ID: 1113834287

View in Genome Browser
Species Human (GRCh38)
Location 13:113318744-113318766
Sequence AGGGAGAAGGCAGTGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 2, 2: 18, 3: 115, 4: 738}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113834287 Original CRISPR AGGGAGAAGGCAGTGAGTGT GGG (reversed) Intronic
900316448 1:2059580-2059602 CGGGAGAAGACAGTGAGTACTGG + Exonic
900537929 1:3187953-3187975 AGGCAGAGGACAGTGTGTGTGGG + Intronic
900707699 1:4090683-4090705 AGGGAGAAGGCAGTGTCAGGAGG + Intergenic
900825212 1:4920854-4920876 AGGGATGAGGCAGTGGGTGAGGG - Intergenic
901524358 1:9810123-9810145 AGGGAGAAGGCAGGGAGGAAAGG + Intronic
901658259 1:10782904-10782926 AGGGATGAGGGAGTGTGTGTTGG + Intronic
901751447 1:11412460-11412482 GGGGAGGGGGCAGTGAGTGTGGG + Intergenic
901937532 1:12636851-12636873 GGGGAGAGGGCACTGAGGGTGGG + Intergenic
902107584 1:14050697-14050719 AGGGAGGAGGCTGAGAGTCTGGG - Intergenic
902143313 1:14375344-14375366 TGGGAGAAGGCTGTCTGTGTTGG - Intergenic
902518853 1:17004696-17004718 AGCGAGGAGGCGGTGAGTGTCGG - Exonic
902882847 1:19384250-19384272 GTGGAGAAGGCAGTGAGGGGAGG - Intronic
902952276 1:19894867-19894889 AGTGAGAAAGCGGTGAGTGGTGG - Intronic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
903769132 1:25753114-25753136 AGGGAGAAAGCAGTGAGGTGCGG - Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904265020 1:29313169-29313191 AGGGAGAAAGCAGAGAGAGGAGG - Intronic
904431261 1:30466071-30466093 ATGGAGCAGGCAGGGAGTGGTGG - Intergenic
904776448 1:32910967-32910989 GGGAAGAAGGCAGAGAGTGTGGG - Intergenic
904918084 1:33984806-33984828 AGGGAGAAGGGAGGGAGGGAAGG + Intronic
905119803 1:35672899-35672921 TGGCAGAAGGCAGTGAGAGCTGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906238601 1:44227713-44227735 AGGGCCAAGGCAGTGAGTTTAGG + Intronic
906542153 1:46595410-46595432 AGGAAGGAGGCAGTGGGTGGGGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906840883 1:49137993-49138015 AGGGAGCAGGCAGGGATTCTGGG + Intronic
907311777 1:53542874-53542896 ATGGAGAAGACACTGAGTCTGGG + Intronic
907733066 1:57086543-57086565 AGGGATTAGGCAGTGAGGGGAGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
909052295 1:70780881-70780903 AGGAAGAAGATAGTAAGTGTGGG + Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910228622 1:84963393-84963415 AGAGAGAAGATAGTGAGTATGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910574010 1:88737780-88737802 AAGGAGAGGGAAGTGAGTGCAGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910851948 1:91657261-91657283 AGGGAGAATGTAGTGGGTGTTGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911393137 1:97271129-97271151 AGAGATAAGGCACGGAGTGTGGG + Intronic
911716486 1:101139281-101139303 AGGGAAAAGGAAGTGAGTTTGGG - Intergenic
912325003 1:108748894-108748916 AGGTAGAAGCCAGTCAGTGGAGG + Intronic
912455458 1:109793647-109793669 AGGGGGCAGGAAGGGAGTGTCGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912719423 1:112007119-112007141 AGGGAGAAGCCAGTGGGGGTGGG - Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913116207 1:115699666-115699688 GGGGAGAAGGCAATGAGTTCAGG + Intergenic
913440450 1:118891501-118891523 AGGGCTAAGGCAGTGAGAGTGGG - Intronic
913535633 1:119769371-119769393 AAGGAGTTGGGAGTGAGTGTTGG + Intergenic
915596613 1:156900007-156900029 AGGAGGAAGGAATTGAGTGTGGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916214640 1:162384599-162384621 AGGGAGAAGGGAGTGAGGATGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917930698 1:179820733-179820755 AGGGAGGAGGGACTGAGTGCAGG - Intergenic
918087963 1:181261475-181261497 ATGGGGAAGGCAGAGAGTATAGG + Intergenic
918276127 1:182955268-182955290 TGGGAGAAGGGAGTCATTGTAGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918472166 1:184885626-184885648 AGGGAGGAGGGAGAGAGTGCAGG - Intronic
918829692 1:189378538-189378560 GGGGAGAAGGGAGGCAGTGTGGG - Intergenic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919105319 1:193142671-193142693 AGGGAAAAGGAAGTGAGGGAAGG - Intronic
919834240 1:201562787-201562809 AGGGAGCAGGCAGGGAGGGGTGG + Intergenic
920118838 1:203640268-203640290 AGGGAGGATGCAGTGAGAGCAGG - Intronic
920675618 1:208036581-208036603 AGTGAGCACGCAGTAAGTGTTGG + Intronic
920914919 1:210251792-210251814 CCGGAGAATGCAGTGGGTGTGGG + Intergenic
921741893 1:218694901-218694923 TGGGAGATGGCAGTGTGGGTGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922909679 1:229205086-229205108 AGGGGAAAGGCAGAGAGAGTGGG - Intergenic
922998413 1:229985172-229985194 AGGGAGAAGGCAGAGTCCGTGGG + Intergenic
923489893 1:234475311-234475333 AGGGACAAGGGTGAGAGTGTGGG - Intronic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923608178 1:235464436-235464458 AGGGAGAAGGTGGTGAGGGAGGG - Intronic
923918051 1:238530566-238530588 AGGGAGAGGCCAGGGAGTGAGGG + Intergenic
923938675 1:238794513-238794535 AGGAAGAAGGGAGGGAGGGTGGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924581921 1:245330608-245330630 AGGGAGGAGGGAGGGAGTGGGGG + Intronic
1063256806 10:4337386-4337408 AGGGAGAAGGCAGGGAGGGGGGG + Intergenic
1063618380 10:7622153-7622175 AGGGAAGAGTCAGTGAGTGGAGG - Intronic
1063624798 10:7678868-7678890 AGGGGGAAGGGAGGGAGGGTTGG + Intergenic
1065916573 10:30358445-30358467 TGGGAGAGGCCAGTGTGTGTAGG + Intronic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066694331 10:38064548-38064570 AGAGAGAAGGAAGTGATTCTTGG - Intronic
1067227306 10:44384579-44384601 AGCGGGAAGGCAGTGGGTGGAGG + Intronic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1067327009 10:45279130-45279152 AGGAAGAAGGGAGTGGTTGTTGG - Intergenic
1067684448 10:48458239-48458261 AGGGAGAAGGCAGACAGGGGAGG + Intronic
1068653748 10:59553481-59553503 AGTGATCAGGCAGTCAGTGTTGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1070050764 10:72887383-72887405 AGGGAGAAGGAAGTGGGCGGAGG - Exonic
1070069019 10:73067664-73067686 AGGGAGACAGGAGTGGGTGTGGG - Intronic
1070543303 10:77432897-77432919 AGGGGGAAGGGACTGAGTGAGGG + Intronic
1070641690 10:78175094-78175116 AGGGACATGGCAGCCAGTGTGGG + Intergenic
1070776805 10:79114550-79114572 AGGGAGAAGGGAGGGAGGGAAGG + Intronic
