCATGCATGGGGTGGGGAGGG - Intergenic
1018323506 6:162638492-162638514 ATGCATGGATGGGAGGCGGAAGG - Intronic
1018734200 6:166675252-166675274 CTTCATGCCTGGGAGGAGGCCGG + Intronic
1018853087 6:167655172-167655194 ATGAATGCCTGGGTGGATGATGG + Intergenic
1019103366 6:169649903-169649925 CTGCATGGGTGGCTGGATGAAGG - Intronic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1020791397 7:12632470-12632492 CAGAATGGATTGGTGGAGGAAGG + Intronic
1021054413 7:16029097-16029119 CTTCATGCATTGGTTGATGAGGG + Intergenic
1021447029 7:20744608-20744630 CTACATCCATGGGGGGAGGGGGG + Intronic
1021618035 7:22522494-22522516 CAGCCTGGTTGGGTGGAGGATGG - Intronic
1022514622 7:30967566-30967588 CTGCATGGATGGGTGCATGGTGG - Intronic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1022694446 7:32690463-32690485 CAGCCTGGTTGGGTGGAGGATGG - Intergenic
1023122642 7:36925157-36925179 GTGCATGCAAGGGTGGATGCAGG - Intronic
1023842925 7:44106925-44106947 CTGCCTGCTCGGGTGGAGGCAGG + Intronic
1024392931 7:48835945-48835967 TTGCATGCATGAGTGGATGGTGG + Intergenic
1025032050 7:55565735-55565757 CTGGCTGCAGGGGTGGAGGTGGG + Intronic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026669120 7:72371852-72371874 CTGCATTCATGGGGAGAGCAAGG - Intronic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1027347998 7:77281700-77281722 ATGCATGCATGTTTTGAGGAAGG + Intronic
1028374640 7:90133612-90133634 CAGCCTGGTTGGGTGGAGGATGG + Intergenic
1029164398 7:98576882-98576904 TTGCATGCATGCCTGGATGAGGG - Intergenic
1029298244 7:99558610-99558632 CCTCATGCCTGGGCGGAGGAGGG + Intronic
1030562274 7:111104152-111104174 GTGCATGCATGAATGAAGGAAGG - Intronic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1032519958 7:132536406-132536428 GTGCATGCAGAGGTGGAGGTAGG - Intronic
1032785000 7:135193777-135193799 CTGCCTGGATGCGTAGAGGAGGG - Intronic
1033333962 7:140436660-140436682 TTGCGTGCATGGGTGGGGGTCGG - Intergenic
1035058485 7:156052155-156052177 GTGGATGGATGGGTGGATGAAGG - Intergenic
1035270704 7:157718457-157718479 CTGCAGGGTTGGGAGGAGGAAGG - Intronic
1035278897 7:157765204-157765226 ATGGATGGATGGGTGAAGGATGG - Intronic
1035279081 7:157766012-157766034 TTGGATGGATGGGTGGATGAAGG - Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035288681 7:157823073-157823095 ATGCATGCATGGATGGATGATGG - Intronic
1035360759 7:158312666-158312688 GTGCATGCATGTGTGCAGGCAGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1037877325 8:22554490-22554512 CTGCATGCTTGGGTCAAGGTGGG - Exonic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1039899527 8:41741263-41741285 GTGCAGGCAGGGGTGGAGGGAGG - Intronic
1039930569 8:41984345-41984367 CTGCATGCATGCCTGCAGCATGG - Intronic
1041786504 8:61639927-61639949 CTTCATGCATGGGTGTAGCTGGG - Intronic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1047189032 8:122661338-122661360 TTGCAGGCAGGGTTGGAGGATGG - Intergenic
1047306808 8:123659225-123659247 ATGGATGGATTGGTGGAGGATGG - Intergenic
1047306826 8:123659317-123659339 ATGGATGGATGGGTGGAAGATGG - Intergenic
