ID: 1113833009

View in Genome Browser
Species Human (GRCh38)
Location 13:113311683-113311705
Sequence CTACCCTGCTCAAGATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113833009_1113833012 4 Left 1113833009 13:113311683-113311705 CCCTGTGATCTTGAGCAGGGTAG 0: 1
1: 0
2: 3
3: 15
4: 237
Right 1113833012 13:113311710-113311732 CCTCTCATTTTCTTTGCATGTGG 0: 1
1: 0
2: 0
3: 34
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113833009 Original CRISPR CTACCCTGCTCAAGATCACA GGG (reversed) Intronic
900610308 1:3541886-3541908 CCACCCTTCTCAAGAGCAAAGGG - Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902290046 1:15429460-15429482 CTTCCCTGCCCATGATCCCACGG - Exonic
902671669 1:17978857-17978879 ATTACCTGCTCAAGGTCACATGG - Intergenic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903683253 1:25111771-25111793 CTGCCCTGCTCTAGGCCACAAGG + Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904165049 1:28549019-28549041 CTACCCTACTCCAAATCACCTGG - Intergenic
904236215 1:29119014-29119036 CCACACTGTTCTAGATCACACGG - Exonic
906750842 1:48258251-48258273 CAACCTTGCTCAAACTCACAGGG - Intergenic
906829853 1:49019530-49019552 CTACCCTGATCAAGGTAACCAGG + Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
907803142 1:57791528-57791550 ATAACCTGCCCAAGTTCACACGG - Intronic
909180972 1:72423481-72423503 CTACTTTGCTGAAGATCAGATGG - Intergenic
909505629 1:76386563-76386585 CTACCCTGTCCAAGCTCTCAGGG - Intronic
909720257 1:78759731-78759753 CGACCTTGATCAAGGTCACAAGG - Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913058807 1:115186062-115186084 CTAGACTTCTCAAGCTCACACGG - Intergenic
913498141 1:119447033-119447055 CTCCCCTGCTCAAGACCATTTGG - Intergenic
915054544 1:153114062-153114084 CTCCCCTGCTTATAATCACAGGG - Intergenic
915608155 1:156968043-156968065 CCACCCTGGCCATGATCACAGGG + Exonic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
918275517 1:182950454-182950476 CTTCTCTGCTAAAGATCACAAGG + Intronic
919854804 1:201697974-201697996 ATACCTTGCCCAAGGTCACAGGG + Intronic
921763173 1:218940540-218940562 CTGGCAGGCTCAAGATCACATGG - Intergenic
924175981 1:241391449-241391471 CCACCCAGCCCAAGGTCACACGG + Intergenic
1062788059 10:281693-281715 CTCGTCTGCCCAAGATCACACGG + Intronic
1063964394 10:11335477-11335499 CTAGTCTGCTCAAGAACAGAGGG + Exonic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1068051765 10:51959055-51959077 CTACCTTGCTCAAAATCTTAAGG + Intronic
1069821806 10:71233127-71233149 CAACCTTGCTCAAGGTCACAGGG - Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072806316 10:98425814-98425836 CTACCCTGGTCAGGAGCACCAGG + Exonic
1073292340 10:102419469-102419491 CTACCCTGGCCAAGGGCACAAGG - Intronic
1074228384 10:111509960-111509982 CTCCCTTAATCAAGATCACATGG + Intergenic
1074762060 10:116674659-116674681 CTTCCCTGCTGAAATTCACATGG + Exonic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1076409732 10:130237673-130237695 TTACCTAGCTCAACATCACAAGG + Intergenic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1080700357 11:34639135-34639157 TTAACGTGCTCAAGGTCACATGG + Intronic
1081960620 11:47134003-47134025 CTTCCCTGAGCAAGATCTCAGGG - Intronic
1083925359 11:65802901-65802923 CCATCTTGCTCAAGGTCACACGG + Intergenic
1085880852 11:80464484-80464506 CCACCCTGCTCATCATGACAGGG + Intergenic
1086269392 11:85042483-85042505 TTAATCTGCTTAAGATCACATGG + Intronic
1087910333 11:103745296-103745318 CAACCTTGCTGAAGATCAGATGG + Intergenic
1089529585 11:119117828-119117850 GTTGCCTGCTCAAGATCACTTGG - Exonic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089726752 11:120487636-120487658 CTTCCCTGCTAAAGGGCACAGGG + Exonic