1071108034 10:82121503-82121525 ATGAGGAAAGCAGTGAGTGTTGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071757148 10:88555814-88555836 AGGGAGATGCCAGTGAGTGAGGG - Intronic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072725865 10:97813529-97813551 AAAGAGAAGGCAGTGACTTTAGG + Intergenic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1072873463 10:99146274-99146296 AGGGAGAAGGGATTGTGTTTAGG - Intronic
1074280280 10:112045063-112045085 GAGGAGACGGCAGTGAGTCTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074758113 10:116642642-116642664 AGGGGCAAGGCAATGATTGTAGG + Intronic
1075065590 10:119287119-119287141 ATGGAGAAGGCAGGGAGGGAAGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075666595 10:124234997-124235019 GAGGCGAAGGCAGTGAGTGTTGG + Intergenic
1075677604 10:124306910-124306932 AAGGCAAAGGCAGAGAGTGTTGG - Intergenic
1075857051 10:125638403-125638425 AGAGAGATGGCAGTGAGAGAAGG + Intronic
1075872685 10:125782228-125782250 GGGGAGAAGGCAGTGCGAGAAGG - Intergenic
1076181508 10:128412586-128412608 AGGGAAAAGCCAGGGAGGGTGGG - Intergenic
1076182201 10:128418996-128419018 AGGGAGCAGGTTGTCAGTGTGGG + Intergenic
1076984197 11:223611-223633 AGGGAGAAGGATGGGGGTGTGGG - Intronic
1077109363 11:855284-855306 AGGGGGACGGGAGTGAGCGTGGG + Intronic
1077214001 11:1387678-1387700 ATGGAGAAGGCGTTGAGTCTGGG + Intergenic
1077387175 11:2275535-2275557 GGAGAGGAGGCAGTGAGTGATGG - Intergenic
1077816395 11:5690046-5690068 AGGAAGAAAGCACTGAGTCTGGG + Intronic
1078729033 11:13959292-13959314 AGTCAGAAGGCACTGAGGGTAGG + Intergenic
1078897241 11:15607597-15607619 AGAGACAAGGCAGTCTGTGTCGG + Intergenic
1079106722 11:17576744-17576766 AGGGAGGGGGAAGTGAGTGAGGG + Intronic
1079773736 11:24497200-24497222 AGAGAGAAGGCAGCGAGGGAAGG + Exonic
1080192605 11:29570029-29570051 AGGGAGAATCCTGTCAGTGTGGG - Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081460934 11:43272433-43272455 ATGGGGAAGGCAGGGAGTTTGGG + Intergenic
1081488009 11:43546939-43546961 CGAGATAAGGCAGTGTGTGTTGG - Intergenic
1081633605 11:44705845-44705867 AGGGAGAAGGCAAGGAGTGGAGG - Intergenic
1081754366 11:45534206-45534228 AGGGAGCAGGCTGTGAGGGGAGG - Intergenic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082807555 11:57460464-57460486 AGGGAGGAGCCAGCGAGTGCGGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083292104 11:61696092-61696114 AGGGAGCAGGAAATGAGAGTGGG + Intronic
1083515777 11:63257457-63257479 AGGGAGAAGGGAGGGAGGGAGGG - Intronic
1083746417 11:64739546-64739568 AGAGAGAAGGCAGTGGGTTAGGG + Intronic
1084178836 11:67436765-67436787 AGGAAAAAGGCACTGAGTGCTGG - Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085535147 11:77213042-77213064 AGGGATAAGGCAGCAAGTGGGGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085750851 11:79160057-79160079 ATGGAGAAGGGAGTGAATGAAGG - Intronic
1085777873 11:79382650-79382672 AGGGAGAAGGGATGGAGGGTAGG + Intronic
1087652545 11:100884922-100884944 AGGGAGCAGGCAGGGAGAATGGG - Intronic
1087696522 11:101383384-101383406 AGGGAGAAGGGAGGGAGCGATGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088834007 11:113561904-113561926 AGGGAGAAGGCAGAGAGACAAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1088975997 11:114817025-114817047 TGGTAGAAGGCAGTTAGGGTGGG + Intergenic
1089050881 11:115544763-115544785 AGGGCAAAGGCAGTGTGGGTAGG + Intergenic
1089706751 11:120283639-120283661 GGGGAGAAGGGAGTGGGTGGGGG - Intronic
1090199555 11:124844574-124844596 AGAGACAAGGCAGTGAGGGATGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090301561 11:125645304-125645326 AGGGAGATGGGAGAAAGTGTGGG - Intronic
1090604529 11:128407491-128407513 ATGGACAAGGCAGTCAGAGTTGG - Intergenic
1090718448 11:129451448-129451470 AGAGAGAAGGCAGGGAGAGTAGG + Exonic
1091131401 11:133150044-133150066 AGAGAGAAAGGAGTGAGTGGAGG - Intronic
1092188183 12:6497125-6497147 AGGAAGAAGGCAGAGTGTGGAGG + Intronic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095999387 12:48116152-48116174 AGGAAGGAGGCAGGGAGTGAGGG - Intronic
1096091617 12:48905735-48905757 AAGGAGAAGGCAGTAAATGGAGG - Intronic
1096101128 12:48971062-48971084 AGGGAGGGGGCAGTGTGAGTGGG - Intronic
1096145909 12:49278542-49278564 AGGGTGAAGGGAGAGAGAGTGGG - Intergenic
1096243566 12:49972340-49972362 AGGCAGGAGGAAGTGAGTGAAGG + Intronic
1096271322 12:50167907-50167929 AGGGATAAAGCAGTGAAAGTAGG - Intergenic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1096770376 12:53932428-53932450 AGGGAGGAGGCAGTGAGGGAGGG + Intergenic
1096909523 12:54968320-54968342 AGAGAGAAGGAAGGAAGTGTGGG - Intronic
1097616653 12:61891764-61891786 AGAGAGAAGGCAGTGTGGGAGGG + Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099935864 12:89124577-89124599 AGGGAGAATGAAGTGTGTATTGG - Intergenic
1100272901 12:93043487-93043509 AGGGAGGAGGGAGGGAGGGTGGG - Intergenic
1100280067 12:93110087-93110109 AGGGGGAAGGGGGTGTGTGTGGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101637443 12:106556811-106556833 AGAGAGAAGGCAGTGGATGGGGG + Intronic
1102001675 12:109561424-109561446 AGGATGAAGGCCGTGAGTGGTGG + Exonic
1102803578 12:115759264-115759286 AGACAGAAGGCAGTGAATATCGG - Intergenic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1103088012 12:118076944-118076966 AGGGAGAAGGCCGGGCGTGGTGG - Intronic
1103374702 12:120446627-120446649 AGGGATGAGGCGGGGAGTGTGGG - Intronic
1103516994 12:121514566-121514588 AGGGAGCAAGGTGTGAGTGTGGG - Intronic
1103891109 12:124239767-124239789 ACGGAGAAGGCAGAGAGTGCTGG - Intronic
1104367737 12:128193140-128193162 AGGGTCAAGGCACTGAGTGATGG - Intergenic
1104668915 12:130667181-130667203 AGGGAGGAGGCAAGGAGTGAGGG + Intronic
1106450830 13:29880526-29880548 AGGGACATGGCAGTCAGTGGTGG + Intergenic
1107414752 13:40190191-40190213 AGGGAGTGGGGAGGGAGTGTGGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107828534 13:44352881-44352903 AGGGTGCTGGCAGTGTGTGTGGG - Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1109649915 13:65311151-65311173 AGGAAGAATCCAGTGAGTGATGG - Intergenic
1110419433 13:75288639-75288661 AGGGAGGAGGAATTGAATGTAGG - Intronic
1110538601 13:76681888-76681910 AGGGAGTGGGCAGTGGGTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111274827 13:85935371-85935393 AGGGAGAAGCCAGGCAGTGGTGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111496426 13:89056383-89056405 AGGGAGAAGGAAAGGAGTGGGGG - Intergenic
1111663559 13:91240458-91240480 AGGGAGAAGACATTCAGAGTTGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1112311670 13:98322659-98322681 AGGAAGAAGGCACTGAGTAGAGG + Intronic
