ID: 1113830775

View in Genome Browser
Species Human (GRCh38)
Location 13:113293984-113294006
Sequence CCCATTACTGATCTTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113830769_1113830775 0 Left 1113830769 13:113293961-113293983 CCAGAGACCAGACTTCCCCGCTT 0: 1
1: 0
2: 2
3: 16
4: 106
Right 1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 156
1113830770_1113830775 -7 Left 1113830770 13:113293968-113293990 CCAGACTTCCCCGCTTCCCATTA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113830775 Original CRISPR CCCATTACTGATCTTTGCTG TGG Intergenic
901955916 1:12785505-12785527 CCCATTAAGGGTCTGTGCTGAGG - Intergenic
904723072 1:32525297-32525319 TACATTAGTCATCTTTGCTGAGG + Intronic
907873865 1:58466797-58466819 CCCATAACTGGTCTGTGCAGGGG + Intronic
910158375 1:84246204-84246226 TCCAGTACTGATTTTTGCTAAGG + Intergenic
911401484 1:97380211-97380233 CCTATTACTCATCTTTGTTTTGG + Intronic
915444759 1:155968295-155968317 CCCATCACTGGTCCTTTCTGGGG + Intronic
916078495 1:161217601-161217623 CCCACTACCCATCTTGGCTGAGG + Intronic
921936022 1:220797894-220797916 CCCATTCTTGATCCTTTCTGAGG + Exonic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1073347391 10:102794197-102794219 CACACCACTGTTCTTTGCTGTGG + Intronic
1074863667 10:117532442-117532464 CTCATTTCTGATCTTTTCTTTGG + Intergenic
1076344500 10:129771229-129771251 CCCATTACAGATCCTTGTCGGGG - Intergenic
1076932440 10:133541587-133541609 CCCATAAATGGTCTGTGCTGAGG - Intronic
1078054579 11:7997116-7997138 CCCATAACTTATATTTCCTGAGG - Exonic
1078359676 11:10658596-10658618 CTCAGTCCTGGTCTTTGCTGTGG + Intronic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1080201622 11:29678096-29678118 CCCATTACTACACTTTGCTTTGG + Intergenic
1082267178 11:50131698-50131720 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1082288911 11:50346870-50346892 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1083138180 11:60699721-60699743 CCTATTCCTTTTCTTTGCTGTGG - Exonic
1084493367 11:69490030-69490052 CCCCTTTCTGACCTATGCTGTGG - Intergenic
1085281632 11:75334788-75334810 CCTATGACAGATCTCTGCTGTGG + Intronic
1086523242 11:87696520-87696542 CTCATTAAGGATCTTTGCTGGGG + Intergenic
1086742432 11:90384173-90384195 CCCTTCACTGAGGTTTGCTGAGG - Intergenic
1086994881 11:93344973-93344995 CCCATTAGTTATTTTTCCTGAGG + Intronic
1089580733 11:119480669-119480691 CCCAGTACTGTCTTTTGCTGAGG - Intergenic
1090466497 11:126939339-126939361 CCAATTACTTGTCTTTGATGGGG - Intronic
1091825601 12:3510265-3510287 CCCTTTACTCATGTGTGCTGTGG + Intronic
1092645907 12:10571799-10571821 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1093928051 12:24928264-24928286 CCCTTCACTGATCTTTGTTATGG + Intronic
1094476059 12:30841690-30841712 CCCATTACTATTCTGTGCTCTGG + Intergenic
1097258620 12:57699732-57699754 ATCATTGGTGATCTTTGCTGGGG + Intronic
1097316283 12:58174179-58174201 ACCATTACTGATGTATGGTGAGG - Intergenic
1102944256 12:116971755-116971777 CCCATTACTCAACTGTGCTGTGG + Intronic
1104762274 12:131304614-131304636 CCCATAACTGATTGTTGCTCAGG + Intergenic
