ID: 1113835888

View in Genome Browser
Species Human (GRCh38)
Location 13:113328250-113328272
Sequence GGGACGGCACCTGCCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113835880_1113835888 7 Left 1113835880 13:113328220-113328242 CCAACACTGTGCATTCATCACCG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 264
1113835878_1113835888 11 Left 1113835878 13:113328216-113328238 CCACCCAACACTGTGCATTCATC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 264
1113835877_1113835888 21 Left 1113835877 13:113328206-113328228 CCTCTGCAAACCACCCAACACTG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 264
1113835876_1113835888 26 Left 1113835876 13:113328201-113328223 CCACGCCTCTGCAAACCACCCAA 0: 1
1: 0
2: 3
3: 11
4: 271
Right 1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 264
1113835879_1113835888 8 Left 1113835879 13:113328219-113328241 CCCAACACTGTGCATTCATCACC 0: 1
1: 0
2: 0
3: 19
4: 164
Right 1113835888 13:113328250-113328272 GGGACGGCACCTGCCTGGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113835888 Original CRISPR GGGACGGCACCTGCCTGGCC AGG Intronic