1112325330 13:98439806-98439828 AGGGAGAAGGCACTCTGAGTTGG - Intronic
1112426947 13:99311275-99311297 AGGGGGAAGGCTGTGAGGGCGGG + Intronic
1113469856 13:110536551-110536573 AAGGAGAAGTCAGTGAGGATGGG + Intronic
1113481624 13:110625931-110625953 AGGGAGGGGGCTGTGAGAGTGGG + Intronic
1113704297 13:112415984-112416006 AGAGGGAGGGAAGTGAGTGTGGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114173132 14:20294664-20294686 AGGGATTAGGAAGTGAGTGAAGG + Intronic
1115653480 14:35420701-35420723 AGGGAGAAGGGAGGGAGGGGGGG + Intergenic
1116019217 14:39441120-39441142 AGGGAGAGGCCAGGGAGAGTGGG - Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116350717 14:43859210-43859232 AGAGAGAAGGAAGTGAGTTTAGG + Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118806308 14:69240155-69240177 AGGGAGAGGAGAGTGTGTGTGGG + Intronic
1119172722 14:72547058-72547080 AGTAAGAAGGCAGAGAGTGAAGG + Intronic
1119182567 14:72614582-72614604 GGAGAGAAGGCAGTGAGGGAGGG - Intergenic
1119268120 14:73277104-73277126 TGGGAGATGGCAGTGGGTGGAGG + Exonic
1120010179 14:79404932-79404954 AGAGAGAAGCCAGTGGGTGGTGG + Intronic
1120441641 14:84548502-84548524 ATGGAGAAGGCAGAAAGTGCAGG - Intergenic
1121104665 14:91272555-91272577 AGAGAAAAGGCCGTGAGAGTCGG + Exonic
1121472499 14:94166166-94166188 AGGGAGAGGGCAGTGAGATGGGG - Intronic
1121604473 14:95230516-95230538 TGGGAGAGGGCAGTCAGGGTCGG + Intronic
1122063001 14:99149159-99149181 GGGAGGAAGCCAGTGAGTGTAGG + Intergenic
1122753544 14:103958380-103958402 AGGGAGTAGACAGTGGGTGTGGG + Intronic
1122911110 14:104827927-104827949 CTGGAGAAGGCAGGGAGGGTGGG + Intergenic
1123453748 15:20396194-20396216 AGGGAGAAAAGAGTGAGTGAGGG - Intergenic
1126065746 15:44825030-44825052 AGGTAGAAGTCAGTGTGTGGAGG - Intergenic
1126094089 15:45075537-45075559 AGGTAGAAGTCAGTGTGTGGAGG + Exonic
1126154025 15:45548434-45548456 TGGGAGAAGCCTATGAGTGTAGG - Intergenic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127368202 15:58310806-58310828 AAGGAGAAGACAGTATGTGTCGG + Intronic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128212421 15:65912036-65912058 AATGAGAGGGCAGTGAGTGGGGG + Intronic
1128838864 15:70833186-70833208 AGGGATAAGGAAGTGAGGGAGGG - Intronic
1128889511 15:71318198-71318220 AGAGATAAGGCAGTGAATTTGGG + Intronic
1128961759 15:72013689-72013711 ATGGAGTAGGCAATTAGTGTGGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129174856 15:73832589-73832611 AGGGGGACGGCAGTGAGGGAGGG + Intergenic
1129210417 15:74064904-74064926 TGGGAGAGGCCAGTGTGTGTGGG + Intergenic
1129403597 15:75300469-75300491 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1129961979 15:79695166-79695188 AGGGAGAAGGGAGAGAGAGAAGG - Intergenic
1130012413 15:80161876-80161898 AGGGAGAAGTCAATCAGTATAGG + Intronic
1130139238 15:81209703-81209725 AGGGAGAAGTGAGTGGGTGTGGG - Intronic
1130141461 15:81229707-81229729 AGGGAGAAGTGAGTGGGTGTGGG - Intronic
1130485467 15:84396031-84396053 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1132293781 15:100720388-100720410 AGGGAGAAGGTGCTGAGGGTGGG + Intergenic
1132327860 15:100986788-100986810 AGGCAGAGGGCAAGGAGTGTAGG - Intronic
1132788295 16:1670406-1670428 TGGGGGATGGCAGTGAGGGTGGG + Intronic
1132860909 16:2071309-2071331 AGGGAGGAGGCTGTGGGTGCTGG + Intronic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1133392755 16:5422772-5422794 AGGGAGAAGGGAGAGGGAGTGGG + Intergenic
1134661477 16:15987746-15987768 AGGGAGGAGACAGTCAGTGCGGG - Intronic
1134681786 16:16131542-16131564 AAGGAGAAGGCAGTGCGGGAGGG + Intronic
1134783227 16:16917649-16917671 AGGAAGAAGGGACCGAGTGTAGG - Intergenic
1136579731 16:31143912-31143934 AGGGAGAAGGTGGTGTATGTTGG - Intronic
1137287776 16:47030652-47030674 AGTGAGAAGCCAGTGAGCCTTGG - Intergenic
1137671586 16:50282449-50282471 AGGGATAAGGGAGTGTGTGTGGG + Intronic
1138252267 16:55510051-55510073 AGGCAGAAGGCAGAGAGCCTAGG + Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139006838 16:62583248-62583270 AGGGGGCAGGCAGTGAGATTTGG + Intergenic
1139032023 16:62895669-62895691 AGGGGAAAGGGAATGAGTGTGGG - Intergenic
1140449453 16:75058719-75058741 GGGTAGATGGCAGTGGGTGTTGG + Intronic
1140688929 16:77462780-77462802 TGGGAGAATGCAGTGTGTTTGGG + Intergenic
1140977090 16:80070382-80070404 AGGGAGAAGGATGTGAATGAGGG - Intergenic
1141087969 16:81110357-81110379 AGGGAAAATGCAGTGAGGGGAGG - Intergenic
1141376604 16:83536490-83536512 AGTGGGAATGCAGTGAGTGTGGG + Intronic
1142189748 16:88712446-88712468 AGGGAGAGGCCAGTGAGGCTGGG - Intronic
1142189773 16:88712520-88712542 CGGGAGACGGCAGTGAGGCTGGG - Intronic
1142906991 17:3050099-3050121 AGGCAGAGGGCAGGGAGAGTTGG + Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143092806 17:4459034-4459056 ATGGAGAAGGGAGTGAGGATGGG - Intronic
1143591966 17:7890610-7890632 CGGGAGAAGTCAGAGAGTGGGGG + Exonic
1143643649 17:8215136-8215158 AGGGAGCAGGCAGAGATGGTTGG + Intergenic
1144029399 17:11305902-11305924 AGGGAGAAGGCATTATTTGTGGG + Intronic
1144174851 17:12695265-12695287 CGGGAGGAGGCAGTGAGAGGCGG - Intronic
1145095364 17:20020782-20020804 AGGGAGAAGAGAATGAGAGTGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148233306 17:45950553-45950575 AGGGAGAAGGGTGTGTGTGCAGG - Intronic
1148839512 17:50485792-50485814 AGGGGGAAGGAAGTGAGTGAGGG - Exonic
1148885499 17:50769240-50769262 AGGAAGAAGGCAAAGTGTGTTGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149525092 17:57349210-57349232 AGGGAGAAGGCAGTGAGCTGAGG - Intronic
1149710707 17:58739598-58739620 AGGGAGGAGGCCTTGAGTGCAGG - Intergenic
1149888395 17:60363879-60363901 AGGGAGAAAGAAGGAAGTGTTGG + Intronic
1150001128 17:61440891-61440913 AGAGAATAGGCAGTGAGTATGGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150384964 17:64751447-64751469 AGGGAAAAGGAAGTGGATGTGGG - Intergenic
1150479143 17:65496383-65496405 AGGGAGGAGGCAGGGCGTGGTGG - Intergenic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151125043 17:71835468-71835490 AGGGAGCAAGCAGGGAGTGGAGG - Intergenic
1151271560 17:73000279-73000301 AGAGAGAAGGCAGAGAGAGAGGG - Intronic
1151396845 17:73828375-73828397 AGTGAGACAGCAGTGAGTCTAGG - Intergenic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1151897773 17:76991845-76991867 AGGGAGAAGGCAGGCAGGGCTGG + Intergenic