1104817502 12:131656182-131656204 CCCATAACTGATTGTTGCTCAGG - Intergenic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1105879531 13:24591977-24591999 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1105920306 13:24957077-24957099 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1108813892 13:54267329-54267351 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1109490143 13:63087147-63087169 CCCATTACTGATCTTTAAGGAGG + Intergenic
1110532349 13:76612038-76612060 CCAATTCCTGAGCTTTTCTGTGG - Intergenic
1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG + Intergenic
1117110848 14:52452812-52452834 CCCATTTGTCATTTTTGCTGTGG - Intronic
1118608824 14:67523790-67523812 CCCACGTCTGTTCTTTGCTGAGG - Intronic
1120857084 14:89222157-89222179 CCCATCACTGGCCATTGCTGTGG + Intronic
1121282677 14:92710673-92710695 GCCATTTCTGATCTTGGTTGAGG - Intronic
1121685975 14:95835477-95835499 CACATGACTGCTCTTTGCAGAGG - Intergenic
1123390487 15:19866531-19866553 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1124453490 15:29820688-29820710 CCCATTATTTGTCTTTTCTGGGG - Intronic
1125467442 15:39968188-39968210 CCAAATACTGACCTTTGCTCTGG + Intronic
1126285094 15:47001196-47001218 CACATTAATGATTTTTCCTGGGG - Intergenic
1126969932 15:54099354-54099376 CGTATTACTGAACTTTGCTTGGG + Intronic
1129303730 15:74642925-74642947 CTCCTCACTGATCTTTGTTGGGG + Intronic
1129418162 15:75400697-75400719 CCCAGGGCTGATCTTTGCTAGGG + Intronic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1137609403 16:49808931-49808953 CCCATTGCTGAACCTTTCTGAGG - Intronic
1142375953 16:89707252-89707274 CCCCTTACTCACCTTGGCTGTGG - Exonic
1142895550 17:2975538-2975560 CCCACTCCTGATGTTTCCTGTGG + Intronic
1144309285 17:13997790-13997812 CACATTACTGAGCTTCTCTGGGG - Intergenic
1148861815 17:50608439-50608461 TCCATTACTGAGATCTGCTGAGG - Intronic
1148867769 17:50637880-50637902 CCCATTTCAGCTGTTTGCTGGGG + Intronic
1153209980 18:2751383-2751405 CCCATGACTCACATTTGCTGGGG - Exonic
1155547167 18:26927803-26927825 CCCATAAATGGTCTGTGCTGAGG - Intronic
1156649434 18:39207124-39207146 CTCATTACTGTTCTTTGAAGTGG - Intergenic
1156985174 18:43342260-43342282 CCCATTCCTGATCCTTTCTCTGG + Intergenic
1158117867 18:54016586-54016608 CCCATTACTTTTCCTTGATGAGG + Intergenic
1160611654 18:80092873-80092895 TTCATTACTGATGTTTGCAGTGG - Intronic
1163196256 19:15723266-15723288 CCCATCCCTGAGCTTTCCTGAGG + Intergenic
1167884061 19:52485951-52485973 CCCATAAATGGTCTGTGCTGTGG + Intronic
926808393 2:16734414-16734436 CCCATTACTCATTTTTCCTGTGG + Intergenic
927482026 2:23461702-23461724 CCCCTTCTTTATCTTTGCTGGGG + Intronic
927613950 2:24570596-24570618 GCCATTCATGATCTTTGCTTAGG - Intronic
928935933 2:36678034-36678056 CCCAGGACTGAGCTCTGCTGGGG + Intergenic
929247672 2:39720421-39720443 CCCACTCCAGATCTTTGCTCAGG + Intergenic
929473657 2:42222515-42222537 CCAATTACTGGACTCTGCTGTGG - Intronic
930450958 2:51537330-51537352 CTTATTACTGAATTTTGCTGAGG + Intergenic
933193254 2:79360817-79360839 CATTTTACTGATCTTAGCTGTGG - Intronic
933905961 2:86892747-86892769 CTCATTACACAGCTTTGCTGGGG - Intergenic