1089788062 11:120922252-120922274 CTAACTTGTTCAAGATCACGTGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1095254028 12:40012607-40012629 CTTACCTGCTAAAGATCACCAGG + Intronic
1101060510 12:100966368-100966390 ATAGCTTGTTCAAGATCACAGGG + Intronic
1101747845 12:107557793-107557815 CTAATTTGCCCAAGATCACAGGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110513371 13:76380257-76380279 CTACCTTATTCAAGGTCACATGG + Intergenic
1111103017 13:83611806-83611828 CTTCCATGCTCAACACCACATGG + Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114613190 14:24055251-24055273 CTACCATGCTGAAGATAACCGGG + Exonic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1117748901 14:58900445-58900467 CTACCTTTCCCAAGTTCACATGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1121049631 14:90812027-90812049 CTACCTTGCCCAGGGTCACAAGG + Intronic
1123199372 14:106647593-106647615 TTTCCTTGCTGAAGATCACAGGG - Intergenic
1124873359 15:33566051-33566073 CTAACTTGCCCAAGGTCACACGG + Intronic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1128240623 15:66098791-66098813 CTGCCATGCCCAAGGTCACACGG + Intronic
1129397972 15:75263190-75263212 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1129401583 15:75287471-75287493 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131504523 15:93004895-93004917 CCAGCCTGCTGAAGAGCACATGG - Intronic
1131999391 15:98163718-98163740 TTCCCCGGCTCAAGAGCACAGGG + Intergenic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133868626 16:9667671-9667693 CTAACTTGTCCAAGATCACAGGG + Intronic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1139407520 16:66730808-66730830 CTGGCCAGCTCAACATCACAGGG + Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1143632422 17:8146791-8146813 ATAGCCTTCTCAAGCTCACATGG + Intronic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1144670582 17:17130544-17130566 GTATCCTGCTAGAGATCACACGG - Intronic
1146511489 17:33453090-33453112 CTTCCTTGCTGAATATCACATGG + Intronic
1146676945 17:34780279-34780301 CTACCCTGCTCAAGAACTTTCGG - Intergenic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1156005879 18:32440268-32440290 ATAACTTGCTTAAGATCACACGG + Intronic
1158241746 18:55385831-55385853 CAGCCCTGCTCAAGTTCTCAGGG + Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1160595641 18:79972260-79972282 GTACCCTGCCCAAGGTCACTTGG + Exonic
1162376967 19:10310525-10310547 TCACCCTGCCCAAGATCACCAGG - Exonic
1162709031 19:12577998-12578020 CTACCTTGCTTCACATCACAAGG - Exonic
1167740930 19:51324590-51324612 CTTCCCTGCTCAAGGTCCCTGGG - Intronic
925950317 2:8903239-8903261 CTTCACCTCTCAAGATCACATGG + Intronic
926383070 2:12310369-12310391 CTGACATGCACAAGATCACATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927187450 2:20492025-20492047 CTACCCTTCTGCACATCACATGG - Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928228402 2:29475391-29475413 CTCTCCTGCCCAAGGTCACACGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
929321268 2:40545943-40545965 TTAACCTGCCTAAGATCACATGG + Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
930030680 2:47056460-47056482 GTACCCTGCTCATTAGCACAGGG + Intronic
930139207 2:47934547-47934569 CTACCCTGCTCAGAATCACCAGG - Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
934042183 2:88136738-88136760 CTGTCCTGCTCTAGATCACTGGG + Intergenic
935643113 2:105309239-105309261 CTGCCCTGCTCCCGCTCACAGGG - Intronic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
937358726 2:121214316-121214338 GTAGCCTGCTCAAAATCATACGG + Intergenic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
948051575 2:234982888-234982910 ATCCCCGGCTCAAGAGCACAGGG - Intronic
1170995141 20:21348224-21348246 GTACCCTTCTCAAAATCAGATGG - Exonic