1152070285 17:78130872-78130894 AGGGAGAATGCAGAGGGTGAGGG + Intronic
1152114247 17:78375193-78375215 AACGAGAAGGCAGTGGGTGAGGG + Intergenic
1152211280 17:79004377-79004399 AGGGAGAAGGGAGTTAGGGAGGG + Intronic
1152211332 17:79004521-79004543 AGGGAGAAGGGAGTTAGGGAGGG + Intronic
1152211574 17:79005209-79005231 AGGGAGAAGGGAGTTAGGGAGGG + Intronic
1153262531 18:3238377-3238399 AGGGGGGAGGCAGGGGGTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155397491 18:25402216-25402238 AGAGAGAAGTTAGTGAGTCTTGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155552079 18:26975206-26975228 CAGGAGAAGCCAGTGAGGGTGGG + Intronic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155900296 18:31381469-31381491 AGGGAGAAGGGAGTCAATGCTGG - Intronic
1156438441 18:37158765-37158787 AAGCAGAAGGCAGTCAGTATTGG + Intronic
1156502954 18:37571208-37571230 AGGGAGAACGCTGTGTGTTTGGG + Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157290409 18:46405898-46405920 CGGGAGGAGGAAGGGAGTGTGGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158759620 18:60369166-60369188 AGGGAGCAGAGAGTGAGAGTGGG - Intergenic
1159644160 18:70897906-70897928 AGGGAGTAGGGATTGAGTTTGGG - Intergenic
1159965065 18:74587281-74587303 TGGGAGAAGGGAGTGAGCGAGGG + Intergenic
1160086322 18:75780480-75780502 AGGGAGAAACCTGTGGGTGTGGG - Intergenic
1160756740 19:761449-761471 AGGGGGATGGCTGTGAGTCTGGG + Intronic
1161001724 19:1914183-1914205 AGGGAGGAGGGAGTGAGAGGTGG + Intronic
1161242385 19:3229503-3229525 CTGGAGGAGGCAGTTAGTGTAGG + Intronic
1161638099 19:5401903-5401925 AGGAAGAAGGAAGAGAGGGTTGG + Intergenic
1162367438 19:10258094-10258116 AGGAACAAGGCAGAGAGGGTGGG - Intronic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1162749241 19:12818281-12818303 AAGAAGAGGGCAGTGAGAGTAGG + Intronic
1163442232 19:17328077-17328099 AGGGTGAAGGCCGTGGGGGTGGG - Intronic
1163519660 19:17784383-17784405 AGGGAGTAGGCAGTGTGGGTCGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164530016 19:29041514-29041536 AGGGAGGAGGCAGAGTTTGTGGG + Intergenic
1165075265 19:33276826-33276848 CAGAAGAAGGAAGTGAGTGTGGG - Intergenic
1165394138 19:35555129-35555151 AGGGGGAGGGCAGGCAGTGTGGG - Intronic
1165447916 19:35866764-35866786 GGGGACAGGGCAGTGGGTGTTGG + Exonic
1165591527 19:36973425-36973447 ATGGGGAAGGAAGAGAGTGTCGG + Intronic
1166054279 19:40279322-40279344 AGGAGGGAGGGAGTGAGTGTGGG - Intronic
1166070355 19:40383747-40383769 TGGGTGAGGGCAGTCAGTGTGGG - Intronic
1166124139 19:40703629-40703651 AGGGAGAAGGGAGGGAGAGAAGG + Intronic
1166301563 19:41914377-41914399 AGGGAGAGGGCAGTGAGGTGGGG - Intronic
1166347966 19:42178060-42178082 AGGGAGAGGGCAGGAAGTATAGG + Intronic
1166393033 19:42420663-42420685 AGGGAGGAGGCAGTGGAGGTGGG - Intronic
1166824266 19:45599428-45599450 AGGGAGAAGGCGGGGAGGGGGGG - Intronic
1166863501 19:45822851-45822873 AGGGAGAAGGTGGTGGGGGTGGG + Intronic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168177637 19:54636095-54636117 AGAGAAAGGGCAGAGAGTGTGGG + Intronic
1168181912 19:54667235-54667257 AGGTAAAGGGCAGAGAGTGTGGG + Intronic
1168406456 19:56112929-56112951 GGGGAGAAGAGAGTGAGGGTGGG - Intronic
1168493975 19:56835157-56835179 AGGGTGGACGCAGTGGGTGTGGG - Intronic
1168570751 19:57466856-57466878 AGAGAGCACGAAGTGAGTGTGGG - Intronic
924994126 2:341321-341343 TGGGAGAGGGGAGAGAGTGTGGG - Intergenic
925159419 2:1673574-1673596 AAGGAGAAGGCAGATAGTGAGGG + Intronic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926149305 2:10415792-10415814 AGGGGAAAGGCATTGAGTGTGGG - Intronic
926345601 2:11942226-11942248 AGGGAGAAAGCAGTGAGCTGGGG + Intergenic
926481547 2:13403050-13403072 AGGGAGAAAAGAGTGAGTGAGGG + Intergenic
926527002 2:13993066-13993088 AGGCAAAAGACAGTGTGTGTAGG + Intergenic
926665116 2:15513168-15513190 AGGGAAAAGGCTTTGTGTGTAGG - Intronic
926756251 2:16238493-16238515 GGGGCCAAGGCAGTGAGTGAGGG + Intergenic
927935170 2:27072073-27072095 AGGGAGAGGGCACTGAGGGCAGG - Intergenic
928172839 2:29014475-29014497 AAGGAGAAGGCTGTCAGCGTGGG - Exonic
929641757 2:43587556-43587578 AGGGATGAGGCAGTGATTGCTGG - Intronic
930187119 2:48421158-48421180 AGGAAGAAAGCAGGGAGAGTTGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930833460 2:55770235-55770257 AGGGAGAAGGGAGGGAGGGAGGG - Intergenic
930845605 2:55900323-55900345 ACGAAGAAGGCAGTGAGAGTTGG - Intronic
931012736 2:57936012-57936034 GGGGAGAAGGAAGTGATGGTAGG + Intronic
931641405 2:64383756-64383778 AGGGGGATGGGAGGGAGTGTAGG - Intergenic
931882809 2:66583722-66583744 AGGGAGAAGGAGGTGCGTGTGGG + Intergenic
932368403 2:71167471-71167493 AGGAAGAAGGCAGGAAGGGTAGG + Intergenic
932465703 2:71922752-71922774 AGGCAGAAGGCGGTGAGGGAGGG - Intergenic
933596650 2:84289452-84289474 AGGCAGAAGGCAGACAGAGTAGG + Intergenic
934151502 2:89151920-89151942 TGGGGGAAGGCTGTGGGTGTGGG - Intergenic
934215757 2:90029986-90030008 TGGGGGAAGGCTGTGGGTGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935174754 2:100640044-100640066 AGGGGGAAGGCAGTGAGGAGTGG - Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935805632 2:106744835-106744857 AAGGAAAATGAAGTGAGTGTTGG - Intergenic
936369859 2:111894871-111894893 AGGGACAGGGAGGTGAGTGTAGG + Intergenic
936499866 2:113058707-113058729 AGGGAGAAGGGAAGGAGTGAAGG + Intronic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936709178 2:115111535-115111557 AGGGAGTAGGCATGGGGTGTAGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937667009 2:124499361-124499383 ATGGAGAAGGCAGCCACTGTGGG + Intronic
937697009 2:124819107-124819129 AAGTAGAAGGCAGAGAGTGAAGG - Intronic
938421790 2:131152527-131152549 AGGGAGGAGGCAGTGTGGGCTGG + Intronic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
939028897 2:137046833-137046855 GGTGAGAAAGCAGTGAGTGGAGG + Intronic
939123248 2:138143554-138143576 AGTGAGAAGGCTGAGAGTGAGGG - Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939501851 2:142996625-142996647 AGGGAACAGGCAGTAACTGTGGG + Intronic
939761452 2:146186771-146186793 AGGGAAAAGGGAGAGAGGGTAGG + Intergenic
939852386 2:147317485-147317507 AGGGAGGAGGCAATGATTTTTGG - Intergenic
939862686 2:147438712-147438734 AAGGAGGAGGCACAGAGTGTAGG - Intergenic
939955816 2:148526974-148526996 ATGGAGAAGTCACTGGGTGTAGG + Intergenic