938734567 2:134174758-134174780 CCAATGCCTGATCTTGGCTGGGG + Intronic
940327361 2:152439722-152439744 CCCCATACTGATCCTAGCTGGGG + Intronic
941194543 2:162432694-162432716 CCCATTCATGATATTGGCTGTGG - Intronic
942334726 2:174871008-174871030 TCAATTACTGATCTTTTCTGTGG + Intronic
943676264 2:190718973-190718995 CCCATGACTGACCTCTTCTGAGG - Intergenic
943725029 2:191244701-191244723 CCCATCACTGATCATTACTCAGG + Intergenic
944125384 2:196287123-196287145 ACCATAACTGCTATTTGCTGTGG + Intronic
945039961 2:205735405-205735427 CGCATTACTGATGGTTTCTGAGG - Intronic
948300018 2:236898382-236898404 CACATCTCTGATCTTAGCTGAGG - Intergenic
1171183609 20:23109472-23109494 CCCTTTACTGAACTTTAGTGTGG + Intergenic
1172487588 20:35307672-35307694 ACCATCACTGATCTTGGCAGAGG - Intronic
1175950331 20:62580273-62580295 CCCATGAGTGAGGTTTGCTGGGG + Intergenic
1176766501 21:13024156-13024178 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1177199069 21:17933251-17933273 CCCATAAATGGTCTGTGCTGAGG - Intronic
1178902430 21:36607949-36607971 CCCTTTACTGTCATTTGCTGTGG - Intergenic
1180513627 22:16118604-16118626 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1181331712 22:22098020-22098042 TCCATCACTGAGCTCTGCTGGGG - Intergenic
1182188523 22:28433833-28433855 CCCTTTTCTGATTTTTGCTTTGG - Intronic
950233691 3:11299088-11299110 CCCATTACTTAGCATTGCTGTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951440152 3:22713351-22713373 TTCATTACTGATATTTGCTGTGG - Intergenic
953541280 3:43820877-43820899 CCCATTGCTGATCCATGATGTGG + Intergenic
956991886 3:74776208-74776230 CACATTACTGATGGTTGCTAAGG + Intergenic
957196582 3:77076024-77076046 AAAATTACTGTTCTTTGCTGAGG + Intronic
959469251 3:106729161-106729183 GCCATTATTGAGCTTTGCTTTGG + Intergenic
962748029 3:138412002-138412024 ACCATTCCTGAGTTTTGCTGGGG + Intergenic
967275938 3:187774578-187774600 CACCTTACTGGTATTTGCTGTGG - Intergenic
968375879 4:41069-41091 CCCATAAATGGTCTGTGCTGAGG - Intergenic
970714360 4:18904530-18904552 CCCATTAGTGTTCATTGGTGTGG + Intergenic
973196089 4:47443550-47443572 CCCATTACTGAGCACTGCTCTGG + Intergenic
974142744 4:57908598-57908620 ACCATTACTGATCCTTGCCCAGG + Intergenic
975206580 4:71650727-71650749 CCCATTGCTGATGTTAACTGGGG + Intergenic
975519688 4:75287158-75287180 CCCATGAATGGTCTGTGCTGAGG - Intergenic
977404131 4:96574790-96574812 CCCATGAGTGTTCTTTGCAGAGG - Intergenic
980165299 4:129219113-129219135 CTCATTACTCATGTCTGCTGGGG - Intergenic
981725292 4:147841076-147841098 CCAACTACTCATCTCTGCTGTGG - Intronic
983983630 4:174030423-174030445 ACGATTAATTATCTTTGCTGTGG + Intergenic
984461926 4:180047958-180047980 GCCAATACTGATCTTCCCTGTGG + Intergenic
987556136 5:19452935-19452957 CTCTTTACTGATTTTTGATGTGG + Intergenic
989956412 5:50366119-50366141 CCCATTCATGTTCTTTCCTGAGG - Intergenic
991408677 5:66325855-66325877 GCCAAGACTGAACTTTGCTGAGG + Intergenic
992847967 5:80773323-80773345 CCCATTAGTGATATTTTTTGTGG + Intronic
1001448513 5:171806335-171806357 ACCATTACTGATGATTGGTGAGG - Intergenic
1003335546 6:5168628-5168650 CCCTTTACTGATCCTGGATGGGG + Intronic