1171092696 20:22300916-22300938 CCACCCTGCTCTTCATCACAGGG - Intergenic
1171205140 20:23273231-23273253 CTAACTTGCCCAAGGTCACATGG + Intergenic
1172134823 20:32679842-32679864 CTAGCCTGCTCAAGAGAACAGGG - Intergenic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1177650509 21:23954986-23955008 ATAACTTGCTCAAAATCACATGG + Intergenic
1179304336 21:40141222-40141244 CTTCCCTGCTCAGGACCACCTGG - Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182038543 22:27218529-27218551 CTTCCCCCCTCAAGATCCCAGGG + Intergenic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183549108 22:38470838-38470860 CTATTGTGCTCAAGATCACCGGG + Intronic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950659350 3:14457190-14457212 CAACCCTGCCCAGGATGACACGG - Intronic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
955601239 3:60647594-60647616 GTCCCCTGCTCAAAATAACAAGG + Intronic
956573288 3:70721273-70721295 GTAGACTGCTTAAGATCACATGG + Intergenic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
957781464 3:84822748-84822770 CTACCCTGCTCCCCATCACAGGG - Intergenic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
959245705 3:103864475-103864497 CAACTCTGCCAAAGATCACATGG - Intergenic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
964991545 3:162818824-162818846 CCATCTTGCTCAAGACCACAAGG + Intergenic
969326448 4:6447163-6447185 CTACCCAGCTCAAGACCCCGGGG - Intronic
969334900 4:6502070-6502092 CTATCCTGCTCCAGATCGCGTGG - Intronic
969357078 4:6634950-6634972 CTGCCCTGCACAAGAACACCTGG + Intergenic
970422092 4:15914871-15914893 CTACACTGCTCAGGGCCACATGG + Intergenic
970912858 4:21298017-21298039 ATAACTTGCTTAAGATCACAAGG - Intronic
970979293 4:22077911-22077933 AAACCCTGATCAAGATAACATGG - Intergenic
971925027 4:32997520-32997542 CAACCCTGCTAAAGATCAGCTGG + Intergenic
972203781 4:36747502-36747524 CCACCCTCCCCAAGAGCACAGGG - Intergenic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973038894 4:45445801-45445823 CAACCCTTCTCACTATCACATGG + Intergenic
977377888 4:96230943-96230965 CTATCCTTCTCAAGATCTCCTGG + Intergenic
978553378 4:109951712-109951734 GTACCCTGTTGAAGGTCACAGGG + Intronic
981046194 4:140267482-140267504 CTACCCTGTTCTAAATCAAAGGG + Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
981723532 4:147824970-147824992 TTACCTTGCCCTAGATCACATGG + Intronic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
984725201 4:183013667-183013689 CTGCCCTTCTCCCGATCACACGG + Intergenic
986974299 5:13377767-13377789 CTCCCCGGCTCAAGGTCCCAAGG + Intergenic
988162861 5:27543932-27543954 CTACCAGGCTCAATAACACATGG - Intergenic
988805899 5:34740456-34740478 TTACCCTTTTAAAGATCACAAGG - Intronic
991007071 5:61839700-61839722 CTACACTGCTCAAAACCAAAGGG - Intergenic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
992037472 5:72794398-72794420 CTAACTTGGCCAAGATCACATGG - Intergenic
992710917 5:79455254-79455276 ATACTTTGCTCAAGATCAGATGG + Intronic
992869322 5:80990575-80990597 CAGCCCTGCTCAACATAACAGGG - Intronic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
996339496 5:122420700-122420722 CTTCTCTCCTCAAGAACACATGG - Intronic
997297144 5:132775530-132775552 ATAACCTGCCCAAGGTCACATGG + Intronic
997968417 5:138379588-138379610 CTACAGTGTTCAAGGTCACAGGG + Exonic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1005871327 6:29976128-29976150 TTACACTGCTAAAGGTCACAAGG + Intergenic
1006440811 6:34052543-34052565 CTGCCCTGCTCAAGGTCTCACGG - Intronic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1011839863 6:91483908-91483930 ATAACCTGCCCAAGATGACAGGG - Intergenic
1012967447 6:105689997-105690019 TTACCTTGCTCATGGTCACATGG - Intergenic