940201579 2:151157143-151157165 AGGAAAAAGGAAGTGAGTTTTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941443751 2:165573986-165574008 AGGGAGTAAGCAGTGAGAATAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941950057 2:171145904-171145926 ATGGAGAAGGTAGTGACTGATGG + Intronic
942716402 2:178897496-178897518 ATTAAGAAGGCAGTAAGTGTTGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943760170 2:191599556-191599578 AAGGAGAGGGCAGAGAGTTTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944365453 2:198913738-198913760 AGGGAGATGACAGTGGGTGATGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945061124 2:205909784-205909806 AGGGAGAAAGCAGAGAGACTAGG + Intergenic
945974383 2:216259202-216259224 AGGGAGCAGGCAGAGGGTGGGGG - Exonic
946000146 2:216475501-216475523 GGGCAGGAAGCAGTGAGTGTCGG + Intronic
946254406 2:218432454-218432476 AGGGAGCAGGGAGTGTGTCTAGG + Intronic
946425581 2:219594005-219594027 AGGGAGAAGGCCGGGCGTGATGG - Intergenic
946606227 2:221408484-221408506 AGGGAGAAGGCAGTGGGGTGGGG - Intergenic
946966962 2:225046206-225046228 AGGGAGGAAGCAGTGAGGGAAGG - Intergenic
947489975 2:230585242-230585264 AGGGGGAAGGTGGGGAGTGTGGG - Intergenic
947857349 2:233333195-233333217 AGAAAGGAGGCAGTGAGTGGTGG - Intronic
948384634 2:237573925-237573947 TGGCAGAAGGCAGTGAGAGCTGG - Intergenic
948612125 2:239176402-239176424 AGGGCAAAGAGAGTGAGTGTGGG - Exonic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948778626 2:240303384-240303406 AGAGGGAAGGGAGTGAATGTTGG - Intergenic
948862253 2:240758294-240758316 AGAGAGATGGCAGTGGGGGTAGG - Intronic
948959010 2:241316846-241316868 AAGGAGAAGGCAGTTAAGGTGGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168941732 20:1718635-1718657 AGGGAGGTGGCAGTCATTGTTGG - Intergenic
1169602214 20:7274572-7274594 AGGGAGAAGGGAGAGATTCTGGG + Intergenic
1169726293 20:8736670-8736692 AGGGAGAAGAGAGAGAGTGAGGG + Intronic
1169859356 20:10135241-10135263 GAGGAGAAGGCAGGGAGGGTTGG - Intergenic
1169887822 20:10420937-10420959 AGGGAGCAGGCAGTCAGCCTTGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170718798 20:18856951-18856973 AGGGACAAGGCAGGAAATGTAGG - Intergenic
1171951153 20:31423759-31423781 TGGGAGTAGACAGTGAGTCTTGG - Intergenic
1172947069 20:38697745-38697767 AGTGAGAAGTCAGTAAGGGTGGG + Intergenic
1173127929 20:40357428-40357450 AGTTGGAAGGCAGTGAGTTTGGG - Intergenic
1173325116 20:42026190-42026212 AGGGAGCAGGGAGTGATTGGAGG + Intergenic
1173356043 20:42291562-42291584 AGGGAGATGGCATGGGGTGTGGG + Intronic
1173472166 20:43332531-43332553 TGGGAGAAGGCAGTGGGGGTGGG + Intergenic
1173615357 20:44399969-44399991 ATGTAGAAGGCAGAGAGTGAGGG - Intronic
1173688507 20:44940796-44940818 TGGCAGAAGGCAGTGAGCGCAGG - Intronic
1174040343 20:47694768-47694790 AAGGCCAAGGCAGTGCGTGTGGG + Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1174408129 20:50316197-50316219 AGGCTGAAGGCAGTGGGTTTGGG - Intergenic
1174579330 20:51560329-51560351 AAGCAGAAGGCAGGGAGTCTGGG + Intronic
1174662787 20:52228816-52228838 ATGGACAGGGCAGTGAGGGTGGG - Intergenic
1175454009 20:59096092-59096114 GGAGAGCAGGCAGTGACTGTGGG - Intergenic
1175530380 20:59670860-59670882 CAGGAGATGGCAGTGAGAGTGGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175641574 20:60634818-60634840 AGAGAGAAGGCAGACAGGGTAGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178477728 21:32952062-32952084 AGGGAGAAAGCAGTGAGAGCCGG + Intergenic
1178541163 21:33451864-33451886 AGGTAGTAGGCAGGGAGTGGAGG + Intronic
1178590010 21:33901943-33901965 AGGAGGCAGGCAGTGAGTCTGGG + Intronic
1179302336 21:40123808-40123830 AGGGAGAAGGGAGGGAGGGAAGG + Intronic
1179802719 21:43818832-43818854 AAAGACAAGGCAGTGAATGTTGG - Intergenic
1179811427 21:43873103-43873125 AGGGAGATGGCATCGAGTGGCGG + Intronic
1180945116 22:19688480-19688502 AGGGAGAGGGCAGTGGGCCTGGG - Intergenic
1181313977 22:21960267-21960289 AGGGAGAAGCCAGGGAGCCTCGG + Intronic
1181521106 22:23449269-23449291 AGGGAGAAGGGGCTGAGTGTGGG - Intergenic
1181832416 22:25571664-25571686 AGGGAGGAGGGAGTGGGTTTGGG + Intronic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1182743564 22:32587336-32587358 AGAGGGAGGGCAGTGGGTGTTGG + Intronic
1182785276 22:32902300-32902322 AGGGAGAATGTAGTCAGTGAGGG + Intronic
1183083387 22:35471623-35471645 ACTGAGAAGGCAGTGGGGGTGGG - Intergenic
1183810968 22:40256959-40256981 AGGCAAAAGCCAGTGTGTGTTGG + Intronic
1184173822 22:42774813-42774835 AGGGAGAAGCCAGGCAGTGGGGG - Intergenic
1184414432 22:44343973-44343995 AGGCAGGAGACAGTGAGTCTTGG - Intergenic
949180889 3:1130277-1130299 GGGGTGAAGGGAGTGAGGGTAGG - Intronic
950164183 3:10781072-10781094 AGGGCGAAGGGAGAGAGTGATGG - Intergenic
950454196 3:13082935-13082957 AAGGAGCCAGCAGTGAGTGTGGG - Intergenic
950495847 3:13333940-13333962 AGGGAGAAAACAGGGAGTGGCGG + Intronic
950677522 3:14563624-14563646 AGGGAGAAGGCAGGGAGGAGGGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952687573 3:36167746-36167768 AGGGAGAAGAGAGTGAGAGGAGG - Intergenic
953376786 3:42435538-42435560 AAGGAGAAGGAAGTCAGTGAGGG + Intergenic
953622158 3:44542655-44542677 AGGGAGAAGGCAGTAAGCCCTGG - Intergenic
954362144 3:50127550-50127572 AGGAAGAAAGCAGCCAGTGTGGG + Intergenic
954390960 3:50267712-50267734 TGTGAGAAGGCAGCCAGTGTTGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954808070 3:53231747-53231769 AGGCAGTAGACAGTGAGTGGTGG - Intronic
954948246 3:54445651-54445673 GGGGAGGAGGTAGGGAGTGTTGG + Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956851011 3:73228155-73228177 AGGGAGAAGGGAGAGAGAGAGGG - Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958464538 3:94442260-94442282 AGAGGGAAGGCACTGAGAGTGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960049600 3:113227333-113227355 AGGGAAAAGCCAGTCAGAGTTGG + Intronic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
960533157 3:118787946-118787968 AGAGAGAAGGGATAGAGTGTGGG - Intergenic
960948231 3:122981527-122981549 AGAGAGTAGGAAGTGAGTGTAGG - Intronic
961008664 3:123421933-123421955 ACGGAGAAGGCCGTGAGTTGAGG - Intronic
961567468 3:127773954-127773976 AGGGCGAAGTCAGGGAGTGTGGG - Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961628646 3:128280760-128280782 AAGGAGAAGGGGGTGAGGGTTGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962883490 3:139601068-139601090 AGGGAGCAGGCAGTGAGGACAGG + Intronic