1007175813 6:39896713-39896735 CCCTTTTCTGAACTTTGCGGTGG + Intronic
1007712562 6:43833934-43833956 CTCATTAGTGATGTCTGCTGGGG - Intergenic
1007989073 6:46236203-46236225 CCCCTTACTGCTCTTTGCAATGG - Intronic
1008238855 6:49084204-49084226 CCCATTACAGGTCCTAGCTGTGG + Intergenic
1008835797 6:55827183-55827205 CCTTTTACTGAGATTTGCTGTGG - Intronic
1013131581 6:107238250-107238272 CCCACTCCTGATCCTTCCTGGGG - Intronic
1016361188 6:143268939-143268961 CCCATAACTGGTCCATGCTGGGG + Intronic
1018387994 6:163322110-163322132 CACATTCCAGATCTCTGCTGCGG + Intergenic
1020778914 7:12493817-12493839 GTCTTAACTGATCTTTGCTGTGG - Intergenic
1022787250 7:33650814-33650836 CCCCTTACTGACCCTTGCTGGGG + Intergenic
1023186694 7:37540025-37540047 ACCATTACATATCTTTGCGGAGG + Intergenic
1024002047 7:45196469-45196491 CTCATAACTGAACTGTGCTGTGG + Intergenic
1027615305 7:80415728-80415750 CCCATGACTGATTTGTGGTGTGG + Intronic
1028104067 7:86856474-86856496 CCCAATAGTTATCTTTTCTGTGG - Intronic
1028733335 7:94178564-94178586 CCCATTGCTGATTTTGGCTCTGG - Intergenic
1029286313 7:99468482-99468504 CCCATCCCTGATCCTTCCTGCGG - Intergenic
1032970440 7:137156859-137156881 CCTATTACTGAGTTTTACTGAGG - Intergenic
1036887115 8:12566425-12566447 CCCATAAAAGATCTGTGCTGAGG + Intergenic
1037430256 8:18804802-18804824 ACCATTACTGAGATTTTCTGGGG + Exonic
1038730059 8:30118952-30118974 CCCATGAATGGTCTGTGCTGAGG - Intronic
1038956018 8:32469639-32469661 CCTTTTACTGATATTTACTGTGG - Intronic
1041815321 8:61964082-61964104 CCAATTCCTGAGCTTTTCTGAGG - Intergenic
1045819965 8:106324845-106324867 ACAATTACTCATCTCTGCTGAGG + Intronic
1047050239 8:121103233-121103255 ACCTTTTCTGATGTTTGCTGAGG - Intergenic
1049629381 8:143644449-143644471 AACATTACTGATCTTCGCAGTGG + Intronic
1056491566 9:87112919-87112941 CCCATGACTGCTCTGTGGTGGGG - Intergenic
1060045637 9:120337959-120337981 CCCATTAGTTATTTTTCCTGAGG + Intergenic
1060247440 9:121958325-121958347 CCCATGACTGAAATTTGCAGAGG - Intronic
1060816117 9:126636141-126636163 CTCCTTTCTGATATTTGCTGAGG + Intronic
1061507922 9:131042358-131042380 ACCATTAGTGATGTCTGCTGTGG - Intronic
1061507933 9:131042436-131042458 TCCATTAGTGATATCTGCTGTGG - Intronic
1061507946 9:131042536-131042558 ACCATTAGTGATGTCTGCTGTGG - Intronic
1061507994 9:131042890-131042912 TCCATTAGTGATGTCTGCTGTGG - Intronic
1061508013 9:131043016-131043038 CCCATTAGTGATGTCTGTTGTGG - Intronic
1061516484 9:131093210-131093232 CCCATTAGAGGGCTTTGCTGGGG + Intronic
1203573349 Un_KI270744v1:153081-153103 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1185566216 X:1097385-1097407 CCCATTTCTGCTTCTTGCTGGGG + Intergenic
1186067627 X:5783198-5783220 CTAATAACTGATCTTTCCTGTGG - Intergenic
1189319363 X:40078392-40078414 CACACAACTGATCTTTCCTGGGG + Intronic
1191732506 X:64352332-64352354 CCCTTTGCTGATTTTTGCTTTGG + Intronic
1193262882 X:79430090-79430112 CTCATTATTGATCTTTTCAGAGG - Intergenic
1195281283 X:103336469-103336491 CCCATTACTGCACTTTTCTGTGG - Intergenic
1201526648 Y:14943565-14943587 CTAATAACTGATCTTTCCTGTGG + Intergenic