1048176773 8:132159846-132159868 ATGGATGAATGGGTGGATGATGG - Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048507043 8:135031138-135031160 ATGCGTGGATGGGTGGGGGAGGG + Intergenic
1049252368 8:141596207-141596229 CAGCGTGCCTGGGTGGAGCAGGG - Intergenic
1049350670 8:142162846-142162868 GAGGATGGATGGGTGGAGGAGGG + Intergenic
1050027957 9:1355199-1355221 CTCCATGCCTGGGTGGGGGTGGG + Intergenic
1050532323 9:6601275-6601297 CTCCAGGAATGGGTTGAGGAAGG - Intronic
1052472488 9:28917380-28917402 CTGAATGGATGGGTGGAAAATGG - Intergenic
1052964802 9:34331840-34331862 TTGAGTGCCTGGGTGGAGGAGGG - Intronic
1054451982 9:65408221-65408243 TTGGATGGATGGGTGGATGATGG - Intergenic
1054454329 9:65421802-65421824 GTGGATGGATGGGTGGATGATGG + Intergenic
1054454367 9:65422002-65422024 ATGTATGCATGGATGGATGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057008718 9:91583285-91583307 ATGGATGGGTGGGTGGAGGATGG + Intronic
1057008725 9:91583316-91583338 GTGGATGAGTGGGTGGAGGATGG + Intronic
1057008734 9:91583347-91583369 ATGGGTGGATGGGTGGAGGATGG + Intronic
1057026054 9:91734418-91734440 CTGCATTCGTGGGTGGAGTTAGG - Intronic
1057181130 9:93031073-93031095 ATGGATGGATGGGTGGATGAAGG + Intronic
1057220369 9:93254461-93254483 CCGCATGCAAGGGTGCAGCAGGG - Intronic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1058621160 9:106884559-106884581 CTGCCTCCATGGTGGGAGGAAGG - Intronic
1059466634 9:114472880-114472902 CCGCATCCATGATTGGAGGATGG - Intronic
1059923544 9:119184572-119184594 GTGCATGCATGTGTGGAGTGGGG - Intronic
1060543920 9:124449759-124449781 CTCCATGCAAGTGTGGAGTAGGG - Intergenic
1061417525 9:130455192-130455214 ATGGATGCATGGGTAGATGATGG - Intronic
1061765603 9:132879076-132879098 CTGGAAGCTGGGGTGGAGGATGG + Intronic
1061980952 9:134103380-134103402 CTGGATGGATGGATGGTGGATGG - Intergenic
1062092448 9:134685526-134685548 CTGGATGGATGGATGGTGGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062217059 9:135394893-135394915 GTGGATGGATGGGTGGTGGATGG + Intergenic
1062217119 9:135395196-135395218 ATGCATGGATGGGTGGTGGATGG + Intergenic
1062274546 9:135724499-135724521 ATGCCTGCATACGTGGAGGAAGG - Intronic
1062572992 9:137194124-137194146 CTGCATGGATGAGCGGGGGAGGG + Intronic
1062745275 9:138208018-138208040 CTGAGTGCATGGGTCCAGGAAGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185616321 X:1424213-1424235 GTGCATGGCTGGGTGGATGATGG - Intronic
1185644898 X:1609563-1609585 CTGGAGGCTTGGGTGGAGTAGGG - Intergenic
1185644969 X:1609806-1609828 CTGGAGGCTTGGGTGGAGTAGGG - Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1187880388 X:23841706-23841728 GTGCATGCATGTGAGGAGGCAGG - Intronic
1188771786 X:34162517-34162539 CTGCCTGCATGTCTGGAGGTAGG + Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1194057351 X:89151856-89151878 TGGCATGCATTGGTGGGGGAAGG + Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196405699 X:115360331-115360353 CTGAGTGCATGGGTAGAGGTGGG - Intergenic
1197078288 X:122378981-122379003 CTCCATGCATGGGTGCTGGTTGG + Intergenic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1200036273 X:153333961-153333983 CTGGACGCTTGGGTGGAGGTGGG - Intergenic
1201237322 Y:11923694-11923716 CTGCATGCTTGTGTGGCTGAAGG - Intergenic