963017498 3:140839833-140839855 AGGGAGAAGGCAGAGGGCATGGG - Intergenic
963072158 3:141313150-141313172 AGGGATAAGGCTGGGAGTGGAGG - Intergenic
963107895 3:141661818-141661840 TGGGAGATGGCCGTGAGTGGAGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963170756 3:142248929-142248951 AGGGAGCAGGCAGGGAGTGAGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964645444 3:158953920-158953942 AGGGAGAAGGGAGGGAGGGAGGG + Intergenic
964706461 3:159623922-159623944 AGGTGGAAGGCAGTGGGAGTAGG - Intronic
964830979 3:160884235-160884257 AGGGAGAAGCCAGTTAGTTGTGG + Intronic
965087164 3:164113838-164113860 AGGGAGAAGCCAGGCAGTGGGGG - Intergenic
965096536 3:164235533-164235555 GGGGAGAAGGAAGTGAGTATAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966914359 3:184576804-184576826 AGGGAGAAGGTAGTGAGCTGGGG - Intronic
967148541 3:186627114-186627136 AGAGAGAAGGAGGTGAGAGTGGG - Intergenic
967467891 3:189828295-189828317 AGGGGAAAGGAGGTGAGTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967920101 3:194608139-194608161 AGGGAGGAGGCAGGGTGTGTGGG - Intronic
968516526 4:1017883-1017905 AGGGAGAACGGTGTGGGTGTGGG - Intronic
968637978 4:1692211-1692233 AGGGTGAAGGCAGTGGGAGCAGG + Intergenic
968669168 4:1839440-1839462 AGGGTGAAGGCATCGAGAGTGGG + Intronic
968829522 4:2925664-2925686 AGGGAGAAGGCAGGGAGGGAGGG + Intronic
968855278 4:3115636-3115658 AGGGACTGGGCAGTGGGTGTGGG + Intronic
968936305 4:3612253-3612275 CAGGAGGAGGCAGTGACTGTGGG + Intergenic
970785778 4:19794291-19794313 AGGAGCAAGGCAGTGAGTGGTGG - Intergenic
970793202 4:19883787-19883809 AGTGAGAAGGCAGTAAGTGCTGG - Intergenic
971029843 4:22624052-22624074 CAGGAGAAGCCAGTGAGGGTTGG + Intergenic
971307559 4:25496828-25496850 AGGGAGAAAGAACGGAGTGTGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973345047 4:49046539-49046561 GGTGAGAAGGCAGGGTGTGTGGG + Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973842408 4:54875625-54875647 AGGAAGATGGCAGGGAGTGATGG + Intergenic
974047036 4:56907355-56907377 AGGGGGAATGCAGTCAGTTTGGG - Intergenic
974062631 4:57049416-57049438 TGGGAGCAGACAGTGAGTTTGGG - Intronic
974070603 4:57119821-57119843 ATGGAGAATGCACTGAGTGAGGG - Intergenic
974102782 4:57436148-57436170 ACGATGATGGCAGTGAGTGTGGG - Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975403719 4:73965812-73965834 AGAGAGAAGGCACAGAGTATGGG - Intergenic
976105402 4:81612125-81612147 GGGCAGAAGGTAGTCAGTGTAGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978319500 4:107478496-107478518 AGTAAGAAGAAAGTGAGTGTAGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978765485 4:112400936-112400958 AGGGAGGTGAGAGTGAGTGTTGG + Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980940345 4:139268133-139268155 AGGGGGAAGGAAGGGAGGGTGGG + Intronic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981521146 4:145663649-145663671 ATGGAGAAGGGAGTGGGAGTAGG + Intergenic
981527125 4:145718051-145718073 AAGGGAAAGCCAGTGAGTGTTGG - Intronic
982077649 4:151753897-151753919 ATGGAGGAAGAAGTGAGTGTGGG - Intronic
982160848 4:152568047-152568069 AGGGAGAGGGCTGTGTATGTGGG - Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982863296 4:160481563-160481585 AGGAAGACGGCAGTGAAAGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983918114 4:173314221-173314243 TGGGAGAAGGCAGAGAGAGGTGG + Intronic
984180825 4:176480449-176480471 AGAGAGAAGTTAGTGAGTGCAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
984938890 4:184914316-184914338 AGGTAGGATCCAGTGAGTGTAGG + Intergenic
985430100 4:189871030-189871052 ACCAAGAAGGCAGTGAATGTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986139581 5:5017416-5017438 ATGGACAAGGGAGTGAGTGGAGG + Intergenic
986459355 5:7954350-7954372 AGTGAAAAGGTAGGGAGTGTGGG + Intergenic
987206058 5:15627288-15627310 AAGCAGAAGGGAGTGGGTGTGGG + Intronic
987294363 5:16537046-16537068 AGGGAGGAGGCAGGCAGGGTGGG - Intronic
987311133 5:16682080-16682102 AGGAAGAAGGCACTGAGTCTCGG - Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
989264370 5:39455900-39455922 AGAGAGAAGGAAGTGAGAGAAGG - Intronic
990319991 5:54620495-54620517 AGCCAGAAGGCAGAGAGTATTGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991403444 5:66277860-66277882 CAGGAGCAGGCAGTGAGTTTTGG + Intergenic
991908011 5:71531458-71531480 TGGGAGAAGGGAGTTGGTGTGGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992984348 5:82212234-82212256 AGAGCAAAGGCAGAGAGTGTGGG - Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993472952 5:88328956-88328978 AAGGAGAAGGCAGTGAGTAGGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994056906 5:95427199-95427221 AGGGAGATGGCAGGAAGTGGTGG + Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994698182 5:103099253-103099275 AGAAAGAAGGGAGAGAGTGTTGG - Intronic
995074180 5:107961566-107961588 TGGGAGTAGGCAGTAAGAGTGGG + Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995406396 5:111801534-111801556 AAGCAGAAGGTAGAGAGTGTTGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996695759 5:126393099-126393121 AGGGAAAAGGTAGTGAAGGTAGG - Intronic
997452792 5:133996898-133996920 TGGGAGCAGGCAGGGAGTGGAGG - Intronic
997511068 5:134454726-134454748 AGGGAGAAGGAAATAAGCGTTGG + Intergenic
997713657 5:136027040-136027062 AAGGAGAAGGGAGAGAGTGTGGG - Intergenic
998124249 5:139605707-139605729 AGGGAGAAGGGAGGGAGAGAGGG - Intronic
998158334 5:139798520-139798542 TGGGAGAAGGAAGGGAGTGGAGG - Intronic
999238887 5:150115951-150115973 AGGAAAGAGGCAGTGAGTGAGGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999353207 5:150897591-150897613 AGGGTGAAGGCAAGCAGTGTTGG - Intronic
999363560 5:151006450-151006472 AAGGAGAAGAAAGTGAGTATGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1000943891 5:167396818-167396840 AGGGCGAAGGCAGACAGTGAAGG + Intronic
1001188168 5:169598180-169598202 AGAGAGAAGGCAGAGCATGTAGG + Intronic
1001315100 5:170636358-170636380 AGGCAGAAGGCAGAGGGTGGCGG + Intronic
1001761103 5:174209043-174209065 AGGGATAAGGGAGTAAGTTTAGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002022265 5:176371440-176371462 AGGGAGAGAGCATTGAGTTTAGG + Intronic
1002671115 5:180868162-180868184 AGTGAGAAGGCTGTGTGTGATGG - Intergenic
1003123622 6:3337979-3338001 TGGGAGAAGGGAGGGAGTCTGGG - Intronic
1003353661 6:5344520-5344542 AGGGAGGAGGCAGTGTGTTATGG + Intronic