1013158216 6:107514666-107514688 CTACCTTATTCAAGATTACATGG - Intronic
1013899550 6:115138004-115138026 CTCCCCTTCTCAGGCTCACAGGG - Intergenic
1015114495 6:129632824-129632846 CTACATTACTCAAGATCATATGG - Intronic
1017189156 6:151633522-151633544 CTACTTTGGCCAAGATCACACGG - Intergenic
1017488840 6:154926427-154926449 CTGCCCTGCCCAAGTGCACAGGG + Intronic
1017949451 6:159123635-159123657 CTCCCCTCCCCAAGAACACATGG - Intergenic
1018345009 6:162891285-162891307 TTCCCCTTCTCAAGATCACTTGG - Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1022406318 7:30093546-30093568 CTAACATGCTCAAAATCCCATGG - Intronic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1024596472 7:50941590-50941612 CTGCCCTCCCCAAGATCACCAGG - Intergenic
1025174363 7:56790099-56790121 CTAGCCTGCTACAGAGCACAGGG - Intergenic
1025697441 7:63786323-63786345 CTAGCCTGCTACAGAGCACAGGG + Intergenic
1026252824 7:68685693-68685715 CTACCCTTGTAAAAATCACAAGG + Intergenic
1026452408 7:70540765-70540787 TTACCCTTCTCAAGGTCAAAGGG - Intronic
1026767599 7:73170277-73170299 CTAAGTTGCCCAAGATCACATGG - Intergenic
1026976037 7:74499060-74499082 CTGCCCTCCTCCAGCTCACAGGG - Intronic
1027044067 7:74979985-74980007 CTAAGTTGCCCAAGATCACATGG - Intronic
1027079579 7:75222373-75222395 CTAAGTTGCCCAAGATCACATGG + Intergenic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1029388799 7:100260965-100260987 CTAAGTTGCCCAAGATCACATGG + Intronic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1030415478 7:109238190-109238212 CTACCAGGCCCAACATCACATGG - Intergenic
1032081937 7:128863559-128863581 CTACTGTGCTCAAGACTACAAGG - Intronic
1033280997 7:140006281-140006303 ACACCCTGCTCAAGAGCTCATGG + Intronic
1034057088 7:148046654-148046676 CTACCCAGCTCAAGAACAAAGGG + Intronic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1039364419 8:36915365-36915387 ATACCATGCCCAAGATCACAAGG - Intronic
1042545362 8:69946571-69946593 AGAGCCTGCTCAAGGTCACATGG - Intergenic
1043135213 8:76514586-76514608 CAACTCTCCTGAAGATCACATGG - Intergenic
1043634388 8:82370689-82370711 CTTCCCTTCTGAATATCACAGGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1047193649 8:122701351-122701373 CTTCCCTGCTCAAGAGTAAATGG - Intergenic
1047657199 8:126991003-126991025 ATAACTTGGTCAAGATCACATGG - Intergenic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1056734200 9:89191562-89191584 CTACCATGCTCAAGAGCAACGGG + Intergenic
1056833539 9:89935447-89935469 CTTGCCTGCCTAAGATCACATGG + Intergenic
1057965113 9:99495677-99495699 CTAACCAGCTTAAGATCTCATGG + Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1060398940 9:123336400-123336422 AAACCTTGCCCAAGATCACAGGG + Intergenic
1061165127 9:128917767-128917789 CCACCCTGCTTTAGATCACTCGG + Exonic
1061542613 9:131285894-131285916 CTATCCTGCTTTAGAGCACAGGG + Intergenic
1061818237 9:133208594-133208616 TTGGCCTGCTCCAGATCACAGGG - Exonic
1062242219 9:135546764-135546786 TTGGCCTGCTCCAGATCACAGGG + Exonic
1188221163 X:27543266-27543288 CTACTTTGTTGAAGATCACATGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1190490444 X:50977538-50977560 ATAACCTTCCCAAGATCACATGG - Intergenic
1191608655 X:63088047-63088069 CCACCCTGCCCAAGGTAACAAGG + Intergenic
1192140066 X:68639327-68639349 CTTCCCAGCTCAGGAACACAAGG - Intergenic
1193857412 X:86621625-86621647 CTAGCATGTGCAAGATCACATGG - Intronic
1193952168 X:87813179-87813201 CTACTTAACTCAAGATCACAAGG + Intergenic
1199095370 X:143732441-143732463 TTACCTTGCTAAAGATGACAAGG - Intergenic
1199746482 X:150774948-150774970 CCACCCTGCTTGAGATCCCACGG - Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200761112 Y:7039942-7039964 CTTACCTTCACAAGATCACAAGG + Intronic