1003425997 6:5998924-5998946 CGGGAGCATGGAGTGAGTGTGGG + Exonic
1004649324 6:17593488-17593510 AGGGAGAAGGGAGGGAGGGAGGG - Intergenic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1004770003 6:18770697-18770719 AGACAGAAGGCAGTGGGTATGGG + Intergenic
1004925094 6:20408721-20408743 AGGTAGAAAGCAGTGAGAATTGG + Intronic
1005764688 6:28999452-28999474 AGGTAGAAAGCATTAAGTGTAGG + Intronic
1006265950 6:32923845-32923867 AGAAAGAAGGCAGGGAGTGGTGG + Intergenic
1006496280 6:34425807-34425829 AGGATGAAGCCAGTGAGTGGCGG - Exonic
1006603476 6:35241064-35241086 GGAGAGTAGGCAGTGAGTGAGGG - Intronic
1006863214 6:37187412-37187434 AGCCAGAAGGCAGGGAGTCTGGG + Intergenic
1006938840 6:37738012-37738034 AGGGAGAGGGGAGTGAGTACAGG + Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009339963 6:62541783-62541805 AGGCAGAAGGAGGTGAGTTTTGG - Intergenic
1009756475 6:67946855-67946877 AGGGGGAAGGCAGAGAGAATTGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010122970 6:72400634-72400656 CGGGTGAGGGGAGTGAGTGTGGG - Exonic
1010393292 6:75361060-75361082 AGTGAGAAGGCAGAGAGAGAGGG - Intronic
1011018307 6:82782844-82782866 TGTGAGAAGGATGTGAGTGTGGG + Intergenic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1011495940 6:87936655-87936677 AGGCAGAAGGCAGTGAGAATGGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1013693015 6:112667743-112667765 AGGGAGAAGCCAGGCAGTGGGGG - Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1015289300 6:131520244-131520266 AGGGAGTGGGGAGTGGGTGTGGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016686292 6:146886028-146886050 AGCCAGAAAGCAGTCAGTGTTGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017786707 6:157762691-157762713 AGGGAGGATGCAGTGGGGGTTGG + Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018202939 6:161411914-161411936 AGGGAGGAGTGAGTGAGTGGAGG - Intronic
1018243222 6:161798913-161798935 AGGGTGAGGGCAGTGTGTGGGGG - Intronic
1018420371 6:163635797-163635819 AGTGAGAAGTCAGGGAGTGTGGG + Intergenic
1018648310 6:165968829-165968851 AGGCAGAAGGCAGAGCCTGTAGG + Intronic
1018828478 6:167424279-167424301 GGGGAGGAGGCAGTGAGGGCAGG - Intergenic
1018963888 6:168468458-168468480 AGGGAGAAGGCAGTCGGTGGGGG - Intronic
1019201417 6:170319377-170319399 AGGGAGAAGGCCGGGCGTGGTGG + Intronic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019403814 7:872015-872037 AGGCAGAAGGGAGCGAGTGCCGG - Intronic
1019483504 7:1277080-1277102 AGGGAGAAGGGAGGGAGAGAGGG - Intergenic
1019590233 7:1827209-1827231 TGGGAGAAGGGGCTGAGTGTGGG + Intronic
1019676469 7:2315988-2316010 ATGCAGGATGCAGTGAGTGTGGG - Intronic
1020224915 7:6272463-6272485 AGGGTGGTGGCGGTGAGTGTCGG - Exonic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021533409 7:21674976-21674998 TTGGAGAAGGCAGTGAGAATAGG - Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022326060 7:29333051-29333073 TGTGAGAAGGGAGAGAGTGTGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022967038 7:35483454-35483476 AAGGAGAAGGGAGAGAGTGATGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023931230 7:44707845-44707867 AGGGAGGGGGCAGTGAGGGCAGG - Intronic
1024004217 7:45213311-45213333 AAGGGGATGGGAGTGAGTGTTGG + Intergenic
1024297723 7:47859272-47859294 AGGGAGAAGGCTGTGGGAGGAGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024991619 7:55239121-55239143 AGGGAGAAGGAAGGGAGGGAAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026604676 7:71805518-71805540 AGGGAGCAGACAGTGAGTCAGGG + Intronic
1026902567 7:74045193-74045215 GGGGACAAAGCAGTGAGTGTAGG - Intronic
1026903674 7:74050677-74050699 TGGGAGGAGGCAGTGAGGGAGGG - Intronic
1026977619 7:74508044-74508066 AGGGAGGAGGCAGTGGTGGTGGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029403368 7:100358663-100358685 AGGAAGGAGGGAGTGAGTGGGGG - Intronic
1029852103 7:103473088-103473110 AGGCCAAAGGCAGTGAGTATAGG - Intronic
1029930237 7:104363114-104363136 AGGGAGAAGGGAGTTTGTTTTGG + Intronic
1030158247 7:106479498-106479520 AGGGAGAAGACAAAGAGTTTTGG - Intergenic
1030380015 7:108800867-108800889 AGGGGGAAGGAAGGGAGTGGAGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031378448 7:121056501-121056523 ATGGAAAAGGTACTGAGTGTGGG - Intronic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031653356 7:124319901-124319923 AGGGAGCAGGGAGTGAGGGGAGG + Intergenic
1031676228 7:124615767-124615789 AGGTTGATGGCAGTGAGGGTCGG - Intergenic
1032156661 7:129475175-129475197 CTGGAGAAGGCAGTGGATGTGGG + Intronic
1032511104 7:132473057-132473079 AGGCAGAAGGTAGAGAGAGTGGG + Intronic
1032527856 7:132593515-132593537 AGTGAGAAGGCAGGGAGTCCAGG + Intronic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033459586 7:141533248-141533270 AGGGAGGAGGCAGAAAGTGAGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033542884 7:142373282-142373304 AGGGAGAAGAAAGTGAGATTTGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034883689 7:154781373-154781395 AGGGAGAACGAAGTGAGAGGGGG - Intronic
1036284504 8:7431951-7431973 TGGGGGAAGGAGGTGAGTGTGGG + Intergenic
1036336972 8:7879579-7879601 TGGGGGAAGGAGGTGAGTGTGGG - Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1036712674 8:11091605-11091627 GGGGAGGAGGCAGTGGGAGTTGG + Intronic
1037407743 8:18562074-18562096 AGAGAGAAGGCAGAGAGAATCGG + Intronic
1037616505 8:20523900-20523922 AGGGAGGAGGAGGTGTGTGTGGG + Intergenic
1037674097 8:21039569-21039591 AGGGAGCAGGAAGTGGGCGTGGG - Intergenic
1037701785 8:21282071-21282093 AGCAAACAGGCAGTGAGTGTAGG + Intergenic
1037858548 8:22388698-22388720 AGGGAGAAAGCAGAGGATGTGGG + Intronic
1037924657 8:22834741-22834763 AGGAAGAAGGAAATGAGTGAGGG - Intronic
1038749495 8:30282504-30282526 AGGAGGAAGGCAGTATGTGTAGG - Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1039640118 8:39210227-39210249 AGGGAGAAGGAAGTGTGCATGGG - Intronic
1040040562 8:42912688-42912710 TGGGGGAAGGCAGTGTGTGGTGG - Intronic
1042665196 8:71196425-71196447 AGGGTGAAGGAAGTCATTGTGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043561874 8:81502557-81502579 AGGGAGACTGCTGTGGGTGTGGG - Intergenic
1043914810 8:85909719-85909741 AGGGATAAGGCAGGCAGAGTAGG + Intergenic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045193904 8:99910865-99910887 AGGAAGAAGGGAGGGAGGGTTGG + Intergenic
1045322387 8:101091848-101091870 GGGGAGAAGGCAGTAACTGATGG - Intergenic
1045376346 8:101578238-101578260 AGGGAGGAGGAGGTGGGTGTTGG + Intronic
1045479236 8:102579176-102579198 GGAGAGAAGACAGAGAGTGTGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047222776 8:122931825-122931847 TGGGAGAAGGAAATGAGTGGGGG + Intronic
1047996704 8:130343366-130343388 AGGGAAAAAGGAGTGAGTGTGGG - Intronic
1048032862 8:130649565-130649587 AGGAAGAGGGGAGTGAGGGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048477836 8:134759015-134759037 AGGGAGAAGGGACTGACTATTGG + Intergenic
1048874554 8:138826918-138826940 AAGGAGAAGGCAGTGAAGGCAGG - Intronic
1049272640 8:141704020-141704042 ATGGAGAAGGCAGTGTGAGCTGG + Intergenic
1049400304 8:142423718-142423740 AGTGAGAAGGCAGAAAGTGGAGG - Intergenic
1049762813 8:144338568-144338590 CGGGAGAAGGCGGTGAGCGCTGG - Intergenic
1050958972 9:11703290-11703312 AGGTAGAAGGAATGGAGTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051368436 9:16337853-16337875 AGGGAGAAGGGGGTGAGTTATGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1055383810 9:75739235-75739257 AGGGAGAAGGAAGGCTGTGTAGG - Intergenic
1055729517 9:79266023-79266045 AGAGATAAGGCAATTAGTGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056821922 9:89848634-89848656 ATGGGGAAGGCAGTGGGTGCTGG + Intergenic
1057751082 9:97793738-97793760 AGGTAGCAGGCAGAGAATGTAGG + Intergenic
1057970547 9:99553322-99553344 AAAGTGGAGGCAGTGAGTGTAGG + Intergenic
1058142184 9:101368534-101368556 AGGTAGAAGGCTGAAAGTGTTGG - Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058915070 9:109557648-109557670 AAGGAGAGGGCAGTGAGTCGAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060180783 9:121532207-121532229 AAGGTAAAGGCAGTGAGTCTTGG + Intergenic
1060401829 9:123354040-123354062 CTGGAGAAGGCAGTAAGAGTGGG - Intergenic
1060440553 9:123635014-123635036 GAGGAGAAGGCAGTGGGAGTAGG + Intronic
1060801646 9:126549005-126549027 AAGGAGAAGGCTGAGAGGGTAGG + Intergenic
1061086822 9:128404541-128404563 AGGGAGATGGAAGAGAGTGTTGG - Intergenic
1061127533 9:128686312-128686334 AGGGAGGTGGCAGGGAGGGTTGG + Intronic
1061431766 9:130535743-130535765 AGGGAGATGGCAGAGAGAGCGGG - Intergenic
1061669027 9:132178198-132178220 AGGGAGAAGAAAATGAGGGTGGG - Intronic
1061793126 9:133068938-133068960 AGGAGGAAGGCATTGAGTGGAGG + Intronic
1061795729 9:133084722-133084744 AGGAGGAAGGCATTGAGTGGAGG + Intronic
1062051690 9:134450581-134450603 ATGGGGAAGGCAGTGAGTGTGGG + Intergenic
1062145616 9:134988183-134988205 ATGGAGAAAGCAGGGAGGGTGGG - Intergenic
1062194189 9:135264013-135264035 GGGGAGAGGGCAGGGAGTGGGGG - Intergenic
1062713461 9:137989374-137989396 GGAGAGAAGGAAGTGAGGGTGGG + Intronic
1203736813 Un_GL000216v2:144831-144853 CGGGGGAAGGCAGTGGGGGTGGG - Intergenic
1185914974 X:4025596-4025618 AGGGAGAAGGGAGGGAGAGAGGG - Intergenic
1187080153 X:15977386-15977408 GGGGTGAAGGCTGTGAGTATAGG + Intergenic
1187612270 X:20955506-20955528 AGGGTGCAAGCAGTGAGTCTTGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1187925618 X:24247275-24247297 AAGGAGAAGGCCGGGCGTGTTGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189166126 X:38862889-38862911 AGGAACAAGGCAGTAAGTGGAGG + Intergenic
1189222092 X:39381303-39381325 AGGGAGAAGGGATGGAGTGATGG - Intergenic
1189253403 X:39619013-39619035 AGGGAGAAGGGAGGGAGAGGTGG + Intergenic
1189303005 X:39966428-39966450 AGAGAGAAGCCAATGTGTGTTGG + Intergenic
1189310611 X:40014880-40014902 CGAGAGAGGGCGGTGAGTGTGGG - Intergenic
1189340500 X:40201206-40201228 AGGCAGAAGTCAGTGAGTACCGG - Intergenic
1189644584 X:43114093-43114115 AGGGGGATGGGAGTGAGTGATGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190259024 X:48786514-48786536 AGGGAGAAGGGAGGGAGGGAGGG + Intergenic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1190667101 X:52705823-52705845 AGGGAGAAGTCAGTGAAGGCCGG + Intronic
1190672317 X:52752585-52752607 AGGGAGAAGTCAGTGAAGGCCGG - Intronic
1190822862 X:53990638-53990660 AGGGAAAAAGGAGTGAGAGTAGG - Intronic
1191729229 X:64315377-64315399 AGAGGGAAGGCACTGAGAGTAGG - Intronic
1191729233 X:64315401-64315423 AGAGGGAAGGCACTGAGAGTGGG - Intronic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193092918 X:77513440-77513462 AGAGAGAAGGCAATGAGAGTGGG + Intronic
1193111187 X:77732173-77732195 AGGCACAAGCGAGTGAGTGTGGG - Intronic
1193553272 X:82925025-82925047 AGAGGGAAGGCATTGAGAGTGGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194078331 X:89425966-89425988 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195532287 X:105970326-105970348 AGGGTGCAGGCAGTGAGTCTTGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195725772 X:107914580-107914602 AGAGAAAAGGCATTGAATGTAGG - Intronic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1195774133 X:108384375-108384397 AGGGGCAAGGCAATGAATGTAGG + Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196489444 X:116249327-116249349 AGGGAGGAGGCAATGATTTTTGG - Intergenic
1196740753 X:119023928-119023950 AGAGAGGATGCAGTAAGTGTTGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197369148 X:125604588-125604610 AGTGTAAAGGCAGTGAATGTAGG - Intergenic
1197370737 X:125622386-125622408 AGAGCGAAGGCACTGAGAGTGGG - Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1198028061 X:132728429-132728451 AAGGACAAGGCAGCGGGTGTGGG + Intronic
1198114148 X:133528665-133528687 AGGGAAATGGCAGTGAGCTTTGG - Intergenic
1198134810 X:133738313-133738335 AGGGAGAAAGCAATGACAGTGGG - Intronic
1198301595 X:135339011-135339033 AAGGAGAAGGAAGTGAGGATTGG - Intronic
1198617398 X:138474414-138474436 AGGGAGGTGGCAGTGAATTTGGG + Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199482089 X:148308943-148308965 AGGGAGAAGGTTGTGGGTGGTGG + Intergenic
1199596057 X:149506622-149506644 AGGGAGATGGCAGGAAATGTAGG + Intronic
1199653878 X:149975470-149975492 AGGGAGGAGCCAAAGAGTGTTGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200052079 X:153438881-153438903 CGGCAGCTGGCAGTGAGTGTGGG - Intergenic
1200430974 Y:3081498-3081520 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1200710456 Y:6479878-6479900 AGGGAGAAGGGAGGGAGAGAAGG + Intergenic
1201023481 Y:9682116-9682138 AGGGAGAAGGGAGGGAGAGAAGG - Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic
1201774237 Y:17646349-17646371 AGGAAGAAGGGAGAGAGTGACGG - Intergenic
1201827320 Y:18259640-18259662 AGGAAGAAGGGAGAGAGTGACGG + Intergenic